Primer probe combination for detecting pepper blast bacteria and application of primer probe combination
Through primer probe combination and RPA amplification technology, the problem that the existing technology is difficult to identify the Phytophthora capsia population that harms pepper crops is solved, high sensitivity detection of pepper pesticide bacteria is achieved, detection accuracy is improved, and rapid field detection methods are provided.
Patent Information
- Application Number
- CN202510282374.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-11
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-03-11
AI Technical Summary
It is difficult to effectively identify the Phytophthora capsia population that harms pepper crops in the prior art, especially in areas where the genetic and morphological differentiation of Phytophthora capsia is significant.
A primer probe combination is provided, including forward primers, reverse primers and probes. Through RPA amplification and LF chromatography, it can specifically detect pepper peptida bacteria and improve detection accuracy to the level of intraspecies subpopulation.
It has achieved high sensitivity detection of the subpopulation of pepper plague in the Phytophthora capsia population, improved the detection accuracy, and can quickly complete the detection in the field, providing fast and accurate identification methods for the prevention and control of pepper plague.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological detection, and particularly to a primer-probe combination for detecting Phytophthora capsici and its application. Background Art
[0002] Pepper (Piper nigrum Linn.) is a perennial tropical spice crop, known as the "king of spices", and the pepper production in China ranks fifth in the world. Pepper blight is a devastating soil-borne disease, which once caused the pepper planting area in China to shrink by nearly 30% within several years. Its pathogen is Phytophthora capsici. Phytophthora capsici not only harms pepper, but also can infect more than 50 kinds of economic crops, including: Solanaceae crops such as pepper and tomato, Cucurbitaceae crops such as cucumber and watermelon, Cruciferae crops such as Chinese cabbage and cabbage, Leguminosae crops such as kidney bean and cowpea, and tropical crops such as pepper and rubber tree, etc., which causes great harm to agriculture. Phytophthora capsici disease has the characteristics of "fast spread, easy outbreak, strong destructiveness, and difficult to prevent and treat", and it is a worldwide prevention and control problem. "Early detection and early prevention" is the consistent principle for preventing and controlling such diseases. And rapid identification of the pathogen is the key core for determining "early detection".
[0003] There are generally genetic differences among regions of Phytophthora capsici in the world, resulting in regional differentiation in its mating type, pathogenicity, drug resistance and other characteristics. This differentiation not only exists between large regions such as countries, provinces and cities, but can even occur between small regions within a province or city, and even between different hosts in the same region. Generally, it is considered that the differentiation differences in genetics and morphology of Phytophthora capsici between tropical and temperate regions are particularly significant. At present, there is no effective method to identify the group that harms this crop from the numerous Phytophthora capsici populations. Summary of the Invention
[0004] In view of this, the technical problem to be solved by the present invention is to provide a primer-probe combination for detecting Phytophthora capsici and its application. The primer-probe combination and its detection method provided by the present invention have the advantages of strong specificity, high sensitivity, simple equipment, rapid detection, etc.
[0005] The present invention provides a primer-probe combination, including a forward primer, a reverse primer and a probe, wherein:
[0006] The forward primer has:
[0007] (1), the nucleotide sequences shown in SEQ ID NO:1 and SEQ ID NO:2; or
[0008] (2), the complementary sequences of the nucleotide sequences shown in (1); or
[0009] (3) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (1) or (2), and a nucleotide sequence having the same or similar function as the nucleotide sequence as shown in (1) or (2); or
[0010] (4) A nucleotide sequence having at least 80% identity with the nucleotide sequence as shown in (1), (2) or (3);
[0011] The reverse primer has:
[0012] (5) A nucleotide sequence as shown in SEQ ID NO:2; or
[0013] (6) A complementary sequence of the nucleotide sequence as shown in (5); or
[0014] (7) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (5) or (6), and a nucleotide sequence having the same or similar function as the nucleotide sequence as shown in (5) or (6); or
[0015] (8) A nucleotide sequence having at least 80% identity with the nucleotide sequence as shown in (5), (6) or (7).
[0016] The probe has:
[0017] (9) A nucleotide sequence as shown in SEQ ID NO:3; or
[0018] (10) A complementary sequence of the nucleotide sequence as shown in (9); or
[0019] (11) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (9) or (10), and a nucleotide sequence having the same or similar function as the nucleotide sequence as shown in (9) or (10); or
[0020] (12) A nucleotide sequence having at least 80% identity with the nucleotide sequence as shown in (9), (10) or (11).
[0021] In some embodiments, the 5'-end of the reverse primer is labeled with biotin;
[0022] The 5'-end of the probe is labeled with a fluorophore, an idsp group is modified between 30 bp and 31 bp from the 5'-end, and the 3'-end of the probe is modified with a group that blocks polymerase amplification.
[0023] In some specific embodiments, the 5'-end of the reverse primer is labeled with Biotin biotin;
[0024] The 5'-end of the probe is labeled with a 6-FAM fluorescent group, and the 3'-end of the probe is modified with a C3 dSpacer blocking group to block polymerase amplification.
[0025] The present invention provides the application of the primer-probe combination in the preparation of a reagent or kit for detecting Phytophthora capsici.
[0026] In some embodiments, the samples to be detected include plant tissues and / or soil samples.
[0027] The present invention provides a reagent or kit for detecting Phytophthora capsici, comprising the primer-probe combination.
[0028] In some embodiments, it further includes at least one of RPA enzyme, RPA reaction buffer, magnesium acetate solution, chromatography buffer, ddH 2 O and chromatography test strips.
[0029] In some embodiments, the concentration of the magnesium acetate solution is 280 mM, and the chromatography buffer is 0.1 M Tris buffer with a pH of 7.5 to 8.5.
[0030] The present invention provides a method for detecting Phytophthora capsici, comprising the following steps:
[0031] Step 1: Extract the DNA of the sample;
[0032] Step 2: Using the DNA of the sample as a template, perform RPA amplification with the primer-probe combination or the reagent or kit;
[0033] Step 3: Determine whether the sample contains Phytophthora capsici according to the result of RPA amplification in Step 2.
[0034] In some embodiments, the reaction system for RPA amplification includes:
[0035]
[0036] In some embodiments, the reaction conditions for RPA amplification are 25-45 °C for 5-60 min.
[0037] In some embodiments, in step 2, RPA amplification is performed using the reagent or kit described in claim 5 or 6. In step 3, the amplification product, RPA reaction solution, and HybriDetect Assay Buffer are mixed to prepare a mixed solution. The sample application area of the chromatographic test strip is placed in the mixed solution, and the result is observed after standing at room temperature for 3 - 4 minutes. If bands appear on both the quality control line and the test line of the chromatographic test strip, the test result is positive, indicating that the sample to be tested contains Phytophthora capsici. If only a band appears on the quality control line of the test strip, the test result is negative, indicating that the sample to be tested does not contain Phytophthora capsici. If only a band appears on the test line of the test strip or no band appears, it indicates that the test result is invalid.
[0038] Compared with the prior art, the primer - probe combination provided by the present invention can effectively detect the Phytophthora capsici subgroup in the Phytophthora capsici population, improving the detection accuracy from the level of conventional species to the level of subspecies within the species. The detection sensitivity can reach 50 pg / μL. Combining the integrated DNA rapid extraction, RPA isothermal amplification, and LF flow - through chromatography methods, it is possible to complete the detection of Phytophthora capsici in the field within 30 minutes without relying on a laboratory, providing a fast and accurate identification means for the field prevention and control of Phytophthora capsici and scientific research. Brief Description of the Drawings
[0039] Figure 1 Shows the ypt1 gene sequence alignment results and primer positions of various Phytophthora species in Example 1;
[0040] Figure 2 Shows the comparison of the detection accuracy between the primer set of the present invention and Comparative Primer 1 in Example 1, where 1 and 2 are Phytophthora capsici (isolated from Hainan pepper), 3 is Phytophthora capsici (isolated from Fujian pepper), 4 is Phytophthora capsici (isolated from Jiangsu pepper), 5 is Phytophthora capsici (isolated from Shandong eggplant), 6 is Phytophthora capsici (isolated from Yunnan zucchini), 7 is Phytophthora capsici (isolated from Hainan tomato), 8 is Phytophthora nicotianae, 9 is Phytophthora sojae, 10 is Phytophthora infestans, 11 is Phytophthora parasitica, 12 is Phytophthora palmivora, 13 is Fusarium solani, 14 is Colletotrichum gloeosporioides, 15 is Lasiodiplodia theobromae, 16 is Escherichia coli, 17 is Bacillus subtilis, 18 is Pseudomonas fluorescens, 19 is the blank control;
[0041] Figure 3Comparison of the detection accuracy between the primer-probe set of the present invention and Comparative Primer 2 in Example 2, where 1 and 2 are Phytophthora capsici (isolated from Hainan pepper), 3 is Phytophthora capsici (isolated from Fujian pepper), 4 is Phytophthora capsici (isolated from Jiangsu pepper), 5 is Phytophthora capsici (isolated from Shandong eggplant), 6 is Phytophthora capsici (isolated from Yunnan zucchini), 7 is Phytophthora capsici (isolated from Hainan tomato), 8 is Phytophthora parasitica var. nicotianae, 9 is Phytophthora sojae, 10 is Phytophthora infestans, 11 is Phytophthora parasitica, 12 is Phytophthora palmivora, 13 is Fusarium solani f. sp. phaseoli, 14 is Colletotrichum gloeosporioides, 15 is Lasiodiplodia theobromae, 16 is Escherichia coli, 17 is Bacillus subtilis, 18 is Pseudomonas fluorescens, 19 is the water control;
[0042] Figure 4 Shows the detection results of DNA of Phytophthora capsici at different concentrations in Example 3, where 1-9 are 200 ng / μL, 100 ng / μL, 31.25 ng / μL, 6.25 ng / μL, 1.25 ng / μL, 250 pg / μL, 50 pg / μL, 10 pg / μL and the water control in sequence;
[0043] Figure 5 Shows the experimental flow chart in Example 4;
[0044] Figure 6 Shows the field rapid detection results of pepper leaf samples in Example 4, where 1 is the leaf after being infected by Phytophthora capsici through artificial inoculation, 2-8 are field pepper leaf samples, and 9 is a healthy pepper leaf;
[0045] Figure 7 Shows the field rapid detection results of pepper vine samples in Example 5, where 1 is the pepper vine after being infected by Phytophthora capsici through artificial inoculation, 2-8 are field pepper vine samples, and 9 is a healthy pepper vine;
[0046] Figure 8 Shows the field rapid detection results of field suspected Phytophthora capsici samples in Example 6, where 1 is the DNA of Phytophthora capsici, 2 is water, and 3-44 are field-collected suspected Phytophthora capsici samples. Detailed implementation mode
[0047] The present invention provides a primer-probe combination for detecting Phytophthora capsici and its application. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those related can obviously make changes or appropriate alterations and combinations to the methods and applications in this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.
[0048] The test materials used in the present invention are all ordinary commercially available products and can be purchased in the market. The present invention will be further described below in conjunction with the embodiments.
[0049] Example 1
[0050] There are obvious conserved regions and variable regions in the guanosine triphosphate (GTP)-binding protein gene (ypt1) sequence among Phytophthora species, which are considered to be useful for the species identification of Phytophthora. By comparing the ypt1 sequence differences between 2 strains of Phytophthora capsici (Phytophthora capsici causing pepper blight) isolated from Hainan pepper and 5 strains of Phytophthora capsici isolated from other hosts at home and abroad and 8 other Phytophthora species, the results are as Figure 1 shown. Although the homology among 7 strains of Phytophthora capsici is over 99%, there is a 12-bp deletion (gap) (see Figure 1 , upstream primer position) between 2 pepper host strains and 5 other host Phytophthora capsici strains, which provides conditions for identifying Phytophthora capsici causing pepper blight from the Phytophthora capsici population. Based on the differences between the pepper-isolated strains and other Phytophthora capsici and other Phytophthora species, the present invention designs a set of detection primers suitable for recombinase polymerase amplification (RPA), including upstream primer 5’-AGTTAGAGCACTGGACTAATTATCTTGTGC-3’ (SEQ ID NO:1), downstream primer 5’-Biotin-ATCCAATGGCACTAAGTTCTGCGTGCGTTAC-3’ (SEQ ID NO:2), and probe 5’-6-FAM-AAGAGTCTTTCAACAACGTCAAGCAGTGGT / idsp / GCATGAGATCGATAG-C3 Space-3’ (SEQ ID NO:3), where idsp is a nucleotide analogue without bases, enabling the probe to be specifically recognized and used for the color development of positive bands in the detection results.
[0051] The detection accuracy of the primer set was compared with that of the comparative primer 1. The comparative primer 1 was from the draft of the local standard of Hainan Province, "Technical Regulations for Molecular Detection of Phytophthora capsici Pathogen" (the website link is https: / / agri.hainan.gov.cn / hnsnyt / xxgk / tzgg / gggs / 202408 / t20240813_3713941.html) publicly soliciting opinions by the Department of Agriculture and Rural Affairs of Hainan Province. The upstream primer is 5'-GACGTTTTAGTTAGAGCAC-3' (SEQ ID NO:4), and the downstream primer is 5'-AATGGCACTGAAGTTCTG-3' (SEQ ID NO:5). The length of the amplified target fragment is 230 bp. For the upstream and downstream primers of the present invention, conventional PCR amplification does not require a probe. The length of the amplified target fragment is 218 bp.
[0052] The specific experimental method is as follows:
[0053] (1)Collection of DNA from samples to be tested
[0054] Collect the DNA of 5 strains of Phytophthora capsici isolated from pepper plants from various places in China (2 strains from pepper hosts, 1 strain from eggplant host, 1 strain from tomato host, 1 strain from zucchini host), the DNA of 2 strains of Phytophthora capsici, the DNA of 5 strains of Phytophthora such as Phytophthora parasitica, Phytophthora palmivora, Phytophthora nicotianae, Phytophthora sojae, and Phytophthora infestans, the DNA of 3 strains of fungi such as Lasiodiplodia theobromae, Colletotrichum gloeosporioides, and Fusarium solani, and the DNA of 3 strains of bacteria such as Pseudomonas fluorescens, Escherichia coli, and Bacillus subtilis. The DNA concentration is about 50 ng / μL.
[0055] (2)Conventional PCR amplification and electrophoresis detection
[0056] Adopt the method in the "Technical Regulations for Molecular Detection of Phytophthora capsici Pathogen".
[0057] Figure 2 It can be seen from the results that among the results of this group of primers, the detection results of 2 strains of Phytophthora capsici (Phytophthora capsici) from pepper hosts in Hainan are positive, and the detection results of 5 strains of Phytophthora capsici isolated from other hosts from various places, 5 strains of Phytophthora of other species, 3 strains of fungi of different species, and 3 strains of bacteria of different species are negative, indicating that this primer can be used to identify Phytophthora capsici. The Phytophthora capsici and other Phytophthora capsici of the control primer are both positive, and the Phytophthora capsici subpopulation in the Phytophthora capsici population cannot be distinguished.
[0058] Example 2
[0059] Compare the detection accuracy of the primer-probe set of the present invention with that of the comparative primer 2
[0060] Control Primer 2: Control Primer 2 is from the "Phytophthora capsici Detection Kit (Colloidal Gold Method)" of Guangdong Xuanda Testing Technology Service Co., Ltd. (executing the enterprise standard "Q GZSLX 001-2023"). Forward primer 5'-AGCAACCAAAGTTTAAGACGTTTTAGTTAGAGC-3' (SEQ ID NO:6), reverse primer 5'-Biotin-TAAATCCAATGGCACTGAAGTTCTGCGTGTGTT-3' (SEQ ID NO:7), probe 5'-6-FAM-GAGCACTGGACTAATTATTGTGCTAATTGTC / idSp / TGTGCATTTGTAGTG-C3 Space -3' (SEQ ID NO:8). The length of the amplified target fragment is 252 bp.
[0061] The primer-probe set of the present invention includes a forward primer, a reverse primer and a probe, as specifically shown in Example 1.
[0062] The specific experimental method is as follows:
[0063] (1)Collection of DNA from the sample to be tested
[0064] Same as Example 1.
[0065] (2)RPA amplification
[0066] Use the TwistAmp nfo Kit kit for RPA amplification. According to the instructions, add 29.4 μL of A buffer, 2 μL of 10 μM forward and reverse primers each, 0.6 μL of 10 μM probe, 12.5 μL of sterile water, and 1 μL of DNA from the sample to be tested to each dry powder. Add 2.5 μl of buffer B and invert 8-10 times to mix well, and react at room temperature for 15 min.
[0067] (3)LF chromatography and result determination
[0068] Use the Milenia Genline HybriDetect 1 kit for LF chromatography detection. According to the instructions, take 10 μL of the RPA reaction solution, add 190 μL of HybriDetect Assay Buffer (chromatography buffer) and invert to mix well. Place the chromatography test strip and let it stand for about 3-5 min until the control line appears. Two lines indicate positive, only the control line indicates negative, and no control line indicates failure.
[0069] Figure 3As can be seen from the results, among the results of this group of primers, the detection results of 2 strains of Phytophthora capsici (the pathogen of pepper blight) on Hainan pepper hosts were positive, and the detection results of 5 strains of Phytophthora capsici isolated from other hosts from various places, 5 strains of Phytophthora of other species, 3 strains of fungi of different species, and 3 strains of bacteria of different species were negative, indicating that this primer can be used to identify the pathogen of pepper blight. The pathogen of pepper blight and other Phytophthora capsici of the control primer were both positive, and the pathogen subpopulation of pepper blight in the Phytophthora capsici population could not be distinguished.
[0070] Example 3
[0071] Sensitivity analysis of the primer-probe group of the present invention for the DNA concentration of the pathogen sample of pepper blight
[0072] (1) Preparation of the DNA of the sample to be tested
[0073] Prepare the DNA samples to be tested for the pathogen of pepper blight. The concentration gradients are: 200 ng / μL, 100 ng / μL, 31.25 ng / μL, 6.25 ng / μL, 1.25 ng / μL, 250 pg / μL, 50 pg / μL, and 10 pg / μL.
[0074] (2) RPA amplification
[0075] Same as Example 2.
[0076] (3) LF chromatography and result determination
[0077] Same as Example 2.
[0078] Figure 4 As can be seen from the results, obvious positive detection bands could be detected for the samples with concentrations of 200 ng / μL, 100 ng / μL, 31.25 ng / μL, 6.25 ng / μL, 1.25 ng / μL, and 250 pg / μL. A faint band could be detected for the sample with a concentration of 50 pg / μL, and the result could also be determined as positive; there were no detection bands for the sample with 10 pg / μL and the water control. The results show that the lower limit of the DNA concentration of the sample that can be detected by this method is 50 pg / μL, and ideal bands can be shown when the DNA concentration ≥ 250 pg / μL.
[0079] Example 4
[0080] The detection results and verification of the primer-probe group of the present invention for pepper leaf samples, and the experimental flow chart is as Figure 5 shown. The specific experimental method is as follows:
[0081] (1) Extraction of the DNA of the pepper leaf sample
[0082] Take 30 mg to 50 mg of tissue at the junction of diseased and healthy tissues, put it into a 2.0 ml EP tube, add 500 μl of DNA extraction buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1% Tween 20, 2% PVP-40) and 1 glass bead (about 5 mm in diameter), and shake vigorously up and down for 15 s. Insert a qualitative filter paper strip about 3×50 mm in length and width into the extraction solution for 5 s, take it out and gently immerse it in 800 μl of washing buffer (10 mM Tris pH 8.0, 0.1% Tween 20) and immediately lift it, and immerse and extract it repeatedly 3-5 times.
[0083] (2)RPA amplification
[0084] Use the TwistAmp nfo Kit kit for RPA amplification. According to the instructions, add 29.4 μL of Abuffer, 2 μL of 10 μM upstream and downstream primers, 0.6 μL of 10 μM probe, and 13.5 μL of sterile water to each dry powder. Gently immerse and lift the DNA carrier, and extract it repeatedly 15 times. Add 2.5 μl of buffer B (from the amplification kit) and invert it up and down 8-10 times to mix well, and react at room temperature for 15 min.
[0085] (3)LF chromatography and result determination
[0086] Same as Example 2.
[0087] (4)Laboratory method verification of detection results
[0088] Take 100 mg of the same sample in “(1) DNA extraction of pepper leaf samples”, and extract DNA with the “High-efficiency Plant Genome DNA Extraction Kit” (DP350, Tiangen). Use the ypt1 amplification universal primers (ypt1-F: ACGGAGAGCTACATCTCGAC; ypt1-R: GTCAGATCGCTCTTGTTACC), and use the “2×HotStart Taq PCR Premix Reagent” (KT202, Tiangen) for PCR amplification. After the PCR products are separated by 1% agarose gel electrophoresis, the target bands are purified and recovered with the “Universal DNA Purification and Recovery Kit” (DP214, Tiangen). The recovered products are subjected to TA cloning through the “pMD 18-T Vector Cloning Kit” (6011, TaKaRa), and then transferred into Escherichia coli TOP10 competent cells. After screening out positive clones by colony PCR, they are sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. After the sequencing results are subjected to BLAST alignment analysis on the NCBI website, the results are filled in Table 1.
[0089] Table 1 Comparison of Field Rapid Test Results and Laboratory Tests of Pepper Leaf Samples and Pepper Vine Samples
[0090]
[0091] Note: + indicates that the sample test result is positive; - indicates that the sample test result is negative.
[0092] Figure 6 It can be seen from the results that the test result of the artificially inoculated pathogenic leaves of Phytophthora capsici (sample 1) is positive, the test result of the field pepper leaf sample 2 is positive, the test results of the field pepper leaf samples 3 to 8 are negative, and the control result of the healthy pepper leaf is negative.
[0093] Combined with Table 1, it can be seen that the field test results are completely consistent with the laboratory identification results.
[0094] Example 5
[0095] Detection Results and Verification of Pepper Vine Samples Using the Primer-Probe Group of the Present Invention
[0096] The implementation method is the same as that of Example 4.
[0097] The results show that Figure 7 It can be seen that the test result of the artificially inoculated pathogenic stem vines of Phytophthora capsici (sample 1) is positive, the test results of the field pepper vine samples 5 and 6 are positive, the test results of the field pepper vine samples 3, 4, 7, and 8 are negative, and the control result of the healthy pepper vine is negative.
[0098] Combined with Table 1, it can be seen that the field test results are completely consistent with the laboratory identification results.
[0099] Example 6
[0100] Field Detection Application of the Primer-Probe Group of the Present Invention
[0101] The implementation method is the same as that of Example 4.
[0102] Figure 8 It can be seen from the results that the test result of the Phytophthora capsici DNA sample (positive control) is positive; the test result of the water sample (negative control) is negative; among the 22 suspected Phytophthora capsici field samples (No. 3 - 44), 23 samples have positive test results and 19 samples have negative test results; the DNA control result is positive, the water control result is negative, and the number of failed test results is 0.
[0103] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.
Claims
1. A primer-probe combination, characterized in that: It includes a forward primer, a reverse primer and a probe, wherein: The forward primer has: (1) The nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2; or (2) A complementary sequence of the nucleotide sequence shown in (1); or (3) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1) or (2), and having the same or similar function as the nucleotide sequence shown in (1) or (2); or (4) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1), (2) or (3); The reverse primer has: (5) the nucleotide sequence shown in SEQ ID NO: 2; or (6) A complementary sequence of the nucleotide sequence shown in (5); or (7) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (5) or (6), and having the same or similar function as the nucleotide sequence shown in (5) or (6); or (8) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (5), (6) or (7); The probe has: (9) the nucleotide sequence shown in SEQ ID NO: 3; or (10) A complementary sequence of the nucleotide sequence shown in (9); or (11) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (9) or (10), and having the same or similar function as the nucleotide sequence shown in (9) or (10); or (12) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (9), (10) or (11).
2. The primer-probe combination according to claim 1, characterized in that: The 5' end of the reverse primer is labeled with biotin; The 5' end of the probe is labeled with a fluorescent group, and the portion 30 bp to 31 bp from the 5' end is modified with an idsp group, and the 3' end of the probe is modified with a group that blocks polymerase amplification.
3. Use of the primer-probe combination according to claim 1 or 2 in preparing a reagent or a kit for detecting pepper blast pathogen.
4. The use according to claim 2, characterized in that: The samples to be tested include plant tissues and / or soil samples.
5. A reagent or kit for detecting pepper blast pathogen, characterized in that: Comprising the primer-probe combination of claim 1 or 2.
6. The reagent or kit according to claim 5, characterized in that It also includes at least one of RPA enzyme, RPA reaction buffer, magnesium acetate solution, chromatography buffer, ddH2O and chromatography test strips.
7. A method for detecting pepper blast pathogen, characterized in that: The steps include: Step 1: Extract DNA from the sample; Step 2, using the DNA of the sample as a template, and using the primer-probe combination of claim 1 or 2 or the reagent or kit of claim 5 or 6 to perform RPA amplification; Step 3: Determine whether the sample contains pepper blast pathogen according to the result of RPA amplification in step 2.
8. The method according to claim 7, characterized in that The reaction system of the RPA amplification includes:
9. The method according to claim 8, characterized in that The reaction conditions of the RPA amplification are 25-45° C. for 5-60 min.
10. The method according to claim 7, characterized in that In the step 2, the reagent or kit according to claim 5 or 6 is used to perform RPA amplification. In the step 3, the amplification product, the RPA reaction solution and the chromatography buffer are mixed to prepare a mixed solution, and the sample area of the chromatography test strip is placed in the mixed solution, and the result is observed after being left at room temperature for 3 to 4 minutes; if bands appear on both the quality control line and the test line of the chromatography test strip, the test result is positive, indicating that the sample to be tested contains pepper blast fungus; if only the quality control line on the test strip has a band, the test result is negative, indicating that the sample to be tested does not contain pepper blast fungus; If only the test line shows strips or no strips appear on the test strip, it means that the test result is invalid.
Citation Information
Patent Citations
Primer for molecularly detecting phytophthora capsici leonian and application thereof
CN101445825A
Molecule detection technique of cayenne pepper phytophthora capsici polygalacturonase (Pcipg) 5 genes
CN101643782A
Primers for detecting phytophthora cinnamomi and nested PCR detection method
CN106868164A
Molecular detection method for high throughput detection of 8 species of phytophthora
CN110079631A
DNA bar code and primer group for identifying genetic relationship of pepper and application of DNA bar code and primer group
CN116334292A