Molecular marker related to flowering character of golden camellia and application of molecular marker

By performing parezole induction treatment and RT-qPCR detection and analysis on Jinhua tea plants, the problems of medium-, long and long periods of Jinhua tea breeding and long reproduction cycles were solved, and the induction and breeding efficiency of early blooming of Jinhua tea were achieved.

CN120060531APending Publication Date: 2025-05-30GUANGXI FORESTRY RES INST
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510183486.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-19
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

There are problems of long and juvenile periods and long breeding cycles in Jinhua tea breeding, which leads to slow breeding progress and lack of effective flowering regulation research.

Method used

The early flowering induction treatment of the golden flower tea plants was performed by pactazole, and specific molecular markers in the axilla of the golden flower tea were analyzed by RT-qPCR detection method to promote the formation of flower buds.

Benefits of technology

The induction of early flowering of Jinhua tea has been achieved, the efficiency and economic value of Jinhua tea breeding have been improved, and the expression patterns of multiple flowering-related genes have been revealed.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060531A_ABST
    Figure CN120060531A_ABST
Patent Text Reader

Abstract

The invention discloses a molecular marker related to flowering traits of camellia nitidissima. The molecular marker comprises any one or more of molecular markers A-J, nucleotide sequences of the molecular markers A-J are shown as sequences 1-10 in a sequence table. In the cultivation process of the golden camellia, leaf axils of the golden camellia are taken as samples, the molecular marker is detected by adopting an RT-qPCR detection method, and when the expression of the molecular marker is up-regulated through flower induction treatment, the leaf axils can be promoted to form flower buds. The molecular marker provided by the invention can be used for researching and analyzing the formation of camellia nitidissima flower buds in a camellia nitidissima cultivation process, and quickly and accurately indicates and induces the effect of early flowering of the camellia nitidissima, so that the camellia nitidissima cultivation method is improved, the early flowering of the camellia nitidissima is promoted, and the economic value of camellia nitidissima planting is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker related to the flowering traits of Camellia nitidissima and its application. Background Art

[0002] Camellia nitidissima Camellia petelotii ), is an evergreen shrub of the genus Camellia in the family Theaceae. Camellia nitidissima is a rare ornamental plant and germplasm resource in the world, accounting for less than 1% of all species in the genus Camellia. Camellia nitidissima has golden-yellow petals, which have better ornamental value compared with common camellia varieties with red, pink and white colors. At the same time, the flowers of Camellia nitidissima are rich in flavonoids, which have functions such as antioxidant, anti-aging, reducing blood lipid and blood pressure. Moreover, compared with ordinary tea leaves, Camellia nitidissima contains more diverse phenolic compounds, such as ellagitannins, proanthocyanidins, taxusin deoxyhexose, apigenin derivatives, camellia sinensis derivatives, quercetin derivatives, glucosylisorhamnetin, etc., which makes Camellia nitidissima have great economic value in healthcare and food production. Although a mature Camellia nitidissima can produce hundreds of flowers every year, seedlings usually need 6 - 8 years to start forming flower buds, and grafted seedlings also need 5 - 6 years. This long juvenile period not only hinders traditional breeding work, but also has an adverse impact on the economic income of breeders. Therefore, how to induce early flowering of Camellia nitidissima is one of the hotspots in the current research on Camellia nitidissima cultivation. However, flowering is a complex process, involving various environmental conditions and internal factors, including photoperiod, temperature, hormones and nutrients. Moreover, perennial plants such as Camellia nitidissima have a long juvenile period and reproductive cycle, as well as different flowering patterns, making its flowering process more complex. There are few reports on the research related to regulating the flowering of Camellia nitidissima. Summary of the Invention

[0003] Aiming at the above deficiencies, the present invention discloses a molecular marker related to the flowering traits of Camellia nitidissima. By using the molecular marker, the formation of flower buds of Camellia nitidissima can be studied and analyzed during the cultivation process of Camellia nitidissima, and the effect of inducing early flowering of Camellia nitidissima can be indicated quickly and accurately, thereby being beneficial to improving the cultivation method of Camellia nitidissima, promoting early flowering of Camellia nitidissima, and increasing the economic value of Camellia nitidissima planting. The present invention is realized by the following technical solutions: A molecular marker related to the flowering traits of Camellia nitidissima, which includes any one or more of molecular markers A - J; the nucleotide sequences of the molecular markers A - J are as shown in sequences 1 - 10 of the sequence listing. The application of the molecular marker related to the flowering traits of Camellia nitidissima is to take the axils of the leaves of Camellia nitidissima as samples during the cultivation process of Camellia nitidissima, and use the RT-qPCR detection method to detect the molecular marker. When the expression of the molecular marker is up-regulated by flower induction treatment, it can promote the formation of flower buds in the axils of the leaves.

[0004] Furthermore, the PCR kit used in the RT-qPCR detection method includes the following primers: Primer AF: (as shown in Sequence 11 in the sequence listing); Primer AR: (as shown in Sequence 12 in the sequence listing); Primer BF: (as shown in Sequence 13 in the sequence listing); Primer BR: (as shown in Sequence 14 in the sequence listing); Primer CF: (as shown in Sequence 15 in the sequence listing); Primer CR: (as shown in Sequence 16 in the sequence listing); Primer DF: (as shown in Sequence 17 in the sequence listing); Primer DR: (as shown in Sequence 18 in the sequence listing); Primer EF: (as shown in Sequence 19 in the sequence listing); Primer ER: (as shown in Sequence 20 in the sequence listing); Primer FF: (as shown in Sequence 21 in the sequence listing); Primer FR: (as shown in Sequence 22 in the sequence listing); Primer GF: (as shown in Sequence 23 in the sequence listing); Primer GR: (as shown in Sequence 24 in the sequence listing); Primer HF: (as shown in Sequence 25 in the sequence listing); Primer HR: (as shown in Sequence 26 in the sequence listing); Primer KF: (as shown in Sequence 27 in the sequence listing); Primer KR: (as shown in Sequence 28 in the sequence listing); Primer JF: (as shown in Sequence 29 in the sequence listing); Primer JR: (as shown in Sequence 30 in the sequence listing).

[0005] Furthermore, for the RT-qPCR detection method, the axils of the leaves of Camellia nitidissima are taken as samples, RNA is extracted using a plant RNA extraction kit, cDNA is then obtained using a reverse transcription kit, and the cDNA is used as a template to prepare a PCR amplification system and perform PCR amplification and detection and analysis of the amplification products; the PCR amplification reaction procedure is as follows: Step1: 2 min at 95 °C; Step2: 5 s at 95 °C, 30 s at 60 °C, for a total of 40 cycles.

[0006] Furthermore, for the flower induction treatment, Camellia nitidissima plants over 4 years old are taken, and then the roots are drenched with a paclobutrazol solution in three times, and the time interval between each treatment is 15 days, and the concentration of the paclobutrazol solution is 100 ppm.

[0007] The present technical solution has the following beneficial effects compared with the prior art: By using paclobutrazol to treat the Camellia nitidissima plants for early flowering induction and conducting transcriptomic analysis, RNA sequencing generated a total of 313,689,058 transcripts, revealing for the first time many flowering-related genes in Camellia nitidissima, including EARLY FLOWERING3 (ELF3), AGAMOUS MADS-box AGL6, FRIDIDA, APETALA2, Squamosa promoter-binding protein 1gene, CONSTANS, CENTRORADIALIS (CEN), flowering time control gene (FCA), FRUITFULL2 (FUL2), GIGANTEA (GI) genes encoding GATA transcription factors, MOTEARLY FLOWERING 4, MOTHER of FT, TFL1 homolog 1, EMBRYONIC FLOWER 1, FLOWERINGLOCUS T, Heading Date Repressor 1, PAF1 complex (PAF1C), CAULIFLOWER A (CAL A), PHYTOCHROME-DEPENDENT LATE-FLOWERING, UNUSUAL FLORAL ORGANS, DEFICIENS, GLOBOSA, VERNALIZATION1 (VRN1), CLAVAT3 (CLV3), WUSCHEL (WUS), etc.; in the comparison between different time points and between flower buds and vegetative buds, a total of 10,944 differentially expressed transcript isoforms and 12,524 differentially expressed genes were generated, most of which were different between flower buds and undifferentiated buds. At the same time, the present invention screens the obtained differentially expressed genes, uses the transcripts corresponding to the screened genes as molecular markers, and then designs primers and amplification reactions for qRT-PCR detection, so as to study and analyze the formation of Camellia nitidissima flower buds during the cultivation process of Camellia nitidissima by using the molecular markers, quickly and accurately indicate the effect of inducing early flowering of Camellia nitidissima, which is beneficial to improving the cultivation method of Camellia nitidissima, promoting the early flowering of Camellia nitidissima, and increasing the economic value of Camellia nitidissima planting. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1 It is a photo of three groups of Camellia nitidissima plants, namely CK1, CK2 and FB, described in Example 1.

[0009] Figure 2It is a schematic diagram of the Pearson correlation of gene expression in the cDNA libraries of 9 samples in Example 1.

[0010] Figure 3 It is a distribution diagram of transcript sizes in the Camellia nitidissima reference transcriptome in Example 1.

[0011] Figure 4 It is a statistical chart of unique and common transcript isoforms and genes in CK1, CK2, and FB in Example 1.

[0012] Figure 5 It is a statistical chart of transcript isoforms and genes with differential expression (DE) described in Example 1.

[0013] Figure 6 It is a heat map and clustering map of differentially expressed isoforms and genes in CK1, CK2, and FB samples in Example 1.

[0014] Figure 7 It is a statistical chart of the differential expression analysis of transcription factors (TFs) in Example 1.

[0015] Figure 8 It is a statistical chart of the differential expression analysis in carbohydrate metabolism in Example 1.

[0016] Figure 9 It is a comparative statistical chart of the expression trend of RNA sequencing and RT-qPCR results in Example 2, where A to J correspond to molecular markers A to J in sequence. Detailed implementation mode

[0017] The present invention will be further described below by way of examples, but it is not intended to limit the present invention. The specific experimental conditions and methods not specified in the following examples are usually conventional means well known to those skilled in the art.

[0018] Example 1: Screening and analysis of molecular markers related to the flowering traits of Camellia nitidissima, specifically including the following steps: (1) The seeds of Camellia chrysantha were taken for sand storage and germination acceleration in December 2020. In February 2021, they were potted and cultivated until 2024 to obtain 4-year-old seedlings of Camellia chrysantha. Nine seedlings were selected and divided into three groups: CK1, CK2, and FB, with three seedlings in each group. Each single plant in each group was used as a biological replicate. The three groups of CK1, CK2, and FB were seedlings of the same batch and were managed in the same way. The only difference was that: the CK1 group was not treated with paclobutrazol, and samples were taken from the axillary parts on March 25, 2024; the CK2 group was also not treated with paclobutrazol, and samples were taken from the axillary parts on July 16, 2024; the FB group was treated with paclobutrazol. Specifically, an aqueous solution of paclobutrazol was prepared and used for root drenching of the plants. The concentration of the aqueous solution of paclobutrazol was 100 ppm, and 1 liter of the aqueous solution of paclobutrazol was drenched for each plant each time, for a total of 3 times, which were carried out on March 25, April 9, and April 24, 2024 respectively. During this period, the plants were only managed for normal pest and disease control and drought watering, without any other fertilization treatment, and samples were taken from the axillary parts on July 16, 2024 (see Figure 1 ). The collected samples were frozen with liquid nitrogen and stored at -80 °C.

[0019] (2) For each sample, a plant total RNA extraction kit (such as the one produced by The total RNA was extracted using the RNAprep Pure Plant Plus Kit, and the quality and quantity of the total RNA were determined using 1% agarose gel and a spectrophotometer; the integrity of the RNA was evaluated using a Bioanalyzer (Agilent 2100 Bioanalyzer) and the RNA integrity number (RIN) was calculated. If the RIN was greater than 4.0, the RNA was enriched using the Oligo(dT) method; cDNA was synthesized by DNA polymerase F chain reaction (PCR) using a DNA synthesis kit (Clonetech SMARTer PCR cDNA Synthesis Kit, Illumina Inc., USA) and random hexamers, then purified and accurately quantified using a fluorometer (Qubit 3.0). The library size was detected using Agilent 2100 and paired-end sequencing was performed on the Illumina Novaseq 6000 platform. The raw read data were cleaned using SAOPnuke v2.1.0 software, removing adapters and reads containing more than 0.5% unknown nucleotides, or reads containing more than 50% of the base quality score (Q-score) greater than 20. The obtained clean reads were de novo assembled into transcript isoforms and genes using the Trinity program; the obtained sequences were functionally annotated using BLAST and multiple databases. The databases included NCBI nonredundant protein sequences (NR), eukaryotic Orthologous Groups, Gene Ontology, Swiss-Prot, and Kyoto Encyclopedia of Genes and Genomes. According to the sequencing results, each library generated at least 5.8 billion clean bases, the QC30 range of quality control was from 96.53% to 96.84%, and the GC content range was from 44.52% to 45.56% (see Table 1). The minimum gene expression correlation between different samples (time points or types) was 0.41, and the correlation between biological replicates was 0.46 (see Figure 2). Since there is no available genome sequence of Camellia nitidissima, the inventors used Trinity software to assemble a reference transcriptome based on nine samples. The reference transcriptome contains 313,689,058 transcripts, with an average length of 817 bp, a median length of 474 bp, and an N50 value of 1,319 bp. Among them, a total of 200,543 transcripts have a length less than 500 bp, 89,070 transcripts have a length between 500 bp and 1 kb, 60,444 transcripts have a length between 1 kb and 2 kb, and 33,837 transcripts have a length exceeding 2 kb (see Figure 3 ).

[0020] Table 1 Statistics of cDNA libraries based on Illumina sequencing

[0021] Specifically, the CK1 group contains 97,868 transcript isoforms and 48,552 genes, the CK2 group contains 86,079 transcript isoforms and 55,737 genes, and the FB group contains 78,385 transcript isoforms and 48,553 genes; among the three groups, there are 52,359 common transcript isoforms and 38,435 common genes (see Figure 4 ). At the same time, the number of unique transcript isoforms and genes in the CK1 group is 25,485 and 15,949 respectively, there are 13,150 unique transcript isoforms and 6,081 unique genes in the CK2 group, and there are 11,102 unique transcript isoforms and 4,163 unique genes in the FB group (see Figure 4 ); using the assembled reference transcriptome as a reference, when mapping the sequences of each sample to the reference transcriptome, the total mapping rate is between 66.0% and 75.3%, especially the unique mapping rate ranges from 21.8% to 24.8%, while the multiple mapping rate ranges from 44.2% to 51.7%. Among 383,894 transcripts (isoforms), the representation rates of each library are 35.8% (FB-1), 33.7% (FB-2), 33.4% (FB-3), 36.3% (ck2-1), 42.8% (ck2-2), 45.9% (ck2-3%), 43.7% (ck1-1), 43.3% (ck1-2), and 45.8% (ck1-3); a total of 235,214 Camellia nitidissima genes are determined, and the representation rates of each library are 33.0% (FB-1), 30.2% (FB-2), 30.0% (FB-3), 33.7% (ck2-1), 41.7% (ck2-2), 47.80% (ck2-3%), 43.4% (ck1-1), 43.7% (ck1-2), and 45.8% (ck1-3) (see Table 2).

[0022] Table 2 Mapping statistics of clean reads, transcripts, and genes in the cDNA library

[0023] (3) Calculate the fragments per kilobase of exon per million mapped fragments (FPKM) using RSEM to identify differential expression between groups. Significantly differentially expressed isomers and genes were screened under the conditions of false discovery rate (FDR) < 0.05 and absolute log2 (fold change) > 1; the FDR cut-off value for differential expression of GO and pathway enrichment was 0.05. Differential expression (DE) analysis showed (see Figure 5 ), the comparison between CK1 group and FB group identified the largest number of differential transcript isomers (6,964) or genes (8,234). In contrast, the comparison between CK2 group and FB group produced the fewest transcript isomers (1,826), while the number of differential genes between CK1 group and CK2 group was the least (1,898). The largest number of common differential genes or transcript isomers were found in the comparisons between CK1 group and CK2 group and between CK1 group and FB group. There were 19 common differential genes in the three-group comparison, and most of these genes were related to the development, nutrient absorption, or photosynthesis of Camellia nitidissima. For example, the transcription factor genes Agamous-like MADS-box AP1, Scarecrow-like 32, and bHLH61, and cell wall-encoding genes endoglucanase 9, beta-D-xylosidase, formin-like protein 11, etc.

[0024] Based on the Gene Ontology (GO) international standard classification system for gene functions, among the differentially expressed isomers between CK1 and CK2, CK1 and FB, and CK2 and FB, the top 20 enriched GO terms were mainly related to translation and cell structure in the comparison between CK1 and CK2, mainly related to translation, transcription, morphogenesis, and hormone metabolism processes in the comparison between CK1 and FB, and mainly related to cell wall components, transcriptional regulation, and cytokinin metabolism in the comparison between CK2 and FB. Cluster analysis was performed on the obtained differentially expressed transcript isomers and genes, see Figure 6As shown in Tables 3 - 4, among the differentially expressed transcript isoforms, subcluster 1 continuously increased from CK1 - CK2 - FB, and this subcluster was related to phosphate ion transport; subclusters 2 and 3 continuously decreased from CK1 - CK2 - FB, with subcluster 2 showing a greater decrease and being related to photosynthesis, while subcluster 3 showing a smaller decrease and being related to ribosomes; subcluster 4 showed no difference between CK2 and FB and was related to oxidoreductase and hydrolase activities, as well as the hydrolysis of N - glycosyl compounds; among the differentially expressed genes, the first two subclusters continuously decreased from CK1 - CK2 - FB, and the third subcluster continuously increased from CK1 - CK2 - FB, and this subcluster was related to protein folding, response to unfolded / mis - folded proteins, protein binding, etc.

[0025] Table 3 GO terms of differentially expressed isoforms

[0026] Table 4 GO terms of differentially expressed genes

[0027] Comparisons among the three sample types revealed differential expression of transcription factors (TFs). In the comparison between CK1 and CK2, there were 113 TF isoforms and 65 genes with differences; in the comparison between CK1 and FB, the number of differential TFs was the largest, specifically 435 TF isoforms and 590 genes; in the comparison between CK2 and FB, there were 128 TF isoforms and 167 genes with differences; in particular, a group of 15 differentially expressed TF isoforms were annotated as related to flower development, vegetative / reproductive transition, or floral organ specification (see Figure 7 ), among which 11 were up - regulated in the FB group samples, such as CAULIFLOWER (CAL) A, FRUITFULL (FUL), DEFICIENS (DEF), GLOBOSA, APETALA1 (AP1), AGAMOUS (AGL), SquamosaPromoter - Binding Protein 1 (SPL1), Constans (CO), S1Fa, and type - B response regulator, etc. For the differential expression analysis related to hormone signaling pathways and hormone biosynthesis and inactivation, see Figure 8, among the comparisons of CK1 vs CK2, CK1 vs FB, and CK2 vs FB, there were 18, 73, and 21 differentially expressed isomers belonging to the hormone signaling pathway respectively. For differentially expressed genes, there were 8, 62, and 31 in the comparisons of CK2 vs CK1, CK1 vs FB, and CK2 vs FB respectively; a group of 20 differentially expressed isomers upregulated in the hormone signaling pathway could be identified in the differentially expressed heatmap. Among the many downregulated genes in FB, gibberellin-regulated protein 1 and DELLA protein SLN1 need to be focused on; for the biosynthesis and inactivation of hormones, see Tables 4 and 5. Cytokinin and steroid biosynthesis had the most differentially expressed isomers or genes. Moreover, in the comparisons of FB with CK1 and CK2 respectively, all the GA inactivation-related isomers in FB were upregulated, and 7 out of 9 differentially expressed genes were upregulated.

[0028] Table 5 Number of differentially expressed isomers in hormone biosynthesis or inactivation and auxin transport

[0029] Table 6 Number of differentially expressed genes in hormone biosynthesis or inactivation and auxin transport

[0030] For the differential expression analysis in carbohydrate metabolism, see Figure 9 , in the comparison of CK1 vs CK2, 24 differentially expressed isomers and 24 differentially expressed genes were found. In the comparison of CK1 vs FB, 102 differentially expressed isomers and 112 differentially expressed genes were found. In the comparison of CK2 vs FB, 24 differentially expressed isomers and 40 differentially expressed genes were found.

[0031] Example 2: Screening was carried out based on the differentially expressed genes obtained in Example 1. The transcripts corresponding to the screened genes were used as molecular markers, namely molecular markers A - J. The nucleotide sequences of the molecular markers A - J are shown as sequences 1 - 10 in the sequence listing. Meanwhile, the RT-qPCR detection method was used to detect the molecular markers. That is, the axils of the leaves of Camellia nitidissima were taken as samples, RNA was extracted using a plant RNA extraction kit, and then cDNA was obtained using a reverse transcription kit. The cDNA was used as a template to prepare a PCR amplification system and PCR amplification and amplification product detection analysis were carried out; the RNA extraction can be carried out by the following steps: (1) Take an appropriate amount of axil samples of Camellia nitidissima leaves and add 0.8 ml of RLS, mix well, and lyse at room temperature for 15 minutes; (2) Centrifuge at 12000 g for 10 min at 4°C; (3)Carefully aspirate the supernatant, add 1 / 2 volume of absolute ethanol and mix well. Transfer the mixture to an RNA adsorption column, centrifuge at 12,000 g for 1 min at 4 °C, and discard the filtrate. (4)Add 0.7 mL of 75% ethanol, centrifuge at 12,000 g for 1 min at 4 °C, discard the filtrate, and repeat twice. (5)Centrifuge the RNA adsorption column for 2 min, add 30 μL of DEPC water, and centrifuge to collect the RNA eluate. (6)The RNA solution is used for reverse transcription or stored at -80 °C.

[0032] The following steps can be used for cDNA preparation: (1)Prepare the system on ice according to the following table;

[0033] (2)Gently pipette and mix well, then briefly centrifuge. Mix again and immediately place on ice for 5 min; (3)Incubate at 37 °C for 10 min to remove genomic DNA contamination; (4)Incubate at 55 °C for 15 min. After the reaction, incubate at 85 °C for 5 min to terminate the reaction. Quickly place the obtained cDNA on ice for subsequent experiments; or immediately store at -20 °C.

[0034] Primers specifically designed for qRT-PCR detection are as follows: Primer AF: GGCTGGTGGAAGGAAACCAA (as shown in Sequence 11 in the sequence listing); Primer AR: TGGGTTCACAGTCCAAGGGA (as shown in Sequence 12 in the sequence listing); Primer BF: AGCGGATCGAGAACTCCACT (as shown in Sequence 13 in the sequence listing); Primer BR: GGAGACTTTGGCATCGCAGA (as shown in Sequence 14 in the sequence listing); Primer CF: GTTCGCGAGAAACAGATGGAG (as shown in Sequence 15 in the sequence listing); Primer CR: CGGAAGGCAAAAGGCATCTG (as shown in Sequence 16 in the sequence listing); Primer DF: AGTGGACAACGACGGAGACT (as shown in Sequence 17 in the sequence listing); Primer DR: ATGGTGAAGGTTAGGGTGGC (as shown in Sequence 18 in the sequence listing); Primer EF: AGACGAGTCCTTAATGGTGGC (shown as Sequence 19 in the Sequence Listing); Primer ER: AGACAAGCAACAGCAACAAGT (shown as Sequence 20 in the Sequence Listing); Primer FF: TCTCCCTGAGGATGTCCCAA (shown as Sequence 21 in the Sequence Listing); Primer FR: AACCCAAACTCTTCTTCAGCTCT (shown as Sequence 22 in the Sequence Listing); Primer GF: AATCAAACCACGCCAACGAG (shown as Sequence 23 in the Sequence Listing); Primer GR: ACAACTTGGAAGAACCCCCAT (shown as Sequence 24 in the Sequence Listing); Primer HF: GTCTCCGGGTAACACTCCGA (shown as Sequence 25 in the Sequence Listing); Primer HR: GAGTCTACCCGAGGCGAGT (shown as Sequence 26 in the Sequence Listing); Primer KF: CGCCTTCTTCTCTCTGCCAT (shown as Sequence 27 in the Sequence Listing); Primer KR: AGCAATCATCTACTTTGTCCTTGC (shown as Sequence 28 in the Sequence Listing); Primer JF: TCAAACAAGGATGAGGTGGCA (shown as Sequence 29 in the Sequence Listing); Primer JR: GGTGGACCAAGCCTTAACTCA (shown as Sequence 30 in the Sequence Listing).

[0035] Combine the primers to optimize and adjust the PCR amplification system (see Table 7) and the amplification program. The PCR amplification reaction program is as follows: Step1: 2 min at 95°C; Step2: 5 s at 95°C and 30 s at 60°C for a total of 40 cycles; Table 7 PCR Amplification System

[0036] Finally, the 2^-ΔΔct method is used for data analysis of qRT-PCR. The results of qRT-PCR show that the expression patterns are almost the same compared with the RNA-seq data.

[0037] In addition, it should be understood that although this specification is described in terms of embodiments, not every embodiment contains only an independent technical solution. This narrative style of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A molecular marker related to flowering traits of Camellia chrysantha, characterized in that: The molecular markers include any one or more of the molecular markers A to J; the nucleotide sequences of the molecular markers A to J are shown in sequences 1 to 10 of the sequence table.

2. The use of molecular markers related to flowering traits of Camellia chrysantha as claimed in claim 1, characterized in that: During the cultivation of Camellia chrysantha, the leaf axils of Camellia chrysantha are taken as samples, and the molecular markers are detected by RT-qPCR detection method. When the expression of the molecular markers is upregulated by flower induction treatment, the formation of flower buds in the leaf axils can be promoted.

3. The use according to claim 2, characterized in that: The PCR kit used in the RT-qPCR detection method includes the following primers: Primer AF: GGCTGGTGGAAGGAAACCAA; Primer AR: TGGGTTCACAGTCCAAGGGA; Primer BF: AGCGGATCGAGAACTCCACT; Primer BR: GGAGACTTTGGCATCGCAGA; Primer CF: GTTCGCGAGAAACAGATGGAG; Primer CR: CGGAAGGCAAAAGGCATCTG; Primer DF: AGTGGACAACGACGGAGACT; Primer DR: ATGGTGAAGGTTAGGGTGGC; Primer EF: AGACGAGTCCTTAATGGTGGC; Primer ER: AGACAAGCAACAGCAACAAGT; Primer FF: TCTCCCTGAGGATGTCCCAA; Primer FR: AACCCAAACTCTTCTTCAGCTCT; Primer GF: AATCAAACCACGCCAACGAG; Primer GR: ACAACTTGGAAGAACCCCCAT; Primer HF: GTCTCCGGGTAACACTCCGA; Primer HR: GAGTCTACCCGAGGCGAGT; Primer IF: AACGTGACTCCCCACACATC; Primer IR: CGATGTTGATGCTCGAAGCG; Primer JF: CGCCTTCTTCTCTCTGCCAT; Primer JR: AGCAATCATCTACTTTGTCCTTGC; Primer KF: TCAAACAAGGATGAGGTGGCA; Primer KR: GGTGGACCAGCCTTAACTCA.

4. The use according to claim 2, characterized in that: The RT-qPCR detection method is to take the leaf axils of Camellia chrysantha as samples, use a plant RNA extraction kit to extract RNA, then use a reverse transcription kit to obtain cDNA, use cDNA as a template to prepare a PCR amplification system and perform PCR amplification and amplification product detection and analysis; the PCR amplification reaction procedure is as follows: Step 1: 95°C for 2 minutes; Step 2: 95°C for 5 s, 60°C for 30 s, for a total of 40 cycles.

5. The use according to claim 2, characterized in that: The flower induction treatment is to take Camellia chrysantha plants that are more than 4 years old, and then use paclobutrazol solution to treat the roots three times, and the time interval between each treatment is 15 days. The concentration of the paclobutrazol solution is 100 ppm.

Citation Information

Cited By

  • Application of transcription factor CnAP2.3 in regulation and control of camellia nitidissima flavonol synthesis

    CN117070554A

  • Molecular marker for identifying species of camellia golden camellia group and application of molecular marker

    CN120989285A