Molecular marker for regulating and controlling storage protein content and yield of wheat TaHOX9-1A and application of molecular marker

Abstract

The invention discloses a wheat TaHOX9-1A molecular marker for regulating and controlling the content and yield of storage protein and application of the wheat TaHOX9-1A molecular marker. The invention belongs to the field of molecular biology, and particularly relates to a wheat TaHOX9-1A molecular marker for regulating and controlling the content and yield of storage protein and application of the wheat TaHOX9-1A molecular marker. Compared with the TaHOX9-1A-Hap2 strain, the TaHOX9-1A-Hap1 strain has the advantages that the protein content, the plant height and the ear number per mu are remarkably reduced, but the grain number per ear and the yield are remarkably improved. The haplotype is an excellent allelic variation for cultivating the high-yield and stable-yield weak gluten high-quality wheat by considering that the protein content is reduced to contribute to cultivating the high-quality weak gluten wheat, and TaHOX9-1A-Hap2 is added to increase the yield, reduce the plant height and improve the lodging resistance, so that the haplotype is an excellent allelic variation for cultivating the high-yield and stable-yield weak gluten high-quality wheat; the wheat variety with the haplotype of TaHOX9-1A-Hap2 can be used as a parent for high-yield, stable-yield, weak-gluten and high-quality wheat breeding.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and particularly relates to wheat TaHOX9-1A molecular markers for regulating storage protein content and yield and their applications. Background Art

[0002] Wheat is one of the most important staple food crops in the world, and about 35% of the world's population takes wheat as the main food. In China, the planting area, total output and consumption of wheat all rank first in the world. The content and composition of storage proteins in wheat grains are important indicators determining the processing and nutritional quality of wheat, and mainly include glutenin and gliadin. Glutenin is divided into low molecular weight glutenin subunits (LMW-GS) and high molecular weight glutenin subunits (HMW-GS). HMW-GS is encoded by Glu-1 genes and determines the strength and elasticity of dough.

[0003] Previously, a transcription factor TaHOX9 that binds to the promoter of high molecular weight glutenin subunit was identified. Through haplotype and genetic effect analysis of TaHOX9 this, excellent haplotypes were identified and molecular markers available for breeding were developed, providing molecular tools for cultivating high-yield and high-quality wheat varieties. TaHOX9 Summary of the Invention

[0004] The main problem to be solved by the present invention is to identify or assist in identifying the content and / or yield of wheat storage proteins.

[0005] To solve the above problems, the present invention provides the application of substances for detecting the polymorphism or genotype or haplotype of SNP sites in the wheat genome in any of the following: (1) Identifying or assisting in identifying the content and yield of wheat storage proteins; (2) Wheat breeding; (3) Preparing products for identifying or assisting in identifying the content and yield of wheat storage proteins; (4) Preparing products for wheat breeding; The SNP site is an SNP site on chromosome 1A of wheat, and its nucleotide type is A or G, which is the 71st nucleotide of Sequence 4 in the sequence listing.

[0006] The haplotype is the haplotype described above TaHOX9-1A - Hap1 and haplotype TaHOX9-1A - Hap2 .

[0007] The haplotype TaHOX9-1A - Hap1The allelic variant bases at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 in the Chinese Spring wheat reference genome sequence RefSeq v1.0 are G, A, C, A, A, T, G, A, C, T, C, C, C, and G respectively; The haplotype TaHOX9-1A - Hap2 The allelic variant bases at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 in the Chinese Spring wheat reference genome sequence RefSeq v1.0 are C, G, T, G, G, G, C, G, T, C, T, T, T, and A respectively.

[0008] The present invention also provides a method for identifying or assisting in the identification of the storage protein content and yield of wheat, including method A or B: A) Detect the genotype of the SNP locus in the genome of the wheat to be tested, and identify or assist in the identification of the storage protein content and yield of wheat according to the genotype. The SNP locus is an SNP locus on chromosome 1A of wheat, and its nucleotide type is G or A, which is the 71st nucleotide of sequence 4 in the sequence listing; B) Detect the haplotype in the genome of the wheat to be tested, and identify or assist in the identification of the storage protein content and yield of wheat according to the haplotype. The haplotype is haplotype TaHOX9-1A - Hap1 and haplotype TaHOX9-1A - Hap2 , and the wheat variety with the haplotype TaHOX9-1A - Hap1 has a lower storage protein content than the wheat variety with the haplotype TaHOX9-1A - Hap2 ; the wheat variety with the haplotype TaHOX9-1A - Hap1 has a higher yield than the wheat variety with the haplotype TaHOX9-1A - Hap2 ; The present invention also provides a method for wheat breeding, including method M1) or M2): M1) Detect the genotype or the haplotype of the SNP locus described above in the wheat genome, and select wheat with the genotype GG of the SNP locus as a parent for breeding, where GG is the homozygous type of the SNP locus being G; M2) Detect the haplotype described above in the wheat genome, and select the wheat of the haplotype TaHOX9-1A-Hap1 as a parent for breeding, and the haplotype TaHOX9-1A-Hap1 at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 in the Chinese Spring wheat reference genome sequence RefSeqv1.0 has allelic variant bases of G, A, C, A, A, T, G, A, C, T, C, C, C, and G respectively.

[0009] The present invention also provides the application of the method described above in wheat breeding.

[0010] In this article, the purpose of the breeding may include cultivating wheat with high and stable yields, weak gluten, and good quality. The wheat can be a pure line variety or an inbred line.

[0011] As an implementation method, the method for wheat breeding may include the following steps: (1) Using the genomic DNA of the wheat to be tested as a template, perform KASP molecular marker detection with a primer composition; (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP locus of the wheat to be tested; (3) Select wheat with the GG genotype for breeding wheat with high and stable yields, weak gluten, and good quality.

[0012] In the above method, the reaction system of KASP can be: 2.0 μL KASP 2×Master Mix (LGC, product number: 13448166), 0.048 μL KASP primer (a mixture of 3 primers, with a total concentration of 50 μM, and the molar ratio of two forward primers to one reverse primer is 2:2:5), 2.0 μL template DNA (50 ng / μL).

[0013] The reaction program for KASP markers can be: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 61°C - 55°C (touch-down program, decreasing by 0.6°C per cycle), extension for 1 min, with 10 cycles of amplification; denaturation at 94°C for 20 s, annealing at 55°C for 1 min, followed by 31 additional cycles of amplification.

[0014] In the above method, the method for determining the genotype of the SNP in the wheat to be tested can be: after the PCR reaction is completed, use a fluorescence signal reader (Omega) and a fluorescence detection system (Araya) to convert the fluorescence signal into an analyzable value for reading the fluorescence data of the reaction product. Terminal fluorescence values are used for genotyping. Samples with the G base type carry FAM fluorescence and are distributed near the x-axis; samples with the A base type carry HEX fluorescence and are distributed near the y-axis; samples with no detected signal are distributed near the origin.

[0015] In the above method or application, the genotype of the SNP locus is GG or AA. GG is the homozygous type of the SNP locus being G, and AA is the homozygous type of the SNP locus being A. The storage protein content of the wheat to be tested with the genotype GG at the SNP locus is lower than that of the wheat to be tested with the genotype AA at the SNP locus; the yield of the wheat to be tested with the genotype GG at the SNP locus is higher than that of the wheat to be tested with the genotype AA at the SNP locus.

[0016] The present invention also provides the following products, which contain the substances in the above application, and the products are any one of: C1) Products for detecting single nucleotide polymorphisms or genotypes related to wheat storage protein content and yield; C2) Products for identifying or assisting in identifying wheat storage protein content and yield; C3) Products for wheat breeding.

[0017] In the above application, method, and product, the substance can be the reagents and / or instruments required for determining the polymorphism or genotype of the SNP locus by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. Among them, SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on "one-step" reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0018] In the above application or product, the substance can be any of the following D1), D2), or D3): D1) The substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP locus; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0019] In the above applications, methods and products, the primer composition may or may not be labeled with a labeling agent. The labeling agent refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Labeling agents include but are not limited to dyes; radioactive labels such as 32P; binding moieties such as biotin; haptens such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and individual fluorescent dyes or fluorescent dyes combined with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge-neutral. The label can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the label is detectable. In some embodiments, the nucleic acid is directly detected without a label (e.g., directly reading the sequence).

[0020] In the above application or product, the primer composition consists of primer F1, primer F2 and primer R; Primer F1 is a single-stranded DNA molecule with a nucleotide sequence that is sequence 1 in the sequence listing or a single-stranded DNA with a nucleotide sequence that is positions 22-39 of sequence 1 in the sequence listing; Primer F2 is a single-stranded DNA molecule with a nucleotide sequence that is sequence 2 in the sequence listing or a single-stranded DNA with a nucleotide sequence that is positions 22-39 of sequence 2 in the sequence listing; The nucleotide sequence of primer R is a single-stranded DNA molecule that is sequence 3 in the sequence listing.

[0021] The present invention also provides a DNA molecule, and the nucleotide sequence of the DNA molecule is sequence 4 in the sequence listing.

[0022] The present invention also provides the application of the above DNA molecule in any of the following: (1) Identifying or assisting in identifying the content and yield of wheat storage proteins; (2) Wheat breeding; (3) Preparing a product for identifying or assisting in identifying the content and yield of wheat storage proteins; (4) Preparing a product for wheat breeding.

[0023] Compared with existing technologies (such as SSR (Simple Sequence Repeat) markers, TaqMan probe technology, etc.), the KASP markers developed in this invention have the following advantages: 1) High throughput: suitable for large-scale sample detection; 2) High specificity: allele-specific primers ensure high accuracy; 3) Automation: fluorescence detection and analysis are automated, reducing human error; 4) Fast and efficient: the process from DNA extraction to result analysis is simple and efficient; 5) Low cost: KASP does not require special probes and the cost is lower than that of TaqMan. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 is for wheat TaHOX9-1A The mutation sites and haplotype typing results of the gene.

[0025] Figure 2 is the result of genotyping the wheat lines in the Huanghuai wheat region using KASP markers K-1A-SNP14 for the TaHOX9-1A wheat lines in the Huanghuai wheat region.

[0026] Figure 3 is the result of genotyping the wheat lines in the Huanghuai wheat region using KASP markers K-1A-SNP1 and K-1A-SNP8 for the TaHOX9-1A wheat lines in the Huanghuai wheat region. DETAILED DESCRIPTION OF THE INVENTION

[0027] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0028] Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0029] Unless otherwise specified, in the following embodiments, quantitative tests are all set with three repeated experiments, and the results are averaged.

[0030] The 142 natural populations in the Huanghuai wheat region in the following examples have been recorded in: Li J, Xie L, Tian X, Liu S, Xu D, Jin H, Song J, Dong Y, Zhao D, Li G, Li Y, Zhang Y, Zhang Y, Xia X, He Z, Cao S. (2021) TaNAC100 acts as an integrator of seed protein and starch synthesis exerting pleiotropic effects on agronomic traits in wheat. Plant Journal 108(3):829-840. The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0031] The following examples used Excel statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. The t-test was performed using the T-TEST model, and P < 0.05 (*) indicated a significant difference.

[0032] Embodiment 1, wheat TaHOX9-1A Identification of gene polymorphic sites and haplotypes transcription factor encoding gene TaHOX9-1A Wheat genome ID ( TraesCS1A02G157500 ) was input into the wheat genome variation database (Wheat-SnpHub-Portal, http: / / wheat.cau.edu.cn / Wheat_SnpHub_Portal / ), 188 varieties (MP group and NC-CC group) in the database were selected, and the variation information of 2 Kb upstream and downstream of the gene and the gene open reading frame was retrieved. A total of 14 variation sites were found, which were recorded as SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13 and SNP14 ( Figure 1), the physical positions of these 14 mutation sites in the Chinese Spring wheat reference genome sequence RefSeq v1.0 are 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 respectively. The variation information linked to the above genes forms two haplotypes TaHOX9-1A-Hap1 and TaHOX9-1A-Hap2 ( Figure 1 )。

[0033] TaHOX9-1A-Hap1 The allelic variant bases at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 in the Chinese Spring wheat reference genome sequence RefSeq v1.0 are G, A, C, A, A, T, G, A, C, T, C, C, C, and G respectively.

[0034] TaHOX9-1A-Hap2 The allelic variant bases at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 in the Chinese Spring wheat reference genome sequence RefSeq v1.0 are C, G, T, G, G, G, C, G, T, C, T, T, T, and A respectively.

[0035] Example 2, Identification TaHOX9-1A Development of molecular markers for haplotypes and their specific primer sets The present invention designed a set of primers suitable for KASP identification of wheat TaHOX9-1A haplotypes at SNP14 on chromosome 1A of wheat with the help of Polymarker (https: / / www.polymarker.info / ) (at position 279744233 in the Chinese Spring wheat reference genome sequence RefSeq v1.0)K-1A-SNP14 , and the specificity of the primer sequences was evaluated using WheatOmics (http: / / 202.194.139.32 / ).

[0036] The KASP primer set consists of forward primers F1 and F2 and a reverse primer R.

[0037] Forward primer F1: 5’- GAAGGTGACCAAGTTCATGCT AGAGATGGGCTGCTCCGC-3’ (SEQ ID No:1); (The underlined part is the specific recognition sequence of the FAM fluorescent probe) Forward primer F2: 5’- GAAGGTCGGAGTCAACGGATT AGAGATGGGCTGCTCCGT-3’ (SEQ ID No:2); (The underlined part is the specific recognition sequence of the HEX fluorescent probe); Reverse primer R: 5’-CTCCGACCGAGCTCACTTAC-3’ (SEQ ID No:3).

[0038] K-1A-SNP14 The nucleotide marked as the 71st position from the 5’ end of SEQ ID No:4 in the wheat genome (the complementary base of the last base at the 3′ end of the two forward primers) is G or A. In SEQ ID No:4, r represents G or A.

[0039] SEQ ID No:4: 5’-TCGTTCGGGCTTGCCTTTCTCATCTTCATCCAATCTGCTCCGACCGAGCTCACTTACCCGGTCGTGGATTrCGGAGCAGCCCATCTCTCAGTTCTCCATTGAAGGCTCGAACTGTTGTCAAACTTTCTCTGCCCAGGAAAA-3’.

[0040] The above nucleic acid sequences of SEQ ID No:1, SEQ ID No:2, and SEQ ID No:3 are antisense DNA sequences, and the nucleic acid sequence of SEQ ID No:4 is a sense DNA sequence.

[0041] Primer F1 is a primer with a FAM fluorescent tag sequence (the underlined bases) at the 5’ end. When combined with primer R, it amplifies the fragment with the nucleotide “G” at the SNP14 site, and the fluorescence signal of the FAM group can be read using a microplate reader or a real-time fluorescence quantitative PCR instrument; Primer F2 is a primer with a HEX fluorescent tag sequence (the underlined bases) at the 5'-end, and it combines with primer R to amplify the fragment with nucleotide "A" at the SNP14 locus. The fluorescence signal of the HEX group can be read by a microplate reader or a real-time fluorescence quantitative PCR instrument.

[0042] Example 3. Molecular Marker K-1A-SNP14 and Its Specific Primer Set in Identifying TaHOX9-1A Haplotypes of Natural Population Wheat 1. Field Phenotypic Identification and Data Analysis of 142 Natural Populations in the Yellow and Huai River Wheat Regions 142 natural wheat varieties in the Yellow and Huai River wheat regions were planted in Anyang, Henan and Suixi, Anhui during the 2012 - 2013 and 2013 - 2014 growing seasons, and in Anyang, Henan and Gaoyi, Hebei during the 2014 - 2015 growing season. A completely randomized block design was adopted with three replicates, single-row plots, row length of 1.5 m, row width of 0.2 m, and 50 seeds per row. Field management measures were carried out according to the local wheat field management specifications.

[0043] The phenotypic data of yield-related traits were sourced from the reference: Li J, Xie L, Tian X, Liu S, Xu D, Jin H, Song J, Dong Y, Zhao D, Li G, Li Y, Zhang Y, Zhang Y, Xia X, He Z, Cao S. (2021) TaNAC100 acts as an integrator of seed protein and starch synthesis exerting pleiotropic effects on agronomic traits in wheat. Plant Journal 108(3):829 - 840. The protein content was detected using a near-infrared reflectance spectrometer (Perten DA 7200, Springfield, IL, USA). The BLUP values of the phenotypic data of multi-environment storage proteins and yield component traits are shown in Table 1.

[0044] 2. Molecular Marker K-1A-SNP14 Detecting the Genotype of SNP14 Locus in Wheat Lines in the Yellow and Huai River Wheat Regions (1) Extract the genomic DNA of young leaves of 142 wheat lines using the CTAB method The quality and concentration of genomic DNA must both meet the requirements of PCR. The standards are as follows: Agarose gel electrophoresis shows a single DNA band without obvious smearing; when detected by a UV spectrophotometer Nanodrop2100 (Thermo), the A260 / A280 ratio is between 1.8 - 2.0 (no protein contamination in the DNA sample), the A260 / A230 ratio is between 1.8 - 2.0 (low salt ion concentration in the DNA sample), and there is no obvious light absorption at 270 nm (no phenol contamination in the DNA sample); the concentration of the wheat genomic DNA to be tested is 50 - 200 ng / μL.

[0045] (2)Kompetitive Allele Specific PCR (KASP) Using the genomic DNA of the wheat to be tested as a template, PCR amplification is carried out with the KASP primer set synthesized in Example 2 to obtain amplification products.

[0046] Reaction system: 2.0 μL KASP 2×Master Mix (LGC, product number: 13448166), 0.048 μL KASP primer (a mixture of 3 primers with a total concentration of 50 μM, and the molar ratio of two forward primers to one reverse primer is 2:2:5), 2.0 μL template DNA (50 ng / μL).

[0047] Reaction program: Pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing at 61℃ - 55℃ (using the touch down program, decreasing by 0.6℃ per cycle), for 1 min, with 10 cycles of amplification; denaturation at 94℃ for 20 s, annealing at 55℃ for 1 min, and continuing with 31 cycles of amplification.

[0048] (3)Fluorescence signal acquisition and genotyping Fluorescence signals are detected on a PHERAstar Plus autofocus fluorescence multi-functional microplate reader (BMG Labtech GmbH, Ortenberg, Germany), and genotyping is performed using KlusterCaller software (LGC, Hoddesdon, UK). When the temperature of the PCR amplification product drops below 40℃, the fluorescence values are read by scanning with the FAM and HEX beams of the microplate reader (the FAM fluorescence label is observed and read at the excitation wavelength of 485 nm and the emission wavelength of 520 nm, and the HEX fluorescence label is observed and read at the excitation wavelength of 528 nm and the emission wavelength of 560 nm). The genotype of the wheat to be tested based on SNP14 the locus is judged according to the fluorescence signal color.

[0049] The specific judgment principles are as follows: 1) If the wheat to be tested is based on K-1A-SNP14If the marker shows a blue fluorescence signal, then the genotype of the wheat to be tested at the SNP14 locus is homozygous GG, that is, the SNP14 locus in the wheat genome is homozygous for nucleotide G; 2) If the wheat to be tested shows a red fluorescence signal based on the K-1A-SNP14 marker, then the genotype of the wheat to be tested at the SNP14 locus is homozygous AA, that is, the SNP14 locus in the wheat genome is homozygous for nucleotide A.

[0050] The genotype classification of the SNP14 locus of 142 wheat lines is shown in Table 1, and the specific genotyping results are shown in Figure 2 .

[0051] Table 1. Genotype classification and phenotypic data of molecular markers K-1A-SNP14 for 142 representative wheat lines in the Yellow and Huai River wheat regions

[0052] 3. Association analysis of haplotypes of wheat TaHOX9-1A gene with storage protein content and main agronomic traits According to the genotyping results and phenotypic data, a t-test was performed using the TTEST model of Excel statistical software to judge the TaHOX9-1A genetic effects of different haplotypes of the TaHOX9-1A gene on storage protein content and yield-related traits. The genetic analysis results of storage protein content and yield-related traits are shown in Table 2, and the experimental results are expressed as mean ± standard deviation. Based on the SNP14 locus genotypes divided by the above KASP markers, the TaHOX9-1A gene can be divided into two haplotypes: TaHOX9-1A-Hap1 (where the genotype of SNP14 is GG); TaHOX9-1A-Hap2 (where the genotype of SNP14 is AA).

[0053] Table 2. TaHOX9-1A Analysis of the phenotypic relationship between the haplotypes of the TaHOX9-1A gene and wheat storage protein content and yield-related traits

[0054] Note: Table 2 shows the statistical comparison of two haplotypes TaHOX9-1A-Hap1 and TaHOX9-1A-Hap2 in terms of storage protein content, yield, number of spikes per unit area, number of grains per spike, 1000-grain weight, and plant height traits. * indicates significant difference (P < 0.05).

[0055] In summary, the haplotype analysis results show that: (1) Compared with type TaHOX9-1A-Hap1 , TaHOX9-1A-Hap2 the storage protein content is significantly increased by 3.36%; (2) Compared with type TaHOX9-1A-Hap1 , TaHOX9-1A-Hap2 the yield is significantly decreased by 4.76%; (3) Compared with type TaHOX9-1A-Hap1 , TaHOX9-1A-Hap2 the number of spikes per mu is significantly increased by 7.52%; (4) Compared with type TaHOX9-1A-Hap1 , TaHOX9-1A-Hap2 the number of grains per spike is significantly decreased by 6.71%; (5) Compared with type TaHOX9-1A - Hap1 , TaHOX9-1A - Hap2 the plant height is significantly increased by 5.6%.

[0056] During the R & D process of the present invention, for the 14 SNP loci mentioned above TaHOX9-1A existing in it, Polymarker (https: / / www.polymarker.info / ) was used to attempt to develop them into KASP markers respectively. The primer design results show that only 3 SNP loci can initially generate KASP primers, namely SNP1, SNP8 and SNP14 loci. Using three groups of KASP primers: K-SNP1-1A ; K-SNP8-1A and K-SNP14-1A to genotype the TaHOX9-1A wheat lines in the Huanghuai wheat region, the results show that ( Figure 2 and Figure 3 ), K-SNP14-1A the genotyping effect is significantly better than that of K-SNP1-1A and K-SNP8-1A.

[0057] The above details the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any changes, uses or improvements of the present invention, including changes made using conventional techniques known in the art that are outside the scope disclosed in this application.

Claims

1. Application of a substance for detecting polymorphism, genotype or haplotype of a SNP site in a wheat genome in any of the following: (1) Identify or assist in identifying the content and yield of wheat storage protein; (2) Wheat breeding; (3) Prepare products for identification or auxiliary identification of wheat storage protein content and yield; (4) Preparing wheat breeding products; The SNP site is a SNP site on wheat chromosome 1A, the nucleotide type of which is G or A, and is the 71st nucleotide of sequence 4 in the sequence list; The haplotype is a haplotype TaHOX9-1A - Hap1 and haplotype TaHOX9-1A - Hap2 , the haplotype is TaHOX9-1A - Hap1 The storage protein content of wheat varieties is lower than that of haplotype TaHOX9-1A - Hap2 Wheat variety; the haplotype is TaHOX9-1A - Hap1 The wheat variety yield is higher than the haplotype TaHOX9-1A - Hap2 Wheat varieties; The haplotype TaHOX9-1A - Hap1 The allelic variant bases at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are G, A, C, A, A, T, G, A, C, T, C, C, C, and G, respectively; The haplotype TaHOX9-1A - Hap2 The allelic variant bases at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993 and 279744233 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are C, G, T, G, G, G, C, G, T, C, T, T, T, T and A, respectively.

2. A method for identifying or assisting in identifying the content and yield of wheat storage protein, characterized in that , including method A or B: A) detecting the genotype of a SNP site in the genome of wheat to be tested, and identifying or assisting in identifying the content and yield of storage protein in wheat according to the genotype, wherein the SNP site is a SNP site on chromosome 1A of wheat, the nucleotide type of which is G or A, and is the 71st nucleotide of sequence 4 in the sequence list; B) detecting haplotypes in the wheat genome to be tested, and identifying or assisting in identifying the content and yield of wheat storage protein based on the haplotypes, wherein the haplotypes are haplotypes TaHOX9-1A - Hap1 and haplotype TaHOX9-1A - Hap2 , the haplotype is TaHOX9-1A - Hap1 The storage protein content of wheat varieties is lower than that of haplotype TaHOX9-1A - Hap2 Wheat variety; the haplotype is TaHOX9-1A - Hap1 The wheat variety yield is higher than the haplotype TaHOX9-1A - Hap2 Wheat varieties; The haplotype TaHOX9-1A - Hap1 The allelic variant bases at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are G, A, C, A, A, T, G, A, C, T, C, C, C, and G, respectively; The haplotype TaHOX9-1A - Hap2 The allelic variant bases at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993 and 279744233 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are C, G, T, G, G, G, C, G, T, C, T, T, T, T and A, respectively.

3. A method for wheat breeding, characterized in that , including method M1) or M2): M1) detecting the genotype of the SNP site in claim 1 in the wheat genome, and selecting wheat with a genotype of GG at the SNP site as a parent for breeding, wherein GG is a homozygous type of G at the SNP site; M2) Detecting the haplotype described in claim 1 in the wheat genome and selecting the haplotype TaHOX9-1A-Hap1 wheat as a parent for breeding, the haplotype TaHOX9-1A-Hap1 The allelic variant bases at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993 and 279744233 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are G, A, C, A, A, T, G, A, C, T, C, C, C and G, respectively.

4. Application of the method according to claim 2 or 3 in wheat breeding.

5. The use according to claim 1, or the method according to claim 2 or 3, characterized in that: The genotype of the SNP site is GG or AA, wherein GG is the homozygous type of the SNP site being G, and AA is the homozygous type of the SNP site being A; the storage protein content of the wheat to be tested whose genotype of the SNP site is GG is lower than that of the wheat to be tested whose genotype of the SNP site is AA; the yield of the wheat to be tested whose genotype of the SNP site is GG is higher than that of the wheat to be tested whose genotype of the SNP site is AA.

6. The product, characterized in that The product contains the substance in the application described in claim 1, and the product is any one of: C1) Products for detecting single nucleotide polymorphisms or genotypes related to wheat storage protein content and yield; C2) Products that identify or assist in identifying the content and yield of wheat storage protein; C3) Products used in wheat breeding.

7. The use according to claim 1 or the product according to claim 6, characterized in that: The substance is as follows (D1), (D2) or (D3): D1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site; D2) the substance is a PCR reagent containing the primer combination described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The use or product according to claim 7, characterized in that: The primer composition consists of primer F1, primer F2 and primer R; The primer F1 is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 39th position of sequence 1 in the sequence list; The primer F2 is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 39th position of sequence 2 in the sequence list; The primer R nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence list.

9. A DNA molecule, characterized in that The nucleotide sequence of the DNA molecule is sequence 4 in the sequence listing.

10. Use of the DNA molecule according to claim 9 in any of the following: (1) Identify or assist in identifying the content and yield of wheat storage protein; (2) Wheat breeding; (3) Prepare products for identification or auxiliary identification of wheat storage protein content and yield; (4) Preparing wheat breeding products.

Images