KASP marker and primer for identifying high-temperature-resistant character of cotton and application of KASP marker and primer

Abstract

The invention belongs to the technical field of cotton breeding, and particularly relates to a KASP marker and a primer for identifying high-temperature-resistant characters of cotton and application of the KASP marker and the primer. The invention provides a KASP marker for identifying the high-temperature-resistant character of cotton, M at the 51st site of the nucleotide sequence of the KASP marker is an SNP site, the polymorphism is A or C, and the cotton with the site of CC homozygous type is higher in high-temperature resistance than cotton with the site of AA homozygous type. The KASP marker provided by the invention is closely associated with the high-temperature-resistant phenotype of cotton, and can be used for rapid identification and breeding of high-temperature-resistant excellent varieties of cotton.

Description

Technical Field

[0001] The present invention belongs to the technical field of cotton breeding, and more specifically, relates to KASP markers, primers for identifying heat-tolerant traits of cotton, and their applications. Background Art

[0002] High temperature can lead to a decline in cotton pollen viability, withering and shedding of young buds, a significant reduction in boll setting on the upper part, i.e., the third-to-last fruiting branch, resulting in a large number of bud and boll drop, reduced yield, and deteriorated quality, which has become an important problem restricting cotton production. High temperature can also cause cotton to flower prematurely, with a shorter growth period, resulting in a decline in the yield and quality of fibers. The cultivation of new heat-tolerant cotton varieties is the main measure to cope with future high temperatures and break through the bottleneck of stagnant per-unit yield for many years.

[0003] With the decline in sequencing costs and the development of molecular biology, molecular marker-assisted selection has a short cycle and wide applicability, and has become the mainstream technology for new variety breeding, which can greatly improve breeding efficiency. Molecular markers have been popularized and applied in crops such as rice, wheat, corn, and rapeseed, but still mainly focus on yield and quality traits, and there is less research and application on stress resistance and other environmental adaptability traits.

[0004] Therefore, it is very necessary to develop a molecular marker that can screen materials related to heat tolerance in cotton for the rapid identification and breeding of excellent heat-tolerant cotton varieties. Summary of the Invention

[0005] The purpose of the present invention is to provide a KASP marker, primers for identifying heat-tolerant traits of cotton, and their applications to solve the above technical problems.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] The present invention provides a KASP marker for identifying heat-tolerant traits of cotton, and its nucleotide sequence is as shown in SEQ ID NO.1. The M at the 51st position of this sequence is a SNP site, and the polymorphism is A or C. Cotton with a CC homozygous type at this site is more heat-tolerant than cotton with an AA homozygous type at this site.

[0008] The present invention determines the heat-tolerant traits of cotton by judging the SNP site polymorphism of the gene sequence at the 5486185 position of chromosome D06 of cotton. When the SNP site of the cotton gene sequence is detected as the CC homozygous type, it is considered that the cotton has heat-tolerant traits.

[0009] The present invention also provides a specific primer for amplifying the above KASP marker, including the upstream primer shown in SEQ ID NO.2, SEQ ID NO.3, and the downstream primer shown in SEQ ID NO.4.

[0010] The present invention also provides a kit for detecting the high-temperature tolerance trait of cotton, and the kit includes the specific primers described above.

[0011] Furthermore, the kit further includes 2×KASPMix and Primer Common.

[0012] The present invention also provides the application of the KASP marker, the specific primer or the kit in identifying the high-temperature tolerance trait of cotton.

[0013] Furthermore, it includes the application of the kit in detecting the high-temperature tolerance trait of cotton and cotton breeding or assistant breeding.

[0014] The present invention also provides a method for detecting the high-temperature tolerance trait of cotton, including the following steps:

[0015] (1) Extract the DNA of the cotton to be tested;

[0016] (2) Using the extracted DNA as a template, perform amplification with specific primers to obtain an amplification product;

[0017] (3) Identify the genotype at the 51st position of the amplification product, and judge the high-temperature tolerance trait of the cotton according to the genotype.

[0018] Furthermore, the judgment is as follows: when the genotype locus at the 51st position of the amplification product is the CC homozygous type, it is judged that the cotton has the high-temperature tolerance trait.

[0019] The present invention has the following beneficial effects:

[0020] The present invention provides a KASP marker for identifying the high-temperature tolerance trait of cotton. The KASP marker can be used for the rapid identification and breeding of excellent cotton varieties with high-temperature tolerance, laying a foundation for the large-scale and rapid identification and screening of cotton materials with high-temperature tolerance, and contributing to subsequent cotton molecular breeding. Description of the Drawings

[0021] Figure 1 It is a scatter plot of the KASP genotyping of the SNP locus of GhD06-5486185 in 308 upland cotton resource materials. Among them, NTC is the control, A: A is the AA homozygous type, and C: C is the CC homozygous type.

[0022] Figure 2 It is a heat map of the high-temperature tolerance clustering of 308 upland cotton resource materials.

[0023] Figure 3Heatmap of correlation analysis of 13 important traits, where plant height is PH, height of the first node is HFNFH, number of fruiting branches is EFB, number of bolls is NB, single boll weight is SBW, lint percentage is LP, pollen viability is PV, leaf area is LA, chlorophyll is Chl, number of dry buds is DBs, abscission rate of the third-to-last fruiting branch is FB3, number of bolls on the third-to-last fruiting branch is CB3, and abscission rate is DR.

[0024] Figure 4 Diagram of differential analysis of different genotypes of 7 traits after high-temperature stress. Among them, A is the diagram of differential analysis of different genotypes of pollen viability, B is the diagram of differential analysis of different genotypes of leaf area, C is the diagram of differential analysis of different genotypes of chlorophyll, D is the diagram of differential analysis of different genotypes of number of dry buds, E is the diagram of differential analysis of different genotypes of abscission rate of the third-to-last fruiting branch, F is the diagram of differential analysis of different genotypes of number of bolls on the third-to-last fruiting branch, and G is the diagram of differential analysis of different genotypes of abscission rate.

[0025] Figure 5 Diagram of differential analysis of different genotypes of agronomic traits and yield traits. Among them, A is the diagram of differential analysis of different genotypes of plant height, B is the diagram of differential analysis of different genotypes of height of the first node, C is the diagram of differential analysis of different genotypes of number of fruiting branches, D is the diagram of differential analysis of different genotypes of number of bolls, E is the diagram of differential analysis of different genotypes of single boll weight, and F is the diagram of differential analysis of different genotypes of lint percentage. Detailed implementation mode

[0026] The present invention will be described in detail below with reference to specific embodiments, but it should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0027] Example 1: Development of KASP marker for GhD06-5486185 SNP locus.

[0028] The KASP marker of the present invention is obtained through genome-wide association analysis QTL mapping interval D06-5486088 of the resequencing data of the upland cotton natural population and the high-temperature tolerance phenotype data. There is an A / C SNP mutation at position 5486185 on chromosome D06. KASP molecular markers are developed based on its haplotype and the phenotypic characteristics of 308 resource materials. The version number of the upland cotton TM-1 whole genome sequence is ZJUv2.1, and the website is:

[0029] https: / / www.cottongen.org / species / Gossypium_hirsutum / ZJU-AD1_v2.1.

[0030] A total of 308 upland cotton resource materials for molecular marker development were used in this experiment, all of which were collected and provided by the Institute of Cash Crops, Xinjiang Academy of Agricultural Sciences. The DNA in the leaves of 308 upland cotton resource materials was extracted using the modified CTAB method. Xinjiang Aidisen Biotechnology Co., Ltd. was commissioned to develop KSAP markers for the GhD06-5486185 SNP locus through the LGC high-throughput genotyping detection platform. The KASP marker primer sequences are shown in Table 1, the PCR amplification system and reaction program are shown in Tables 2 and 3, and the product results are shown in SEQ ID NO.1.

[0031] SEQ ID NO.1: TTGACGATTAGCATCAGATATCGGATAAGAAAATCT AAATGTTCAAAATAMTTTTATAAAAAAAACTGAACTATAAAAGAGAATG AGAAAAAGAGCTTTCG.

[0032] Table 1: KASP marker primer sequences.

[0033] Primer Sequence 5′-3′ SEQ ID NO. F1 GAAGGTCGGAGTCAACGGATTTTTGCGTGTGCGTGGTATT 2 F2 GAAGGTGACCAAGTTCATGCTTTGCGTGTGCGTGGTATG 3 R CGAGTTTTCAAAATAGATGAATGTT 4

[0034] Table 2: KASP detection PCR amplification system.

[0035] Component 1× System 2× KASPMix 1μl 100μM F1 / F2 0.003μl 100μM R 0.003μl 100μM Primer Common 0.008μl DNA 1μl Total 2μl

[0036] All components in Table 2 are components in the kit KASP 2X Master Mix, which was purchased from LGC Limited with the product number KBS-1050-112.

[0037] Table 3: KASP detection PCR reaction program.

[0038]

[0039] The genotyping results are as Figure 1 shown. Among the 308 materials, 138 materials had the genotype C / C and 170 materials had the genotype A / A.

[0040] Example 2: Phenotypic identification and high-temperature tolerance evaluation of 308 resource materials.

[0041] Relevant tests on the phenotypic identification of high-temperature tolerance and agronomic traits of 308 resource materials were carried out at the Cotton Comprehensive Experiment Station of Xinjiang Academy of Agricultural Sciences, the 16th Regiment of the First Division in Alar City, Xinjiang in 2022 and 2023. Their names, genotypes and 13 phenotypic data are shown in Table 4.

[0042] Table 4: Names, genotypes and 13 phenotypic data of 308 upland cotton resources.

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059] Note: PH is plant height, HFNFH is the height of the first node, EFB is the number of fruiting branches, NB is the number of bolls, SBW is the weight of a single boll, LP is the lint percentage, PV is the pollen viability, LA is the leaf area, Chl is the chlorophyll, DBs is the number of dry buds, FB3 is the abscission rate of the third top fruiting branch, CB3 is the number of bolls on the third top fruiting branch, and DR is the abscission rate.

[0060] The planting pattern of drip irrigation under plastic film with six rows per film was adopted, the planting density was 15,500 plants per mu, the random block design was used with 3 replicates, and the row length was 4.5 m. Thirteen important traits including plant height, the height of the first node, the number of fruiting branches, the number of bolls, the weight of a single boll, the lint percentage, the pollen viability, the leaf area, the chlorophyll, the number of dry buds, the abscission rate of the third top fruiting branch, the number of bolls on the third top fruiting branch, and the abscission rate were investigated.

[0061] The specific investigation methods are as follows: (1) Plant height: After the cotton plant height stops growing after topping, measure the plant height of 5 consecutive plants in mid-August, and take the average value as 1 replicate. (2) Height of the first node: Measure the height of the first node of 5 consecutive plants in mid-August, and take the average value as 1 replicate. (3) Number of fruiting branches: Measure the number of fruiting branches of 5 consecutive plants before harvest, and take the average value as 1 replicate. (4) Number of bolls: Measure the number of bolls set on 5 consecutive plants before harvest. (5) Single boll weight: Mix and harvest 20 cotton flowers for each replicate to calculate the single boll weight. (6) Lint percentage: Mix and harvest 20 cotton flowers for each replicate, and the ratio of the weight of seed cotton to the lint cotton ginned out is one replicate. (7) Pollen viability: After high-temperature stress, measure the pollen viability at the tetrad stage. Sample the flowers and immerse them in 2,3,5-triphenyltetrazolium chloride solution, then let it stand at room temperature for 1 hour, add 2% sulfuric acid to stop the staining, take pictures of the pollen under the microscope, and measure the pollen viability as the percentage of normally stained pollen in the total number of pollen. (8) Leaf area: Use an LA-S leaf area meter to measure the leaf areas of the top, middle, and bottom leaves of 5 consecutive plants, and take the average value as 1 replicate. (9) Chlorophyll: Use a SPAD-502 chlorophyll meter to measure the chlorophyll content near the main vein of the leaf and on both sides of the functional leaf of 5 consecutive plants, and take the average value as 1 replicate. (10) Number of dry buds: After high-temperature stress, measure the number of dry bud bolls of 5 consecutive plants within 10 - 15 days, and take the average value as 1 replicate. (11) Abscission rate of the third-to-last fruiting branch: Measure the number of abscised third-to-last fruiting branches of 5 consecutive plants before harvest, and take the average value as 1 replicate. (12) Number of bolls set on the third-to-last fruiting branch: Measure the number of bolls set on the third-to-last fruiting branch of 5 consecutive plants before harvest, and take the average value as 1 replicate. (13) Abscission rate: The ratio of the number of empty fruiting nodes to the total number of fruiting nodes.

[0062] The data of 13 trait indicators in this experiment were statistically analyzed using EXCEL2010 software and R language. Based on the genotypes at the GhD06 - 5486185 SNP locus and the high-temperature tolerance phenotypes of 308 upland cotton resource materials, a differential analysis was carried out to achieve the purpose of associating genotypes with phenotypes and exploring the relationship between genotypes and high-temperature tolerance in upland cotton.

[0063] Based on the pollen viability, leaf area, chlorophyll, number of dry buds, abscission rate of the third-to-last fruiting branch, and abscission rate at the tetrad stage after high-temperature stress, a comprehensive cluster analysis of the high-temperature tolerance of 308 upland cotton resource materials was carried out by cluster analysis. The analysis results are as Figure 2As shown in the figure, Class I is high-temperature resistant materials, with 62 materials, among which the proportion of C / C genotype is 83.87% and the proportion of A / A genotype is 16.13%. Class II is relatively high-temperature resistant materials, with 106 materials, among which the proportion of C / C genotype is 66.04% and the proportion of A / A genotype is 33.96%. Class III is materials sensitive to high temperature, with 68 materials, among which the proportion of C / C genotype is 14.71% and the proportion of A / A genotype is 85.29%. Class IV is extremely high-temperature sensitive materials, with 72 materials, among which the proportion of C / C genotype is 8.33% and the proportion of A / A genotype is 91.67%. Among them, the materials with C / C genotype generally have strong high-temperature resistance, with a total of 138 materials.

[0064] To explore the relationship between phenotypic traits, the corrplot software in R language was used to conduct a correlation analysis between phenotypes. Unmarked represents no significant difference; * represents P < 0.05, indicating a significant correlation between different phenotypic traits; ** represents P < 0.01, indicating a significant correlation between different phenotypic traits; *** represents P < 0.001, indicating an extremely significant correlation between different phenotypic traits. The analysis results are as Figure 3 shown. A correlation analysis was conducted on 13 trait indicators. The results showed that after high-temperature stress, there were extremely significant correlations among pollen viability, leaf area, chlorophyll, dry bud number, boll setting number of the third-to-last fruiting branch, abscission rate of the third-to-last fruiting branch, and abscission rate. The dry bud number, abscission rate of the third-to-last fruiting branch, and abscission rate were negatively correlated with other traits. After high-temperature stress, the 7 phenotypic data of pollen viability, leaf area, chlorophyll, dry bud number, boll setting number of the third-to-last fruiting branch, abscission rate of the third-to-last fruiting branch, and abscission rate were grouped into one category, and the remaining traits were grouped into another category. This indicates that these 7 phenotypic data can reflect the response of cotton to high-temperature stress from different angles.

[0065] Example 3: Genotype and phenotype association analysis.

[0066] Based on 308 upland cotton resource materials, an association analysis was conducted between the genotype at the GhD06-5486185 SNP locus and other phenotypes to achieve the purpose of associating genotype with phenotype and exploring the relationship between genotype and high-temperature resistance. The ggplot software in R language was used to conduct a two-tailed T test between phenotypes and genotypes. NS represents no significant difference; ** represents P < 0.01, indicating a significant difference in the same phenotypic traits among different genotypes as a whole.

[0067] As Figure 4As shown in the figure, there are significant differences in pollen viability, leaf area, chlorophyll content, number of dry buds, number of bolls on the third-to-last fruiting branch, abscission rate of the third-to-last fruiting branch, and overall abscission rate between A / A and C / C genotypes. Overall, the C / C genotype materials have higher pollen viability, larger leaf area, higher chlorophyll content, and more bolls on the third-to-last fruiting branch. The C / C genotype materials have fewer dry buds, lower abscission rate of the third-to-last fruiting branch, and lower overall abscission rate. This indicates that there is a strong correlation between genotype variation and the overall high-temperature tolerance of the 308 materials.

[0068] The relationship between different genotypes and agronomic traits and yield traits was further analyzed, and the results are as Figure 5 shown in the figure. Except for plant height and the height of the first fruiting node, there are no significant differences in other traits such as the number of fruiting branches, number of bolls, single boll weight, and lint percentage. Overall, the C / C genotype materials have higher plant height and the height of the first fruiting node. These results indicate that the genotype at the GhD06-5486185 SNP locus is significantly associated with multiple trait indicators related to high-temperature tolerance in cotton. Overall, the C / C genotype has better high-temperature tolerance and does not affect important traits such as the number of bolls, single boll weight, and lint percentage. This indicates that the GhD06-5486185 SNP locus, as a molecular marker, has important significance in the identification and screening of high-temperature tolerance in cotton resource materials.

[0069] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that any value between the two endpoints of each numerical range and the two endpoints themselves can be selected. To avoid redundancy, preferred embodiments of the present invention are described.

[0070] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic inventive concept. Therefore, the appended claims are intended to be construed as including the preferred embodiments and all changes and modifications falling within the scope of the present invention.

[0071] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these changes and modifications.

Claims

1. A KASP marker for identifying high temperature resistance traits of cotton, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

1. The M at position 51 of the sequence is a SNP site, and the polymorphism is A or C. Cotton with CC homozygous type at the site is more resistant to high temperature than cotton with AA homozygous type at the site.

2. A specific primer for amplifying the KASP marker according to claim 1, characterized in that: It includes upstream primers as shown in SEQ ID NO.2 and SEQ ID NO.3, and downstream primers as shown in SEQ ID NO.

4.

3. A kit for detecting high temperature resistance of cotton, characterized in that: The kit comprises the specific primer according to claim 2.

4. The kit according to claim 3, characterized in that The kit also includes 2×KASPMix and PrimerCommon.

5. Use of the KASP marker according to claim 1, the specific primer according to claim 2 or the kit according to claim 3 in identifying the high temperature resistance trait of cotton.

6. Use of the KASP marker according to claim 1, the specific primer according to claim 2 or the kit according to claim 3 in cotton breeding or assisted breeding, characterized in that: The breeding is to cultivate high temperature resistant cotton germplasm.

7. A method for detecting high temperature resistance of cotton, characterized in that: The following steps are involved: (1) Extracting cotton DNA to be tested; (2) using the extracted DNA as a template and performing amplification using the specific primers described in claim 3 to obtain an amplified product; (3) Identifying the genotype at position 51 of the amplified product, and determining the high temperature resistance of the cotton according to the genotype.

8. A method for detecting high temperature resistance of cotton according to claim 7, characterized in that: The judgment is: when the genotype site at position 51 of the amplified product is CC homozygous, the cotton is considered to have the high temperature resistance trait.

Images