Soybean pod cracking resistance related molecular marker and application thereof

Abstract

The invention discloses research of Pdh1 allelic variation in soybean breeding material distribution and pod cracking resistance, and pod cracking severely affects improvement of soybean productivity and is one of important indexes of soybean breeding selection. The invention discloses a high-quality anti-pod-cracking soybean breeding identification marker Pdh1-2 gene, the Pdh1-2 gene is a variation type of a Pdh1 gene, the base sequence of the Pdh1 gene is as shown in SEQ ID NO.2, and the base sequence of the Pdh1-2 gene is as shown in SEQ ID NO.3. The invention also discloses a preparation method of the high-quality anti-pod-cracking soybean breeding identification marker Pdh1-2 gene. The practicability of the Pdh1-2 variation type is further explored. 1118 breeding strains are randomly selected, the proportions of split pods and non-split pods of variation types are respectively counted, and the result shows that 975 parts of materials are Pdh1-1 and Pdh1-3 variation types, and 143 parts of materials are Pdh1-2 variation types. The combined phenotypic analysis shows that the proportion of the Pdh1-2 split pod material is the maximum and is 84.6%, the proportion of the Pdh1-1 is 81.0%, and the proportion of the Pdh1-3 is the minimum and is only 41.1%. The research provides a theoretical basis for breeding of southern anti-pod-cracking soybeans assisted by the molecular marker.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering and genetic breeding, and particularly relates to a method for selecting high-quality and anti-shattering soybean breeding materials by using the distribution of Pdh1 allelic variations in soybeans. Background Art

[0002] Soybean (Glycine max (L.) Merr.) is an important crop for both food and oil, as well as for feeding livestock, and is an important source of edible vegetable oil and plant protein. To meet the growing population demand and the need for a high-quality living standard, it is estimated that soybean production must double by 2050. Shattering can improve the environmental adaptability and reproductive ability of wild plants in natural conditions and plays an important role in the seed dispersal process of flowering plants such as legumes. There is a saying in the soybean industry that "soybeans are grown in the south and propagated in the north". That is, due to climate problems in southern regions such as Jiangxi, the germination rate of soybean seeds for seed production is relatively low, and they often need to be sent to the north for seed production. However, due to the climate differences between the north and the south, especially the difference in precipitation, when anti-shattering materials selected in southern regions are planted in dry areas in the north, a relatively high shattering rate will be shown. This will seriously hinder the breeding process of high-quality and high-yield soybeans. Moreover, existing research shows that the proportion of varieties containing the major anti-shattering gene selected in southern regions is much lower than that in the north and the Huang-Huai-Hai region (Dou Ling, Hao Qingnan, Yang Zhonglu, et al. Distribution of the anti-shattering gene pdh1 in varieties jointly tested in the middle and lower reaches of the Yangtze River [J]. Chinese Journal of Oil Crop Sciences, 2023, 45(4): 704.). Therefore, it is crucial to select anti-shattering soybean varieties based on artificial selection combined with molecular marker-assisted selection for the breeding of high-quality, high-yield, and multi-resistant soybean varieties in the later stage.

[0003] Currently, preliminary studies have been conducted on soybean shattering cells and related molecular mechanisms. Previous research reports suggest that soybean shattering may be controlled by three genes. However, the results of reverse genetics studies indicate that soybean shattering is controlled by multiple genes in various ways, such as by affecting the biosynthesis and abscission process of the secondary cell wall of pods. In addition, the results of forward genetics studies show that this trait is controlled by a major quantitative trait locus (QTL) and several minor QTLs. Bailey et al. (in 1997) in F 4Twelve RFLP (Restriction Fragment Length Polymorphism) markers related to pod dehiscence were identified in the RIL population. These markers were located on chromosomes 2, 15, 16, and 19, respectively. Among them, the QTL located on chromosome 16 was identified as the major QTL. Further analysis found that this major QTL (qPDH1) was located between the SSR (Simple Sequence Repeat) markers Sat_093 and Sat_366 on linkage group J. In recent studies, qPDH1 was also detected in populations with different genetic backgrounds, and a dirigent protein named Pdh1 was found at this locus. It was found that the Pdh1 defective gene with a premature stop codon could enhance the level of resistance to pod dehiscence, while the fully functional gene would increase the torsion of the dry pod wall, resulting in pod dehiscence. Through genome-wide association analysis of the anti-pod dehiscence phenotype of soybean cultivation, it was found that pdh1 could enhance the resistance to pod dehiscence of varieties in the Huang-Huai-Hai region and the middle and lower reaches of the Yangtze River. For arid regions such as Northeast China, the joint action of Pdh1 and NST1A was required. It was also found that the epistatic interaction between Pdh1 and NST1A played a key role in the level of soybean resistance to pod dehiscence, and humidity shaped the distribution of non-dehiscence alleles.

[0004] In this study, 1120 advanced-generation soybean breeding materials obtained from hybrid combinations of variety resources in different planting ecological regions were used to identify the pod dehiscence of the breeding materials in Nanchang and Xinxiang respectively, and to analyze the distribution characteristics of the anti-pod dehiscence gene Pdh1 in the breeding materials, so as to understand the anti-pod dehiscence performance of breeding materials combined with variety resources from different sources, and provide a theoretical basis for the selection of anti-pod dehiscence varieties. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for selecting high-quality anti-pod dehiscence soybean breeding materials by using the distribution of Pdh1 allelic variations in soybeans.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The present invention discloses a high-quality anti-pod dehiscence soybean selection and identification marker Pdh1-2 gene, and the Pdh1-2 gene is a variant type of the Pdh1 gene. The base sequence of the Pdh1 gene is shown in SEQ ID NO.2, and the base sequence of the Pdh1-2 gene is shown in SEQ ID NO.3. The physical position of the Pdh1-2 variation site in the soybean reference genome Glycine max Wm82.a2.v1 version is Chr16-29944247; the nucleotide of the SNP site is a C / T variation, resulting in a V / I amino acid substitution.

[0008] Furthermore, the present invention discloses a method for breeding the identification markers as described in claim 1, comprising the following steps:

[0009] (1) Selection of parental combinations of breeding materials: Select four parents, namely southern variety resources, Huang-Huai-Hai variety resources, Northeast variety resources, and foreign introduced variety resources, for hybridization in different combinations;

[0010] (2) Conduct field trials in Nanchang and Xinxiang. At each location, identify the pod shattering phenotypes of each treatment respectively one week before harvest and at harvest time;

[0011] (3) Amplify and sequence the Pdh1 gene of each treatment. According to the sequencing results, divide the Pdh1 gene of each treatment into three mutation types: Pdh1-1, Pdh1-2, and Pdh1-3; the Pdh1-1 contains a fully functional Pdh1 gene, the Pdh1-2 contains a mutated Pdh1 gene with a sense mutation, and the Pdh1-3 contains a defective Pdh1 gene with a premature termination codon.

[0012] The amino acid sequence of the Pdh1-1 protein is consistent with the Pdh1 reference sequence. In Pdh1-2, a C / T variation occurs at the 320th position of the open reading coding frame, resulting in a V / I amino acid substitution; in Pdh1-3, an A / T occurs at the 91st position, resulting in premature termination of Pdh1 translation. The nucleotide sequence of the Pdh1 gene is as shown in SEQ ID NO.2, the nucleotide sequence of the Pdh1-2 gene is as shown in SEQ ID NO.3, and the nucleotide sequence of the Pdh1-3 gene is as shown in SEQ ID NO.1.

[0013] Furthermore, the present invention discloses a method for screening the identification markers as described in claim 1, which uses the different lengths of the fragments cut by restriction enzymes NheI and AasI to distinguish different mutation types.

[0014] To further verify the prediction results, the present invention respectively selected three representative materials with different mutation types for enzyme digestion treatment. The results of agarose gel analysis showed that, as expected, the Pdh1-3 mutation type containing both 91T and 320C sites could be distinguished by three distinct bands, while Phd1-2 without both could not be digested by the endonuclease and showed the same amplification band as PCR. The fragment Pdh1-1 containing the 320C site showed a band smaller than the PCR amplification fragment size due to digestion by AasI. In summary, the newly developed AasI in this study will contribute to the identification of the Pdh1-1 mutation type.

[0015] Furthermore, the above-mentioned identification marker Pdh1-2 gene was applied to the breeding of high-quality and anti-shattering soybean; the specific primer sequences of the identification marker Pdh1-2 gene are shown in SEQ ID NO.4-5.

[0016] The advantages of the present invention are as follows: This study reveals the contribution of variety combinations in different planting ecological regions to the anti-shattering characteristics of offspring, as well as the influence of the introduction of different variant types of the major anti-shattering gene Pdh1 on the anti-shattering characteristics of the selected varieties. It is revealed that selecting varieties in the Huang-Huai-Hai and Northeast planting ecological regions with a relatively high distribution frequency of the anti-shattering variant type Pdh1-3 as parental materials can strengthen the introduction and utilization of anti-shattering genes. Finally, 319 selected materials screened in this study carry both the anti-shattering variant type Pdh1-3 and exhibit an anti-shattering phenotype, laying a good foundation for the breeding of high-quality, high-yield, and multi-resistant soybean varieties in the later stage. Brief Description of the Drawings

[0017] Figure 1 For the statistical analysis of the anti-shattering phenotype distribution of the test materials in Nanchang (a) and Xinxiang (b) and the drawing of the Venn diagram (c).

[0018] Figure 2 For the sequence alignment of Pdh1 variant types.

[0019] Figure 3 For the statistical analysis of the variant types of Pdh1 in breeding materials.

[0020] Figure 4 For the NheI and AasI enzyme digestion typing of different variant types of Pdh1.

[0021] Figure 5 For the correlation analysis between the anti-shattering phenotype and the Pdh1 variant type.

[0022] Figure 6 For the statistics of cracking and non-cracking materials of each variant type. Detailed Embodiments

[0023] 1.1 Experimental Materials

[0024] 1120 high-generation soybean breeding materials for testing, derived from 38 hybrid combinations, including Southern China (SC), Huang-Huai-Hai (HHH), Northeast China (NEC) and foreign introduced variety resources (FC). The number of breeding materials for hybrid combinations between variety resources in each planting ecological region is shown in Table 1.

[0025] Table 1 Number of hybrid combinations between varieties in different planting ecological regions

[0026]

[0027] 1.2 Experimental design

[0028] Field experiments were conducted in Nanchang (28°40′N, 115°53′E) and Xinxiang (35°18′N, 113°53′E) in the autumn of 2023, representing the planting environments in the south and north respectively. Each material was planted in a single row with a plant spacing of 8 cm and a row spacing of 40 cm. The experimental fields were managed according to local agronomic measures to ensure suitable conditions for moisture, fertilizer, pest and disease control, etc.

[0029] 1.3 Shattering property identification

[0030] At each location, the shattering property of each treatment was identified one week before harvest and at harvest time. Each time of identification, 10 plants of each treatment were randomly collected, and the total number of pods and the number of shattered pods of all plants were recorded, and the shattering rate (total number of shattered pods / total number of pods × 100%) was calculated. According to the shattering rate, the shattering property of each treatment was divided into four grades: grade 3, no shattering; grade 5, shattering rate less than or equal to 9%; grade 7, shattering rate 9% - 25%; grade 9, shattering rate above 25%.

[0031] 1.4 Identification of variant types of anti-shattering gene Pdh1

[0032] Take 50 - 100 mg of leaf tissue from mature plants, extract genomic DNA using the TSINGKE plant DNA extraction kit, and dilute the extracted DNA to 30 ng / μL; use the PCR (Polymerase Chain Reaction) method to amplify and sequence the Pdh1 gene of each treatment. Use the specific primers Pdh1-F: GAAGGACCATAGGACCCGATATA and Pdh1-R: TTTTCATGTCACCAACACTCG for the Pdh1 (Glyma.16G141400) gene. The PCR loading system is 40 μL, and the DNA template concentration is 30 ng / μL. The reaction system is pre-denatured at 98℃, and then undergoes 35 cycles of 98℃ for 10 s, 60℃ for 10 s, 72℃ for 20 s; the extension of the last cycle is 72℃ for 5 min. The PCR products are directly sent for sequencing. According to the sequencing results, the Pdh1 gene of each treatment is divided into three variant types: Pdh1-1 (containing a fully functional Pdh1 gene), Pdh1-2 (containing a Pdh1 mutant gene with a sense mutation), Pdh1-3 (containing a Pdh1 defective gene with a premature stop codon), and further use DNAMAN to analyze the restriction enzyme sites of different variant types of Pdh1.

[0033] 1.5 Data processing and analysis

[0034] The sequencing results were aligned with the Pdh1 gene sequence in Phytozome v2.0 (w82.a2.v2) using the clustalw2 software. Among those with an A at the 91st base within the open reading frame, they were pod - splitting varieties, and those with a T at the 91st base were anti - pod - splitting varieties. The R package GGally was used to analyze the correlation between samples and between samples and Pdh1 mutation types, and the R package ggplot2 was used to visualize the correlation results.

[0035] Example 1: Identification of anti - pod - splitting phenotype

[0036] The results of the anti - pod - splitting property identification of breeding materials in Nanchang showed ( Figure 1 ), among 901 materials, the anti - pod - splitting grade was 3 (i.e., anti - pod - splitting materials), 158 materials had an anti - pod - splitting grade of 5, 29 materials had an anti - pod - splitting grade of 7, and 32 materials had an anti - pod - splitting grade of 9. The corresponding number of materials in the Xinxiang area for each grade was 612, 144, 216, and 148 respectively. Among them, 536 materials showed anti - pod - splitting property in both areas, 365 materials showed anti - pod - splitting property only in the Nanchang area, and 76 materials showed anti - pod - splitting property only in the Xinxiang area.

[0037] By evaluating the anti - pod - splitting property of variety resources hybrid breeding materials in different planting ecological regions, this study found that variety resources in the Huang - Huai - Hai planting ecological region, variety resources in the Northeast planting ecological region, and foreign variety resources had more advantages in anti - pod - splitting as parental breeding materials (Table 2). Among the anti - pod - splitting materials (grade 3), the two parental variety resource combination types with the highest proportions were HHH×FC (88.61%) and HHH×NEC (82.63%) (Table 2). While the proportions of anti - pod - splitting materials in the SC×SC and SC_HHH combination materials were the lowest, accounting for 60.58% and 58.70% of the same combination types respectively (Table 2).

[0038] Table 2 Statistical analysis of anti - pod - splitting phenotypes of parental combinations of different planting ecological region types

[0039]

[0040] Example 2: Analysis of pdh1 mutation types

[0041] After DNA extraction, PCR amplification, and sequencing of each sample, a total of three mutation types were detected ( Figure 2 , Figure 3), namely Pdh1-1(91A / 320C), Pdh1-2(91A / 320T), and Pdh1-3(91T / 320C). The protein sequence of Pdh1-1 is identical to the Pdh1 reference sequence. In Pdh1-2, the C / T variation at the 320th position of the open reading coding frame results in an amino acid substitution of V / I. In Pdh1-3, the A / T at the 91st position leads to premature termination of Pdh1 translation.

[0042] Example 3 Analysis of the Distribution of Pdh1 Mutation Types in Breeding Materials of Variety Resources Combinations in Different Planting Ecological Regions

[0043] Among all the detected Pdh1 mutation types ( Figure 3 ), the distribution quantity proportion of the Pdh1-1 mutation type is the highest, accounting for 56.96% of all samples. The proportion of the Pdh1-3 mutation type is the second highest, at 32.23%, and the proportion of the Pdh1-2 mutation type is the lowest, only accounting for 10.80%.

[0044] Further statistics were made on the distribution of the three Pdh1 mutation types in the breeding materials of parental hybrid combinations in different planting ecological region types (Table 3). The results show that except for HHH×NEC, the proportion of the Pdh1-1 mutation type is the highest in the offspring of all hybrid combinations, reaching more than 51%. The proportion of the Pdh1-2 mutation type is relatively high in the SC_FC and SC×SC combinations, and is at the lowest level in the remaining combinations. The anti-cracking pod mutation type Pdh1-3 is mainly concentrated in the offspring of the HHH×NEC and SC×NEC hybrid combinations, accounting for 66.67% and 40.48% of the same combinations respectively. The distribution proportion of the anti-cracking pod mutation type Pdh1-3 in the offspring of the SC×SC hybrid combination is the lowest, only accounting for 12.31% of the same combination type, indicating that the anti-cracking pod mutation type Pdh1-3 has not been fully utilized in the variety breeding process of the southern planting ecological region type.

[0045] Table 3 Distribution Frequencies of Pdh1 Mutation Types in the Offspring of Parental Hybrid Combinations in Different Planting Ecological Region Types

[0046]

[0047] Example 3 Identification of Pdh1 Mutation Types by Restriction Enzyme Digestion

[0048] Analysis was carried out on the key site-specific restriction enzymes of the three Pdh1 mutation types through the DNAMAN software. The results show that due to the mutation at the 91T site of Pdh1-3, it can be digested by the Nhe I restriction enzyme, while the 91A of Pdh1-1 and Pdh1-2 cannot be recognized by the Nhe I restriction enzyme, which is consistent with the previous literature reports. And due to the newly identified 320C site in this study in Phd1-1 and Pdh1-3, it can be recognized by the Aas I restriction enzyme.

[0049] To further verify the prediction results, the present invention respectively selected three representative materials with different mutation types for digestion treatment. The results of agarose gel analysis showed that, as expected, the Pdh1-3 mutation type containing both the 91T and 320C sites could be distinguished by three distinct bands, while Phd1-2 without both could not be digested by the restriction enzyme and showed the same amplification bands as PCR. The fragment Pdh1-1 containing the 320C site showed bands smaller than the PCR amplification fragment size due to digestion by Aas I. In summary, the newly developed Aas I in this study will contribute to the identification of the Pdh1-1 mutation type. Figure 4 )

[0050] Example 4: Combined analysis of Pdh1 mutation type and anti-shattering pod phenotype

[0051] Combined with the trait investigation results (Table 3), there was a highly significant positive correlation in the anti-shattering pod grades of the materials from Nanchang and Xinxiang, with a correlation coefficient of 0.20. The results of the correlation analysis between the Pdh1 mutation type and the anti-shattering pod grades in the two regions showed Figure 5 a) that the Pdh1-1 mutation type had a highly significant positive correlation with the anti-shattering pod grades in both regions, the Pdh1-2 mutation type had a weak positive correlation with the anti-shattering pod grade in the Xinxiang region, and the Pdh1-3 mutation type had a highly significant negative correlation with the anti-shattering pod grades in the two regions. By jointly analyzing the materials with an anti-shattering pod grade of 3 in the two regions and the materials carrying the anti-shattering pod mutation type Pdh1-3, a total of 319 (accounting for 28.48% of the total samples) were finally identified to stably exhibit anti-shattering pod characteristics in both regions and also have the anti-shattering pod mutation type Pdh1-3. Figure 5 b). In addition, 26 materials with the Pdh1-3 mutation type only showed anti-shattering pod characteristics in Nanchang, and 8 materials with the Pdh1-3 mutation type only showed anti-shattering pod characteristics in the Xinxiang region. Figure 5 b).

[0052] To further explore the practicality of the Pdh1-2 mutation type, 1118 breeding lines were randomly selected, and the proportions of pod-shattering and non-pod-shattering of each mutation type were respectively counted. The results showed that 975 materials were of the Pdh1-1 and Pdh1-3 mutation types, while 143 materials were of the Pdh1-2 mutation type. The combined phenotypic analysis showed that the proportion of pod-shattering materials of Pdh1-2 was the largest, at 84.6%, followed by Pdh1-1 at 81.0%, and Pdh1-3 at the least, only 41.1%. Figure 6 ) It can be seen that the pod-shattering level of the Pdh1-2 mutation type is significantly higher than that of the other two mutation types, indicating that the newly discovered mutation site will significantly increase the pod-shattering rate of soybeans, and this method is helpful for the breeding of anti-shattering pod soybean varieties in the later breeding process.

[0053] Shattering of soybean pods is an important factor affecting soybean yield and quality. Wild soybeans have pod shattering characteristics, which are beneficial to the dissemination and reproduction of seeds. However, the pod shattering of cultivated soybeans can lead to pod cracking during the mechanized harvesting process, especially under the influence of global warming, resulting in serious losses in the yield of cultivated soybeans. Therefore, the importance of reducing soybean pod shattering in the breeding of high-quality and high-yield soybean varieties is obvious. At present, some QTLs and genes related to pod shattering have been mapped, and the pod shattering characteristics and related genetic bases of cultivated soybean varieties in different regions have been reported. However, there are few studies reporting the contribution of variety combinations in different planting ecological regions to the pod shattering resistance of breeding materials and the introduction of pod shattering resistance genes. In this invention, the pod shattering phenotypes of 1,120 breeding materials from 38 different hybrid combinations were analyzed in Nanchang and Xinxiang regions, and it was found that the breeding materials of hybrid combinations with HHH, NEC, and FC as parents had stronger pod shattering resistance advantages. This invention also combined the distribution of different variant types of the reported major pod shattering-related gene Pdh1 in breeding materials, and analyzed their correlation with the pod shattering phenotypes of breeding materials grown in different environments, and then evaluated the influence of the introduction of different variant types of Pdh1 on the pod shattering resistance characteristics of breeding materials.

[0054] The distribution of Pdh1 variant types in breeding materials is related to the relative humidity in the planting ecological regions of the parents. The domestication place of soybeans is China, but the origin place is still controversial, mainly concentrated in NEC, SC, and HHH. Some areas in the Yellow River region (mainly the lower reaches of the Yellow River) may be important potential domestication sites for early-flowering phenotypes and large-seeded soybeans. Pdh1 is a major gene for soybean pod shattering resistance and has been reported to be widely used in the breeding of cultivated soybean materials with pod shattering resistance. Only a few materials in wild-type soybeans contain loss-of-function alleles, while only one cultivated soybean with a premature termination allele has pod shattering resistance and is highly distributed in selected varieties in areas with scarce precipitation. This invention found that the offspring of hybrid combinations with NEC materials as parents all showed excellent pod shattering resistance characteristics ( Figure 1 , Table 2). For example, compared with the breeding materials selected from the SC×SC combination, the proportion of pod shattering-resistant materials in the breeding materials selected from the SC×NEC combination increased by 13.7% (Table 1), and the proportion of samples containing the pod shattering-resistant variant type Pdh1-3 increased by 228.84% (Table 3). Therefore, in the future breeding for improving pod shattering resistance of southern varieties, varieties in the Huang-Huai-Hai and Northeast planting ecological regions with a relatively high distribution frequency of the pod shattering-resistant variant type Pdh1-3 can be preferentially selected as parent materials to strengthen the introduction and utilization of pod shattering resistance genes.

[0055] The main reason for the pod dehiscence phenotype in soybeans is that during the pod maturation and drying process, the pod wall is distorted due to uneven contraction between tissues, resulting in the ventral suture being torn by torsion. In the southern region of China, the climate is hot, humid, and rainy. To prevent mature soybeans from being damaged by rain, they are usually harvested in advance, threshed after drying, which makes the judgment of the pod dehiscence grade of breeding materials in the southern region less accurate. In this study, there were far more pod dehiscence-resistant materials (grade 3, 901) in Chang than in Xinxiang (grade 3, 612), while the correlation between the pod dehiscence resistance grade and the pod dehiscence resistance variation type was not as good as that in Xinxiang (see Figure 5 a). With the continuous expansion of the planting area of soybeans, the popularization of mechanization, and the scale of off-site breeding in southern China, the problem of soybean yield loss caused by pod dehiscence has become increasingly serious, seriously affecting production efficiency and the enthusiasm of growers. Although field observation is necessary, it is also necessary to further combine the use of the Pdh1 gene as a molecular marker to assist in screening pod dehiscence-resistant soybean materials, improve the seed selection efficiency, and thus improve the breeding efficiency of pod dehiscence-resistant soybean varieties in the southern region.

[0056] In summary, this study revealed the contribution of variety combinations in different planting ecological regions to the pod dehiscence resistance characteristics of offspring, and the influence of the introduction of different variation types of the major pod dehiscence resistance gene Pdh1 on the pod dehiscence resistance characteristics of selected varieties. Through combined phenotypic analysis, this invention showed that the proportion of Pdh1-2 pod dehiscence materials was the largest, followed by Pdh1-1, and the proportion of Pdh1-3 was the smallest. It can be seen that the pod dehiscence level of the Pdh1-2 variation type was significantly higher than the other two variation types, indicating that the newly discovered variation site will significantly increase the pod dehiscence rate of soybeans. This method is helpful for the breeding of pod dehiscence-resistant soybean varieties in the later breeding process. Further, to achieve the rapid screening of different variation types, this invention used the different lengths of fragments cut by restriction enzymes Nhe I and Aas I to quickly distinguish different variation types. The Pdh1-3 variation type containing both the 91T and 320C sites can be cut by Nhe I and Aas I into three obvious bands, while Phd1-2 without both cannot be cut by the endonuclease and shows the same amplification band as PCR. The fragment Pdh1-1 containing the 320C site shows two bands smaller than the PCR amplification fragment size due to being cut by Aas I; the purpose of quickly identifying different variation types is achieved. Finally, this study screened 319 selected materials that carried both the pod dehiscence-resistant variation type Pdh1-3 and showed the pod dehiscence-resistant phenotype, laying a good foundation for the breeding of high-quality, high-yield, and multi-resistant soybean varieties in the later stage.

[0057] The above is only the preferred embodiment of the present invention, and all equivalent changes and modifications made according to the scope of the patent application of the present invention shall fall within the scope covered by the present invention.

Claims

1. A soybean pod crack resistance-related molecular marker Pdh1-2, characterized in that: The base sequence of the Pdh1-2 gene is shown in SEQ ID NO.

3.

2. The soybean pod crack resistance-related molecular marker Pdh1-2 according to claim 1, characterized in that: The physical position of the marker mutation site of the molecular marker Pdh1-2 in the soybean reference genome Glycine max Wm82.a2.v1 version is Chr16-29944247; the nucleotide at the SNP site is a C / T mutation, resulting in a V / I amino acid substitution.

3. A primer, characterized in that Used to amplify the soybean pod crack resistance related molecular marker Pdh1-2 as claimed in claim 1, the primer sequence is shown as SEQ ID NO.4-5.

4. The method for identifying the soybean pod crack resistance-related molecular marker Pdh1-2 according to claim 1, characterized in that: The target sequence is obtained by amplification with specific primers, and is identified by digestion with an endonuclease that identifies the Pdh1-2 marker; the specific primer sequence is shown in SEQ ID NO.4-5.

5. The identification method according to claim 4, characterized in that: The Pdh1-3 variant type containing both 91T and 320C sites can be digested by NheI and AasI to produce three obvious bands, while Phd1-2 containing neither of the two sites cannot be digested by endonucleases and shows the same amplification bands as PCR. The fragment Pdh1-1 containing the 320C site is digested by AasI to produce two bands smaller than the size of the PCR amplification fragment; the base sequence of the Pdh1-3 gene is shown in SEQ ID NO.1; the base sequence of the Pdh1-1 gene is shown in SEQ ID NO.

2.

6. Use of the soybean pod crack resistance-related molecular marker Pdh1-2 according to any one of claims 1-2, or the primer according to claim 3, or the identification method according to any one of claims 4-5 in any of the following: (A1) Application in breeding high-quality pod crack-resistant soybeans; (A2) Application in identification or auxiliary identification of soybean germplasm resources; (A3) Application in soybean breeding.

Images