Primer pair and kit for specifically distinguishing varieties of dendrobium devonianum paxt and application of primer pair and kit

Abstract

The invention relates to the technical field of biology, in particular to a primer pair and a kit for specifically distinguishing varieties of dendrobium devonianum and application of the primer pair and the kit. Sequencing is carried out on chloroplast genomes of dendrobium devonianum paxt varieties (purple jade and jade), six highly variable sites are found, the six highly variable sites comprise psbE-petL, ccsA-psaC, clpP-psbB, psaI-ycf4, trnI-CAU-trnL-CAA and trnT-GGU-psbD, and the two dendrobium devonianum paxt varieties have significant differences. On the basis of the differential sequence, six special specific primer pairs are designed, and the PCR amplification effect of the dendrobium devonianum variety is detected by utilizing the primer pairs. Results show that all primer pairs can obtain PCR products, and the amplification success rate is 100%. The result of further sequencing the PCR product shows that the primer group Primer D5 based on the trnI-CAU-trnL-CAA sequence has remarkable specificity, the difference between two varieties of dendrobium devonianum is most obvious, the sequencing success rate is 100%, and the Primer D5 can be used for specifically distinguishing the varieties of dendrobium devonianum.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a primer pair for specifically distinguishing purple dendrobium varieties, a kit and applications thereof. Background Art

[0002] Dendrobium sw. is one of the largest genera in the Orchidaceae family, with approximately 1,500 species worldwide, primarily distributed in tropical and subtropical Asia and Oceania. China is a key distribution area for Dendrobium, home to approximately 80 species. Dendrobium plants have been used in traditional medicine for thousands of years, primarily to treat symptoms such as loss of body fluids, dry mouth and thirst, insufficient stomach yin, and loss of appetite and retching caused by febrile illnesses. Modern phytochemical and pharmacological research indicates that Dendrobium contains a variety of compounds, including polysaccharides, phenols, terpenes, and alkaloids, exhibiting multiple pharmacological effects, including immunomodulatory, hypoglycemic, hepatoprotective, antioxidant, and anti-fatigue properties.

[0003] Dendrobium devonianum is an important plant with both medicinal and edible properties, and is one of the main varieties used as a medicinal material in southwestern provinces and regions. Morphological differences and variation among individuals within the species are common in nature. Natural hybridization and artificial breeding have increased the diversity and complexity of variation, making morphological classification more difficult. Furthermore, with the widespread collection and continuous accumulation and exchange of Dendrobium devonianum germplasm resources, a large number of homonyms and homonyms have emerged, causing significant inconvenience and confusion in production and research. Therefore, it is essential to develop molecular markers using the chloroplast genome to study Dendrobium devonianum varieties. Establishing rapid, efficient, and accurate Dendrobium devonianum variety identification technology is expected to provide technical support and scientific basis for variety exchange, research, and promotion and application. Summary of the Invention

[0004] In order to solve the above problems, the present invention provides a primer pair, a kit and its application for specifically distinguishing purple Dendrobium varieties. The primer pair provided by the present invention can specifically distinguish purple Dendrobium varieties.

[0005] To achieve the above-mentioned purpose, the present invention is implemented through the following technical solutions:

[0006] The present invention provides primers for specifically distinguishing purple dendrobium varieties. The primer pair comprises an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID No. 9: ATGGTTGTTGCTATCTGCTCC; the nucleotide sequence of the downstream primer R is shown in SEQ ID No. 10: GAGCAATTCCATAACAGATTTCGG.

[0007] The present invention also provides a primer pair, a kit and applications thereof for specifically distinguishing purple dendrobium varieties.

[0008] The present invention also provides the use of the primer pair or the kit in distinguishing varieties of Dendrobium officinale.

[0009] The present invention also provides a method for distinguishing purple dendrobium varieties, comprising the following steps:

[0010] Using the genomic DNA of the sample to be tested as a template, the reaction system was prepared using the above primer pair or the above kit for PCR amplification. After sequencing the PCR product, the software CodonCode Aligner (CodonCode Co., USA) was used for sequence splicing and proofreading. First, the primer regions at both ends of the sequence were removed using the software, and then sequencing quality assessment and preprocessing were performed to obtain the sequence of the target fragment, see SED ID No.13 to SED ID No.18. Purple Dendrobium varieties were distinguished by the differential sites in the sequence. If the sequence at the 100-137bp position of the amplified product is missing, the sample to be tested is jadeite; if the base at the 100-137bp position is CCCGTAGTTGGAAATAACCCATATGGCTAAGATCGAAG, the sample to be tested is purple jade.

[0011] Preferably, the PCR amplification reaction program includes: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 53°C for 30 seconds, and extension at 72°C for 1 minute, for a total of 30 cycles; and finally extension at 72°C for 7 minutes, with a termination temperature of 4°C.

[0012] Preferably, the PCR amplification reaction system, in a volume of 25 μL, includes 2 μL of template DNA, 1 μL of upstream and downstream primers, 15 μL of 2×Taq Plus PCR MasterMix, and 6 μL of ddH2O.

[0013] Preferably, the concentrations of the upstream primer and the downstream primer are both 10 μmol / L.

[0014] Preferably, the concentration of the template is 10 to 30 ng / μL.

[0015] Preferably, the 2×Taq PCR MasterMix was purchased from Beijing Hongyue Innovation Technology Co., Ltd. with the production number DM1220.

[0016] Preferably, the sample to be tested includes fresh tissue and / or dried sample tissue with undegraded DNA.

[0017] Beneficial effects:

[0018] The present invention provides a primer pair for specifically distinguishing purple dendrobium varieties, the primer pair comprising an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID No. 9: ATGGTTGTTGCTATCTGCTCC; the nucleotide sequence of the downstream primer R is shown in SEQ ID No. 10: GAGCAATTCCATAACAGATTTCGG. The present invention discovered 16 highly variable sites, including psbE-petL, ccsA-psaC, clpP-psbB, psaI-ycf4, trnI-CAU-trnL-CAA and trnT-GGU-psbD, through chloroplast genome sequencing, which showed significant differences among purple Dendrobium varieties. The present invention designed specific primer pairs based on the above-mentioned differential sequences, and used the above-mentioned primer pairs to perform PCR amplification and sequencing on purple Dendrobium variety samples. The success rates of amplification and sequencing were both 100%. The sequencing results showed that the primer set Primer D5 of the trnI-CAU-trnL-CAA sequence had the most obvious difference between the two varieties, and could accurately identify purple Dendrobium varieties.

[0019] Specifically, the method of the present invention is as follows:

[0020] (1) Fresh leaves or dried medicinal materials of the purple-skinned Dendrobium species were taken and ground thoroughly with liquid nitrogen. The total DNA of the leaves of the Dendrobium to be tested was extracted using the Polysaccharide and Polyphenol Plant Genomic DNA Extraction Kit (TIANGEN, Beijing, China).

[0021] (2) Using the DNA extracted in step (1) as a template and the molecular specific labeled primers (Primer D5-F, Primer D5-R) as amplification primers, PCR amplification is performed.

[0022] The PCR reaction system for each 25 μL is composed as follows:

[0023] PCR amplification conditions are as follows:

[0024] Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 53°C for 30 s, and extension at 72°C for 1 min, for a total of 30 cycles; finally extension at 72°C for 7 min, with a termination temperature of 4°C.

[0025] (3) Take 6 μL of the amplified product of step (2), spot it on a 1% agarose gel, use a DNA molecular weight standard (DL2000 DNA marker) as a DNA marker, and perform electrophoresis in a 1×TAE buffer. The voltage and electrophoresis time are set to 120V and 30min respectively. After the electrophoresis is completed, the agarose gel is placed on a UV gel imaging analyzer for development. If obvious and clear DNA bands appear in the electrophoresis results, the PCR amplification product can be further sequenced. The software CodonCodeAligner (CodonCode Co., USA) is used to splice and proofread the successfully sequenced sequences. First, the software is used to remove the primer regions at both ends of the sequence, and then the sequencing quality is assessed and preprocessed to obtain the sequence of the target fragment. See SED ID No. 13 to SED ID No. 18. Distinguish the purple Dendrobium varieties by the differential sites in the sequence. If the sequence at the 100-137bp position of the amplified product is missing, the sample to be tested is Jadeite; if the bases at the 100-137bp position are CCCGTAGTTGGAAATAACCCATATGGCTAAGATCGAAG, then the sample to be tested is purple jade.

[0026] The present invention provides a primer pair for specifically distinguishing purple dendrobium varieties, the primer pair comprising an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID No. 9: ATGGTTGTTGCTATCTGCTCC; the nucleotide sequence of the downstream primer R is shown in SEQ ID No. 10: GAGCAATTCCATAACAGATTTCGG. The present invention discovered six highly variable sites, including psbE-petL, ccsA-psaC, clpP-psbB, psaI-ycf4, trnI-CAU-trnL-CAA and trnT-GGU-psbD, through chloroplast genome sequencing, which showed significant differences among purple Dendrobium varieties. The present invention designed specific primer pairs based on the above-mentioned differential sequences, and used the above-mentioned primer pairs to perform PCR amplification and sequencing on purple Dendrobium variety samples. Analysis of the sequencing results showed that the primer group Primer D5 of the trnI-CAU-trnL-CAA sequence had the most obvious difference between the two varieties, and could accurately identify purple Dendrobium varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Gel electrophoresis and sequencing results of the product amplified by Primer D5

[0028] Figure 2 Gel electrophoresis results of the amplified products of the 6 pairs of primers designed DETAILED DESCRIPTION

[0029] The present invention provides a primer pair for identifying purple Dendrobium varieties in a specific region. The primer pair comprises an upstream primer F and a downstream primer R. The nucleotide sequence of the upstream primer F is shown in SEQ ID No. 9: ATGGTTGTTGCTATCTGCTCC; the nucleotide sequence of the downstream primer R is shown in SEQ ID No. 10: GAGCAATTCCATAACAGATTTCGG. The primer pair provided by the present invention can be used to perform PCR amplification on a Dendrobium sample to be tested, and the purple Dendrobium varieties can be specifically distinguished based on the sequencing results of the amplified products.

[0030] The present invention also provides a kit for specifically distinguishing purple Dendrobium varieties, the kit comprising the above-mentioned primer pair. The kit provided by the present invention can specifically distinguish purple Dendrobium varieties. The specific principles are the same as above and will not be repeated here.

[0031] The present invention also provides the use of the above primer pair or the above kit in distinguishing purple Dendrobium varieties. The primer pair or kit provided by the present invention can specifically distinguish purple Dendrobium varieties. The specific principles are the same as above and will not be repeated here.

[0032] The present invention also provides a method for distinguishing purple dendrobium varieties, comprising the following steps:

[0033] Using the genomic DNA of the sample to be tested as a template, the PCR reaction system is prepared using the above-mentioned primer pair or the above-mentioned kit, and PCR amplification and sequencing are performed; after sequencing the PCR product, the software CodonCode Aligner (CodonCode Co., USA) is used for sequence splicing and proofreading. First, the primer regions at both ends of the sequence are removed using the software, and then sequencing quality assessment and preprocessing are performed to obtain the sequence of the target fragment, see SED ID No.13 to SED ID No.18. If the sequence at the 100-137bp position of the amplified product is missing, the sample to be tested is jadeite; if the base at the 100-137bp position is CCCGTAGTTGGAAATAACCCATATGGCTAAGATCGAAG, the sample to be tested is purple jade.

[0034] In the present invention, the sample to be tested preferably includes fresh tissue and / or dried medicinal material tissue with undegraded DNA; the fresh tissue or dried medicinal material tissue preferably includes one or more of roots, stems, leaves and flowers.

[0035] In the present invention, the amplification reaction system is 25 μL, preferably including 2 μL of template DNA, 1 μL of upstream and downstream primers, 15 μL of 2×Taq Plus PCR MasterMix, and 6 μL of ddH2O; the concentration of the template DNA is preferably 10-30 ng / μL.

[0036] The present invention has no special requirements on the sources of the various reagents in the PCR amplification reaction system, and commercially available products known to those skilled in the art can be used. The 2×Taq PCR MasterMix used in the present invention and examples was purchased from Beijing Hongyue Innovation Technology Co., Ltd., with the production number DM1220.

[0037] To further illustrate the present invention, the following examples provide a detailed description of a primer pair, a kit, and its application for specifically distinguishing purple Dendrobium varieties provided by the present invention. The following examples are provided for a better understanding of the present invention and are not intended to limit the present invention to the best mode of implementation. They do not limit the content and scope of the present invention. Any product identical or similar to the present invention that is derived by anyone under the guidance of the present invention or by combining the features of the present invention with those of other prior arts is within the scope of the present invention.

[0038] Example 1

[0039] A primer pair for specifically distinguishing purple dendrobium varieties, comprising an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID No. 9: ATGGTTGTTGCTATCTGCTCC; the nucleotide sequence of the downstream primer R is shown in SEQ ID No. 10: GAGCAATTCCATAACAGATTTCGG.

[0040] Example 2

[0041] A method for distinguishing purple dendrobium varieties, comprising the following steps:

[0042] 1. Extraction of total DNA from samples to be identified

[0043] (1) Weigh 2 g of fresh leaves (seedlings), rinse the leaves with sterile distilled water, and dry them with filter paper;

[0044] (2) Liquid nitrogen was added to fully grind the tissue, and other operations were performed according to the Polysaccharide and Polyphenol Plant Genomic DNA Extraction Kit (TIANGEN, Beijing, China).

[0045] (3) DNA quality was tested by agarose gel electrophoresis and NanoDrop 2000 / 2000C spectrophotometer. The final concentration was maintained at 10–30 ng / μL and stored at −20°C until use.

[0046] 2. PCR Amplification

[0047] Using the total DNA extracted in step 1 as a template, a reaction system was prepared using the primer pairs designed in Example 1 for PCR amplification. The amplification system consisted of 25 μL of template DNA, 1 μL each of upstream and downstream primers, 15 μL of 2×Taq Plus PCR Master Mix, and 6 μL of ddH2O. The template DNA concentration was preferably 10 to 30 μL. The PCR amplification reaction procedure was as follows: initial denaturation at 94°C for 5 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 53°C for 30 seconds, and extension at 72°C for 1 minute. Finally, an extension at 72°C for 7 minutes was performed, with a stop temperature of 4°C.

[0048] 3. Amplification product determination

[0049] The PCR amplification product obtained in step 2 is subjected to gel electrophoresis. If obvious and clear DNA bands appear in the electrophoresis results and the length of the amplification product is 200 to 700 bp, the PCR amplification product can be further sequenced and compared.

[0050] 4. Sequencing

[0051] The PCR amplification product obtained in step 3 was subjected to Sanger bidirectional sequencing on an Applied BiosystemsTM 3730XL sequencer. After sequencing the PCR product, the software CodonCode Aligner (CodonCode Co., USA) was used for sequence splicing and proofreading. First, the primer regions at both ends of the sequence were removed using the software, and then sequencing quality assessment and preprocessing were performed, that is, the low-quality parts at both ends of the sequencing results were removed to obtain the sequence of the target fragment, see SED ID No.13 to SED ID No.18. If the sequence at the 100-137bp position of the amplified product is missing, the sample to be tested is emerald; if the base at the 100-137bp position is CCCGTAGTTGGAAATAACCCATATGGCTAAGATCGAAG, the sample to be tested is purple jade.

[0052] Depend on Figure 1 It can be seen that the method provided by the present invention can accurately distinguish the varieties of Dendrobium officinale.

[0053] Comparative Example 1

[0054] To obtain specific primers with good discrimination, we used the mVISTA online tool to perform a global alignment of the full-length chloroplast genomes of the purple Dendrobium varieties. Based on the differences between the two samples, we manually selected candidate regions and designed six pairs of primers. The specific primer information is shown in Table 1.

[0055] Table 1 Specific sequences, positions and amplification product sizes of the six primer pairs Note: Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0056] Comparative Example 2

[0057] In order to screen the special specific primer pairs, the six pairs of primers in Comparative Example 1 were selected respectively, and the purple Dendrobium varieties were amplified using a method similar to Example 2. The electrophoresis results are shown in FIG. Figure 2 Further sequencing analysis revealed that the Primer D5 primer pair (Primer D5-F and Primer D5-R, i.e., the primer pair designed in Example 1) could most intuitively and clearly distinguish the varieties of Dendrobium officinale.

[0058] In summary, the primer pairs or kit provided by the present invention can specifically distinguish Dendrobium officinale varieties.

[0059] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

[0060] Sequence Listing

[0061] School of Pharmacy, Dali University

[0062] A primer pair, kit and application thereof for specifically distinguishing purple dendrobium varieties 18 1 25

[0066] DAN

[0067] Artificial Sequence

[0068] GAATCAGTATAGCTATCCTTCCTCT 25 2 18

[0071] DAN

[0072] Artificial Sequence

[0073] TGAACCGAACCTCCAAAG 18 3 18

[0076] DAN

[0077] Artificial Sequence

[0078] ACAAGAGAAGCCATCGAG 18 4 19

[0081] DAN

[0082] Artificial Sequence

[0083] ATCGTATCCTGCAGCATT 19 5 twenty two

[0086] DAN

[0087] Artificial Sequence

[0088] AGGACTGGAAGGTTCATAGAAG 22 6 19

[0091] DAN

[0092] Artificial Sequence

[0093] AGACCGTGTATTTCACCTG 19 7 twenty one

[0096] DAN

[0097] Artificial Sequence

[0098] CAACACTGGATCATCATACAG 21 8 twenty one

[0101] DAN

[0102] Artificial Sequence

[0103] CTAGATCCAGTTGCATTCGAT 21 9 twenty one

[0106] DAN

[0107] Artificial Sequence

[0108] ATGGTTGTTGCTATCTGCTCC 21 10 twenty four

[0111] DAN

[0112] Artificial Sequence

[0113] GAGCAATTCCATAACAGATTTCGG 24 11 19

[0116] DAN

[0117] Artificial Sequence

[0118] CTACTTCGCCATTGTTCCT 19 12 20

[0121] DAN

[0122] Artificial Sequence

[0123] AGGACTAATCGAGTCGAACT 20 13 593

[0126] DAN

[0127] Artificial Sequence

[0128] TCATTGGTTTCATTGAATAACTAAAGAAGATAGATAGACCTTTCTCTTCGTCTCAGGTCGATGGATCTCCTCAATTGGAAGATCTCCCATATGGATAATACACATTCCAGTTGACCGAGCCTAATTCTAATTGCTTTGTTCCGAAGCAAAGATATCCACGGAGGCGGGTTCGTCCTATTCAGATATTCACGACCAAGAGATACGATCCTCTTTCGGATAGGCCCTGAAAGGAGAAGGAAGGCTGGAATGCCAACAGACGTCTGTCTATTCTCTAATTCACCCGACCCGATAGTACCCATTTTGAGAACGTCCAGTGCCAAAGTCACTGAATGGGTAAGTCGCCAATCCCTAATGTAATGTACTTTCTTTGCTGGGTTACGGGTACTGGTGGGTATTTTACCAGAGGTTTCTATCAATCTACCTTGTGCGATTCCTGTTGAATCCTATACTCGGGGGGTGCGCGCAGGGCGGACGATTTCCAAACGGACTCCTATAGAGAAGATCGCCAAGATTTCGTGATCCGCTGCCGATTCCAACAGCTCGGACTCGGATCGTGAGGATCGCCGGAATACTTCGTATCAACAGATAAGATACTCGTCAATATTGATTAGAT 593 14 593

[0131] DAN

[0132] Artificial Sequence

[0133] TCATTGGTTTCATTGAATAACTAAAGAAGATAGATAGACCTTTCTCTTCGTCTCAGGTCGATGGATCTCCTCAATTGGAAGATCTCCCATATGGATAATACACATTCCAGTTGACCGAGCCTAATTCTAATTGCTTTGTTCCGAAGCAAAGATATCCACGGAGGCGGGTTCGTCCTATTCAGATATTCACGACCAAGAGATACGATCCTCTTTCGGATAGGCCCTGAAAGGAGAAGGAAGGCTGGAATGCCAACAGACGTCTGTCTATTCTCTAATTCACCCGACCCGATAGTACCCATTTTGAGAACGTCCAGTGCCAAAGTCACTGAATGGGTAAGTCGCCAATCCCTAATGTAATGTACTTTCTTTGCTGGGTTACGGGTACTGGTGGGTATTTTACCAGAGGTTTCTATCAATCTACCTTGTGCGATTCCTGTTGAATCCTATACTCGGGGGGTGCGCGCAGGGCGGACGATTTCCAAACGGACTCCTATAGAGAAGATCGCCAAGATTTCGTGATCCGCTGCCGATTCCAACAGCTCGGACTCGGATCGTGAGGATCGCCGGAATACTTCGTATCAACAGATAAGATACTCGTCAATATTGATTAGAT 593 15 593

[0136] DAN

[0137] Artificial Sequence

[0138] TCATTGGTTTCATTGAATAACTAAAGAAGATAGATAGACCTTTCTCTTCGTCTCAGGTCGATGGATCTCCTCAATTGGAAGATCTCCCATATGGATAATACACATTCCAGTTGACCGAGCCTAATTCTAATTGCTTTGTTCCGAAGCAAAGATATCCACGGAGGCGGGTTCGTCCTATTCAGATATTCACGACCAAGAGATACGATCCTCTTTCGGATAGGCCCTGAAAGGAGAAGGAAGGCTGGAATGCCAACAGACGTCTGTCTATTCTCTAATTCACCCGACCCGATAGTACCCATTTTGAGAACGTCCAGTGCCAAAGTCACTGAATGGGTAAGTCGCCAATCCCTAATGTAATGTACTTTCTTTGCTGGGTTACGGGTACTGGTGGGTATTTTACCAGAGGTTTCTATCAATCTACCTTGTGCGATTCCTGTTGAATCCTATACTCGGGGGGTGCGCGCAGGGCGGACGATTTCCAAACGGACTCCTATAGAGAAGATCGCCAAGATTTCGTGATCCGCTGCCGATTCCAACAGCTCGGACTCGGATCGTGAGGATCGCCGGAATACTTCGTATCAACAGATAAGATACTCGTCAATATTGATTAGAT 593 16 592

[0141] DAN

[0142] Artificial Sequence

[0143] CTTTCTCTTCGTCTCAGGTCGATGGATCTCCTCAATGGCCTGATCTCCCATATGGGTTMTATGCATTCCCGTAGTTGGAASATAACCCATATGGCTAAGATMCGAAGCAGTTGACTCCGCGTAATTCTAATTGCTTTGTTCCGAAGCAAAGATATCAGAGAAGGCGGGTTCGTCCTATTAGGATATTCACGAMCAAGAGATACGATCCTCTTTCGGATAGTCCCTGAAAGGAGAAGGAAGGCTGGAATGCCAACAGACGTCTGTCTATTCTCTAATTCACCCGACCCGATAGTACCCATTTTGAGAACGTCCAGTGCCAAAGTCACTGAATGGGTAAGTCGCCAATCCCTAATGTAATGTACTTTCTTTTCTGGGTTACGGGTACTGGTGGGTATTTTACCAGAGGTTTCTATCAATCTACCTTGTGCGATTCCTGTTGAATCCTATACTCGGGGGGTGCGCGCAGGGCGGACGATTTCCAAACGGACTCCTATAGAGAAGATCGCCAAGATTTCGTGATCCGCTGCCGATTCCAACAGCTCGGACTCGGATCGTGAGGATCGCCGGAATACTTCGTATCAACAGATAAGATACTCGTCAATATTGATTAGAT 592 17 592

[0146] DAN

[0147] Artificial Sequence

[0148] CTTTCTCTTCGTCTCAGGTCGATGGATCTCCTCAATGGCCTGATCTCCCATATGGGTTMTATGCATTCCCGTAGTTGGAASATAACCCATATGGCTAAGATMCGAAGCAGTTGACTCCGCGTAATTCTAATTGCTTTGTTCCGAAGCAAAGATATCAGAGAAGGCGGGTTCGTCCTATTAGGATATTCACGAMCAAGAGATACGATCCTCTTTCGGATAGTCCCTGAAAGGAGAAGGAAGGCTGGAATGCCAACAGACGTCTGTCTATTCTCTAATTCACCCGACCCGATAGTACCCATTTTGAGAACGTCCAGTGCCAAAGTCACTGAATGGGTAAGTCGCCAATCCCTAATGTAATGTACTTTCTTTTCTGGGTTACGGGTACTGGTGGGTATTTTACCAGAGGTTTCTATCAATCTACCTTGTGCGATTCCTGTTGAATCCTATACTCGGGGGGTGCGCGCAGGGCGGACGATTTCCAAACGGACTCCTATAGAGAAGATCGCCAAGATTTCGTGATCCGCTGCCGATTCCAACAGCTCGGACTCGGATCGTGAGGATCGCCGGAATACTTCGTATCAACAGATAAGATACTCGTCAATATTGATTAGAT 592 18 592

[0151] DAN

[0152] Artificial Sequence

[0153] CTTTCTCTTCGTCTCAGGTCGATGGATCTCCTCAATGGCCTGATCTCCCATATGGGTTMTATGCATTCCCGTAGTTGGAASATAACCCATATGGCTAAGATMCGAAGCAGTTGACTCCGCGTAATTCTAATTGCTTTGTTCCGAAGCAAAGATATCAGAGAAGGCGGGTTCGTCCTATTAGGATATTCACGAMCAAGAGATACGATCCTCTTTCGGATAGTCCCTGAAAGGAGAAGGAAGGCTGGAATGCCAACAGACGTCTGTCTATTCTCTAATTCACCCGACCCGATAGTACCCATTTTGAGAACGTCCAGTGCCAAAGTCACTGAATGGGTAAGTCGCCAATCCCTAATGTAATGTACTTTCTTTTCTGGGTTACGGGTACTGGTGGGTATTTTACCAGAGGTTTCTATCAATCTACCTTGTGCGATTCCTGTTGAATCCTATACTCGGGGGGTGCGCGCAGGGCGGACGATTTCCAAACGGACTCCTATAGAGAAGATCGCCAAGATTTCGTGATCCGCTGCCGATTCCAACAGCTCGGACTCGGATCGTGAGGATCGCCGGAATACTTCGTATCAACAGATAAGATACTCGTCAATATTGATTAGAT 592。

Claims

1. The present invention provides a primer pair for specifically distinguishing purple dendrobium varieties, characterized in that: The primer pair includes an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID No.9: ATGGTTGTTGCTATCTGCTCC; the nucleotide sequence of the downstream primer R is shown in SEQ ID No.10: GAGCAATTCCATAACAGATTTCGG.

2. A kit for specifically distinguishing purple dendrobium varieties, characterized in that: The kit contains the primer pair described in claim 1, and the kit can specifically distinguish the varieties of Dendrobium officinale.

3. Use of the primer pair according to claim 1 or the kit according to claim 2 in distinguishing varieties of Dendrobium officinale.

4. A method for specifically distinguishing purple dendrobium varieties, comprising the following steps: The genomic DNA of the sample to be tested is used as a template, and the reaction system is prepared using the above primer pair or kit to perform PCR amplification. After sequencing the PCR product, the sequence is compared, and the purple dendrobium varieties are distinguished by the difference sites in the sequence. If the sequence at the position of 100 to 137 bp of the amplified product is missing, the sample to be tested is jadeite; if the base at the position of 100 to 137 bp is CCCGTAGTTGGAAATAACCCATATGGCTAAGATCGAAG, the sample to be tested is purple jade.

5. The method for specifically distinguishing purple dendrobium varieties according to claim 4, characterized in that: The PCR amplification reaction procedure includes: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 53°C for 30 seconds, extension at 72°C for 1 minute, for a total of 30 cycles; and finally extension at 72°C for 7 minutes, with a termination temperature of 4°C.

6. A method for specifically distinguishing purple dendrobium varieties according to claim 4 or 5, characterized in that: The PCR amplification reaction system is 25 μL, including 2 μL of template DNA, 1 μL of upstream and downstream primers, 15 μL of 2×Taq Plus PCRMasterMix, and 6 μL of ddH2O.

7. The method according to claim 6, characterized in that The concentrations of the upstream primer and the downstream primer are both 10 μmol / L; the concentration of the template is 10-30 ng / μL.

8. The method according to claim 6, characterized in that The 2×Taq PCR MasterMix was purchased from Beijing Hongyue Innovation Technology Co., Ltd. and the product number was DM1220.

9. The method according to claim 4, characterized in that The sample to be tested includes fresh tissue and / or dry sample tissue with undegraded DNA.

Images