SNP molecular marker for identifying thousand seed weight of wheat and application of SNP molecular marker

Abstract

The invention relates to the technical field of gene engineering, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker for identifying thousand seed weight of wheat and application thereof. The SNP locus is located on a wheat 7B chromosome, the specific position is the 739932086th base pair, and the SNP locus shows the polymorphism of T and C. The SNP molecular marker provided by the invention can efficiently identify the thousand seed weight of wheat, and has important significance for promoting high-yield breeding of plants.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to an SNP molecular marker for identifying the thousand-grain weight of wheat and its application. Background Art

[0002] Wheat ( Triticum aestivum L. ) is listed as one of the key food crops globally due to its wide planting range and rich yield. The thousand-grain weight, as a key factor in measuring the single yield of wheat, has a crucial impact on the yield. The KASP technology, namely competitive allele-specific PCR, is a molecular marker technology based on SNP sites, which is well-known for its high stability, accuracy and economy. In the field of high-throughput SNP genotyping, especially in the case of a large number of samples and fewer SNP sites, the application of the KASP technology is particularly prominent. With the rapid growth of the global population, it is of great significance to increase the wheat yield. Currently, SNP markers related to the thousand-grain weight of wheat need to be further developed. In view of this, the present invention is specifically proposed. Summary of the Invention

[0003] To solve the above technical problems, the present invention provides an SNP molecular marker for identifying the thousand-grain weight of wheat and its application.

[0004] Specifically, the technical solutions provided by the present invention are as follows: The present invention provides a high-yield SNP molecular marker, and the SNP molecular marker contains a nucleotide sequence with polymorphism of T or C at the 739932086 bp of chromosome 7B of wheat.

[0005] Preferably, plants with the genotype of CC at the polymorphic site have a higher thousand-grain weight compared to plants with the genotype of TT.

[0006] In the second aspect, the present invention provides a KASP primer combination, and the KASP primer combination is used for amplifying the SNP molecular marker, which includes forward primer 1, forward primer 2 and a reverse primer; the nucleotide sequence of forward primer 1 includes a nucleotide fragment shown in SEQ ID NO.01; the nucleotide sequence of forward primer 2 includes a nucleotide fragment shown in SEQ ID NO.02; the nucleotide sequence of the reverse primer includes a nucleotide fragment shown in SEQ ID NO.03.

[0007] In the third aspect, the present invention provides a detection reagent or kit for detecting the high-yield characteristics of plants, and the kit includes the KASP primer combination.

[0008] Fourth aspect, the present invention provides a method for identifying the high-yield characteristics of plants, including: using the DNA of a plant sample to be tested as a template, performing PCR amplification using the KASP primer combination or the detection reagent or kit, and judging the thousand-grain weight of the plant sample to be tested according to the amplification result.

[0009] Preferably, judging the high-yield characteristics of the plant sample to be tested according to the amplification result includes: analyzing the genotype of the polymorphic site located at the 739932086 bp of chromosome 7B of wheat in the amplification product. Plants with the genotype CC have a higher thousand-grain weight than plants with the genotype TT.

[0010] Preferably, the plant is one or more of wheat, rice, barley or corn.

[0011] Preferably, taking the total system of 10 μL as an example, the PCR amplification system includes: KASP Mix(2X) KASP Mix(2X), 4 - 6 μL, Primer Mix, 0.12 - 0.16 μL, DNA 25 - 35 ng, and the balance is water.

[0012] Preferably, the reaction program used for PCR amplification is: 95℃ for 8 - 12 min; 95℃ for 15 - 25 s, 61℃ for 60 s, 8 - 12 cycles, and the annealing temperature decreases by 0.5 - 0.7℃ for each cycle; 95℃ for 15 - 25 s, 55℃ for 35 - 45 s, 32 - 36 cycles; 25℃ for 10 - 20 min.

[0013] Fifth aspect, the present invention provides any of the following applications of the SNP molecular marker or the KASP primer combination or the detection reagent or kit: (1) For identifying the thousand-grain weight of wheat; (2) For the early prediction of the high-yield characteristics of wheat; (3) For wheat molecular marker-assisted breeding; (4) For screening or cultivating high-yield plants Beneficial effects: The present invention provides an SNP molecular marker for identifying the thousand-grain weight of wheat and its application. The SNP locus is located on chromosome 7B of wheat, and the specific position is the 739932086th base pair, showing polymorphisms of T and C. The SNP molecular marker provided by the present invention can efficiently identify the thousand-grain weight of wheat, which is of great significance for promoting high-yield breeding of plants. Description of the drawings

[0014] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following will describe the drawings required for use in the embodiments or the description of the prior art.

[0015] Figure 1 It is obtained by the exon capture sequencing technology provided in Example 1 of the present invention TraesCS7B02G482100 Gene exon SNP locus map

[0016] Figure 2 It is a thousand-grain weight statistical chart of different genotypes at the 739932086 locus of chromosome 7B provided in Example 2 of the present invention

[0017] Figure 3 It is the genotyping result of the wheat genotype at the 739932086 locus of chromosome 7B provided in Example 2 of the present invention; among them, TT represents 739932086-T, CC represents 739932086-C, and CK represents no-template control, that is, ultrapure water is used to replace the sample DNA

[0018] Figure 4 It is the sequencing peak map of different genotypes at the 739932086 locus of chromosome 7B provided in Example 2 of the present invention Detailed implementation manners

[0019] The present invention provides an SNP locus and its application in identifying the thousand-grain weight of plants. The SNP locus is located on chromosome 7B of wheat, and the specific position is the 739932086th base pair, showing polymorphisms of T and C. By analyzing the phenotypic differences in thousand-grain weight and exon capture analysis, the present invention identifies an SNP locus closely related to the thousand-grain weight of plants and designs a set of KASP primer pairs accordingly. These primer pairs can efficiently identify the thousand-grain weight of wheat and are of great significance for promoting high-yield breeding of plants

[0020] The SNP locus provided by the present invention is located at the 739932086bp of chromosome 7B, and the polymorphism is T / C

[0021] The present invention provides a KASP primer combination for detecting the polymorphism of the above SNP locus, including: 739932086-F1 and 739932086-F2; it also includes 739932086-R. The 739932086-F1 includes the following nucleotide sequence AAGCCGACGATCATATTCGGT (SEQ ID NO.01); the 739932086-F2 includes the following nucleotide sequence AAGCCGACGATCATATTCGGC (SEQ ID NO.02); the 739932086-R includes the following nucleotide sequence GCCGATCGATCGATGTAGATAG (SEQ ID NO.03)

[0022] Furthermore, 739932086-F1 and 739932086-F2 in the KASP primer combination can also be linked to a fluorescent label sequence, such as FAM (GCCTTTGACCCCGTTCATGCT) or HEX (GCCTTTCTTAGTCCCCTTATT).

[0023] In a specific embodiment provided by the present invention, the KASP primer combination is as follows: 739932086-F1 (SEQ ID NO.04): 5’-GCCTTTGACCCCGTTCATGCTAAGCCGACGATCATATTCGGT-3’.

[0024] 739932086-F2 (SEQ ID NO.05): 5’-GCCTTTCTTAGTCCCCTTATTAAGCCGACGATCATATTCGGC-3’.

[0025] 739932086-R (SEQ ID NO.03): 5’- GCCGATCGATCGATGTAGATAG-3’.

[0026] The present invention further provides the application of the SNP locus, or the KASP primer combination, or the kit in identifying the thousand-grain weight of plants.

[0027] The present invention further provides the application of the SNP locus, or the KASP primer combination, or the kit in screening or cultivating high-yield plants.

[0028] Furthermore, the plant is one or more of wheat, rice or corn.

[0029] The present invention also provides a method for identifying the high or low thousand-grain weight of plants, including: using the DNA of the plant sample to be tested as a template, and performing PCR amplification using the KASP primer combination or the kit described above; judging the thousand-grain weight of the plant sample to be tested according to the amplification result.

[0030] Furthermore, taking the total system of 10 μL as an example, the system of the PCR amplification includes: KASP Mix(2X), 4 - 6 μL, Primer Mix, 0.12 - 0.16 μL, DNA 25 - 35 ng, and the balance is water.

[0031] The reaction procedure of the PCR amplification includes: 95°C for 8 - 12 min; 95°C for 15 - 25 s, 61°C for 60 s, 8 - 12 cycles, with the annealing temperature decreasing by 0.5 - 0.7°C in each cycle; 95°C for 15 - 25 s, 55°C for 35 - 45 s, 32 - 36 cycles; 25°C for 10 - 20 min.

[0032] Further, based on a total system of 100 μL, the Primer Mix includes: 739932086 - F1, 100 μM, 10 - 14 μL, 739932086 - F2, 100 μM, 10 - 14 μL, and 739932086 - R, 100 μM, 10 - 14 μL, with the balance being water.

[0033] Further, the plant is one or more of wheat, rice, or corn.

[0034] Further, determining the thousand - grain weight of the plant sample to be tested based on the amplification result includes: In the amplification result, plants with the SNP locus identified as genotype CC have a higher thousand - grain weight compared to plants with genotype TT.

[0035] By analyzing the phenotypic differences in thousand - grain weight and exon capture sequencing technology, the present invention successfully identified a SNP locus of a gene closely related to the thousand - grain weight phenotype of plants. Detecting the polymorphism of this SNP locus can achieve accurate and rapid identification of the thousand - grain weight characteristics of plants. The markers at this locus exhibit strong genetic stability, high resolution, and are suitable for high - throughput detection. The SNP locus and the corresponding KASP primer pair provided by the present invention can not only be used to identify the high or low thousand - grain weight of plants, but also improve the efficiency of plant variety selection, shorten the breeding cycle, and have great application value for accelerating the development in the field of high - yield plant breeding.

[0036] To make the objectives, technical solutions, and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of them. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts fall within the protection scope of the present invention.

[0037] At the endpoints and any values disclosed in this specification, the exact ranges or values are not limited, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, between the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values, they can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0038] In the description of this specification, the description with reference to terms such as "one embodiment", "some embodiments", "specific implementation manners", or "some specific implementation manners" means that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the embodiments of the present invention. In this specification, the schematic expressions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0039] In the embodiments provided in this specification, for those without specified specific technologies or conditions, they shall be in accordance with the technologies or conditions described in the literature in this field or in accordance with the product specifications. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through regular channels.

[0040] The relevant wheat varieties (lines) involved in the following examples were all provided by Researcher Zhang Xueyong of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. The relevant wheat was all sown in Xinxiang, Henan, and harvested after physiological maturity, naturally dried and used for subsequent analysis. It should be noted that as a professional agricultural research institution, the applicant has long-term preserved relevant germplasm materials, and the relevant wheat varieties are all publicly available in the market or existing germplasm banks.

[0041] Example 1 This example illustrates the process of obtaining SNP markers for the thousand-grain weight of plants and the design of KASP primers.

[0042] 1. Exome capture sequencing of 148 samples.

[0043] To obtain the genes regulating high thousand-grain weight in wheat, first, the genotypes of 148 wheat samples were determined using exome capture technology, in order to preliminarily determine the development of wheat SNP molecular markers. The specific determination results are shown in Table 1 below.

[0044] 2. Obtaining the thousand-grain weight of different wheats and the development of SNP molecular markers.

[0045] To obtain the genes regulating high thousand-grain weight in wheat, based on the exome sequencing, the thousand-grain weight phenotypes of the above-mentioned 148 wheat varieties were measured, in order to preliminarily determine the phenotypic differences in the thousand-grain weight of wheat. The specific determination results are shown in Table 1 below.

[0046] Based on the 148 phenotypic data of thousand-grain weight obtained in Step 2, combined with the results of exon capture sequencing analysis, to explore the contribution of SNP sites of important genes to thousand-grain weight, a TraesCS7B02G482100 SNP site was found in the exon of the gene, and the thousand-grain weight of this SNP variation increased significantly. A significant locus affecting the thousand-grain weight of wheat (7B: 739932086 bp) was identified (see part of the results in Figure 1 ), and this locus was named: 739932086.

[0047] Based on the above sequence differences and the principle of KASP, a primer set for PCR amplification to obtain the wheat molecular marker was further developed and designed as follows: 739932086-F1: 5’-GCCTTTGACCCCGTTCATGCTAAGCCGACGATCATATTCGGT-3’, (The partial sequence “GCCTTTGACCCCGTTCATGCT” at the 5’ end is the FAM-labeled sequence, SEQ ID NO.06).

[0048] 739932086-F2: 5’-GCCTTTCTTAGTCCCCTTATTAAGCCGACGATCATATTCGGC-3’, (The partial sequence “GCCTTTCTTAGTCCCCTTATT” at the 5’ end is the HEX-labeled sequence, SEQ ID NO.07).

[0049] 739932086-R: 5’- GCCGATCGATCGATGTAGATAG-3’.

[0050] When using 739932086-F1 and 739932086-R as a primer pair combination, it is used to amplify the sequence with base T at the 739932086 locus on chromosome 7B of the wheat molecular marker.

[0051] When using 739932086-F2 and 739932086-R as a primer pair combination, it is used to amplify the sequence with base C at the 739932086 locus on chromosome 7B of the wheat molecular marker.

[0052] Example 2 This example provides the application of the SNP molecular marker in identifying the thousand-grain weight of wheat.

[0053] 1. Based on the primer pair design in Example 1, the genotypes of 90 wheat materials (50 TT / 40 CC) were detected, and the association relationship between the genotype and the thousand-grain weight phenotype was identified. The specific process is as follows.

[0054] First, the genomic DNA of each wheat variety was extracted separately.

[0055] Then, according to the primers designed in Example 1, using the above-extracted DNA as a template, different wheat samples were detected and analyzed by PCR (using a Quant Studio 1 fluorescence quantitative PCR instrument).

[0056] Specifically, when performing PCR amplification, the 10 μL amplification system was designed as follows: KASP Mix(2X), 5 μL; Primer Mix, 0.14 μL; DNA, 30 ng; ddH 2 O, supplemented to 10 μL; for the Primer Mix, in every 100 μL: 739932086-F1, 100 μM, 12 μL; 739932086-F2, 100 μM, 12 μL; 739932086-R, 100 μM, 30 μL; ddH 2 O, 46 μL.

[0057] The PCR reaction program (which can be appropriately adjusted according to the amplification results) was as follows: 95°C for 10 min; 95°C for 20 s, 61°C for 60 s (10 cycles, with a decrease of 0.6°C in each cycle); 95°C for 20 s, 55°C for 40 s, 34 cycles; 25°C for 15 min.

[0058] 2. Using the genomic DNA extracted from each wheat variety in step 1, ordinary PCR was performed for sequencing to verify the accuracy of KASP genotyping.

[0059] First, specific primers were designed for amplification at the 739932086 bp position on chromosome 7B of wheat (the reference sequence is Chinese Spring wheat), and the primer sequences were: A7BF: 5’- GCGAGATCGACCTTGGGCTG-3’ (SEQ ID NO.08).

[0060] A7BR: 5’- AAGGGAGATTGGAGAGGGTT-3’ (SEQ ID NO.09).

[0061] Eight wheat varieties with TT / CC genotypes of the KASP genotyping results were randomly selected, amplified using a conventional PCR instrument, sequenced after electrophoresis detection to verify the reliability of the genotyping results.

[0062] For specific PCR amplification, the 25 μL amplification system was designed as follows: 2×EasyTaq® PCR SuperMix for PAGE (+dye), 10 μL; Primer A7BF / A7BR, 1 μL each; DNA, 60 ng; ddH 2 O, supplemented to 25 μL.

[0063] The PCR reaction program (which can be appropriately adjusted according to the amplification results) was: 94℃ for 5 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 40 s (35 cycles); 72℃ for 10 min; end at 16℃.

[0064] The specific genotype and wheat thousand-kernel weight statistical results are shown in Table 1 and Figures 1-4 as follows.

[0065] Table 1 Corresponding results of genotypes and thousand-kernel weights of different wheat varieties Based on the above statistical results, it can be seen that: the average thousand-kernel weight of TT genotype wheat is 35.46 g; the average thousand-kernel weight of CC genotype wheat is 38.43 g. The thousand-kernel weight of CC genotype wheat is significantly higher than that of TT genotype wheat, increasing by 8.37%, with a significant difference at the p<0.01 level. That is, the thousand-kernel weight of TT genotype wheat is significantly lower than that of CC genotype wheat.

[0066] The present invention accurately detects specific gene loci through the designed primers, can accurately evaluate the thousand-kernel weight characteristics of wheat, and provides a solid foundation for molecular-assisted breeding. In addition, using this gene locus, the present invention can provide technical and theoretical support for the development of new wheat varieties with different thousand-kernel weight characteristics, which has great technical value for increasing wheat yield.

[0067] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. High-yield SNP molecular marker, characterized in that: The SNP molecular marker contains a nucleotide sequence of T or C at the 739932086 bp position of wheat 7B chromosome.

2. The SNP molecular marker according to claim 1, characterized in that: Plants with CC genotype at the polymorphic site had higher thousand-grain weight than those with TT genotype.

3. KASP primer combination, characterized in that, The KASP primer combination is used to amplify the SNP molecular marker according to claim 1, and comprises forward primer 1, forward primer 2 and reverse primer; The nucleotide sequence of forward primer 1 includes the nucleotide fragment shown in SEQ ID NO.01; The nucleotide sequence of forward primer 2 includes the nucleotide fragment shown in SEQ ID NO.02; The nucleotide sequence of the reverse primer includes the nucleotide fragment shown in SEQ ID NO.

03.

4. A detection reagent or kit for detecting high-yield characteristics of plants, the kit comprising the KASP primer combination according to claim 3.

5. A method for identifying high-yield characteristics of a plant, characterized in that: include: Using the DNA of the plant sample to be tested as a template, PCR amplification is performed using the KASP primer combination described in claim 3 or the detection reagent or kit described in claim 4, and the thousand-grain weight of the plant sample to be tested is determined based on the amplification result.

6. The method for identifying high-yield characteristics of plants according to claim 5, characterized in that: Judging the high-yield characteristics of the plant sample to be tested according to the amplification results includes: analyzing the genotype of the polymorphic site located at 739932086 bp of wheat chromosome 7B in the amplified product, and the plants with genotype CC have higher thousand-grain weight than the plants with genotype TT.

7. The method for identifying high protein content in plants according to claim 5 or 6, characterized in that: The plant is one or more of wheat, rice, barley or corn.

8. The method for identifying high-yield characteristics of a plant according to any one of claims 5 to 7, characterized in that: Based on a total system of 10 μL, the PCR amplification system includes: KASP Mix (2X) KASP Mix (2X), 4-6 μL, Primer Mix, 0.12-0.16 μL, DNA 25-35 ng, and the remainder is water.

9. The method for identifying high-yield characteristics of plants according to claim 8, characterized in that: The reaction program used for PCR amplification was as follows: 95°C for 8-12 min; 95°C for 15-25 s, 61°C for 60 s, for 8-12 cycles, with the annealing temperature decreasing by 0.5-0.7°C in each cycle; 95°C for 15-25 s, 55°C for 35-45 s, for 32-36 cycles; 25°C for 10-20 min.

10. Any of the following uses of the SNP molecular marker according to claim 1 or 2, the KASP primer combination according to claim 3, or the detection reagent or kit according to claim 4: (1) Used to identify the thousand-grain weight of wheat; (2) Used for early prediction of high-yield characteristics of wheat; (3) Used in wheat molecular marker-assisted breeding; (4) Used for screening or cultivating high-yield plants.

Images