Specific molecular marker for rapidly detecting thinopyrum intermedium 7J chromosome and application of specific molecular marker

Abstract

The invention discloses a specific molecular marker for rapidly detecting a 7J chromosome of elytrigia intermedium and application of the specific molecular marker. Belongs to the technical field of plant molecular genetics. According to the invention, four specific molecular markers (sacThiC20-4, sacThiC20-32, sacThiC20-64 and sacThiC20-94) of the 7J chromosome of the elytrigia intermedium, which are newly found, are not reported before the invention is used for detecting the 7J chromosome of the elytrigia intermedium. The newly found molecular marker can be used for rapidly detecting the 7J chromosome or the 7J chromosome segment in an elytrigia intermedium chromosome engineering line (chromosome addition line, substitution line, translocation line and didiploid) in the distant hybridization process of elytrigia intermedium or wheat and elytrigia intermedium. The invention has an important value for identifying the 7J chromosome in the field of elytrigia intermedium genetic breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of plant molecular genetics, and more specifically, to a specific molecular marker for rapidly detecting the 7J chromosome of Thinopyrum intermedium and its application. Background Art

[0002] Thinopyrum intermedium (2n = 6x = 42, JJ s S) is a perennial herbaceous plant of the genus Thinopyrum in the family Poaceae, also known as blue wheatgrass, blue crested wheatgrass or intermediate wheatgrass, and is a long-day, strong winter-hardy, perennial wild forage grass. Thinopyrum intermedium is native to eastern Europe and is naturally distributed in regions such as the Caucasus and Central Asia. In China, it is mainly distributed in regions such as Qinghai, Xinjiang, Inner Mongolia, and Northeast China. The plant height of Thinopyrum intermedium over 3 years is generally 80-140 cm, and the spike length is 20-30 cm. It has abundant leaf biomass, excellent grass quality, high cellulose and protein content, good palatability, and is favored by cattle, horses, and sheep. It can be used as an excellent forage resource. It has well-developed roots and extremely strong cold tolerance, and is suitable for soil and water conservation, wind prevention and sand fixation, and dam protection in alpine, arid and semi-arid regions, and can play a major role in the ecological environment protection of the upper reaches of large rivers such as the Yangtze River and the Yellow River. At the same time, it is immune to various diseases such as powdery mildew, stripe rust, leaf rust, and stem rust of cereal crops such as wheat and barley, and is highly resistant to root rot, leaf blight, sheath blight, head blight, yellow dwarf disease, stripe mosaic disease, etc. It is an important gene resource for the genetic improvement of cereal crops.

[0003] Introducing the excellent genes of Thinopyrum intermedium into cultivated crops through distant hybridization is an important research content in modern crop genetic improvement. Sun Shancheng et al. (1953) used the methods of sexual hybridization, continuous backcrossing and directional selection of offspring to breed new octoploid Trititrigia species with excellent agronomic traits such as Zhong 1, Zhong 2, Zhong 3, Zhong 4, and Zhong 5 - wheat-Thinopyrum intermedium partial amphiploids using wheat and Thinopyrum intermedium. Gauderon et al. (1966) developed the wheat-Thinopyrum intermedium partial amphiploid TAF46 using the backcross method, which has excellent resistance to wheat yellow dwarf disease and stripe mosaic disease. Liu et al. (2005) screened out the powdery mildew-resistant partial amphiploid E990256 in the offspring of the cross between Yannong 15 and Thinopyrum intermedium using the GISH method with the St genome as a probe. Bao et al. (2009) comprehensively used techniques such as morphology, cytology, and genomic in situ hybridization to breed 10 TE series octoploid Trititrigia such as TE253 and TE257 from the offspring of the cross between common wheat and Thinopyrum intermedium.

[0004] In recent years, Qi Xiaolei (2017), Cui Yu (2018), Zhang Wenjie (2020), Li Jianbo (2021), Hu Junmei (2022), Zhang Xiaojun (2022), etc. have carried out distant hybridization between Thinopyrum intermedium and wheat, and selected a large number of new breeding germplasms such as double ditelosomics, addition lines, substitution lines, etc. However, since the whole genome map of Thinopyrum intermedium has not been published, the identification of Thinopyrum intermedium chromosomes generally relies on cytological methods including C-banding, N-banding, GISH, and FISH, which have problems such as low detection resolution and slow identification speed, seriously affecting the effective utilization of Thinopyrum intermedium gene resources. The development of molecular marker technology provides a new development direction for its molecular identification, and the use of specific molecular markers developed based on Thinopyrum intermedium sequences can effectively solve this problem.

[0005] In summary, how to provide a method for quickly identifying the 7J chromosome of Thinopyrum intermedium is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides a specific molecular marker for quickly detecting the 7J chromosome of Thinopyrum intermedium and its application. The present invention provides 4 specific molecular markers for the 7J chromosome of Thinopyrum intermedium, which are used for quickly detecting the 7J chromosome of Thinopyrum intermedium.

[0007] In order to achieve the above object, the present invention adopts the following technical scheme:

[0008] A primer pair for a specific molecular marker sacThiC20-4 for quickly detecting the 7J chromosome of Thinopyrum intermedium, and the nucleotide sequence of the specific molecular marker sacThiC20-4 is:

[0009] ACCAATATTAGCCGCAGTCTCAAATGAGTCCTGGAGCTATCCAGGT TCTGCAGTTTCCAAGCTGCCATCATCCATCACAAATGCTCCCCCAGCCG ACACACCATGTCCGCATTG, SEQ ID NO:1;

[0010] The nucleotide sequence of the primer pair is:

[0011] sacThiC20-4-F: 5'-ACCAATATTAGCCGCAGTCTCA-3', SEQ ID NO:2;

[0012] sacThiC20-4-R: 5'-CAATGCGGACATGGTGTGTC-3', SEQ ID NO:3.

[0013] A primer pair for a specific molecular marker sacThiC20-32 for rapid detection of the 7J chromosome of Thinopyrum intermedium, and the nucleotide sequence of the specific molecular marker sacThiC20-32 is as follows:

[0014] TATCACTCGCCCAGGTTAGCGGTGTAGCTTTGGTCTTTTAACATCG AATGATCGTTCAACAGCTTCCCAAAACATCTTCGCATGATCGCACTGCA AAAGGC, SEQ ID NO:4;

[0015] The nucleotide sequence of the primer pair is as follows:

[0016] sacThiC20-32-F: 5'-TATCACTCGCCCAGGTTAGC-3', SEQ ID NO:5;

[0017] sacThiC20-32-R: 5'-GCCTTTTGCAGTGCGATCAT-3', SEQ ID NO:6.

[0018] A primer pair for a specific molecular marker sacThiC20-64 for rapid detection of the 7J chromosome of Thinopyrum intermedium, and the nucleotide sequence of the specific molecular marker sacThiC20-64 is as follows:

[0019] GTGTTCTCAAGAGGAGGAGCATATCGTGTACTGCAGAAACCAATT AGCACATCACAAATATATTTGTGAGCGAGTGAGCACCTAAGTGTATAC TCCTCCACCGTTTAGGGTTTAGCCGTGTGCG, SEQ ID NO:7;

[0020] The nucleotide sequence of the primer pair is as follows:

[0021] sacThiC20-64-F: 5'-GTGTTCTCAAGAGGAGGAGCAT-3', SEQ ID NO:8;

[0022] sacThiC20-64-R: 5'-CGCACACGGCTAAACCCTA-3', SEQ ID NO:9.

[0023] A primer pair for a specific molecular marker sacThiC20-94 for rapid detection of the 7J chromosome of Thinopyrum intermedium, and the nucleotide sequence of the specific molecular marker sacThiC20-94 is as follows:

[0024] AAAACAAGGCTTTCGCCCAAAGCCCTGCGCCCGTCCACCTGACCAAGCCCTGGGGAAGGGGCTCTGCCACTGCCAATGGAGAGCGCACTGCAGCCCGCACTGCACCGACAGCGTTAAACCATGGCCACCGGACCGAGAGCCCGCCGATCAAGCCACACATCACCATGA, SEQ ID NO:10;

[0025] The nucleotide sequences of the primer pairs are as follows:

[0026] sacThiC20-94-F: 5'-AAAACAAGGCTTTCGCCC-3', SEQ ID NO:11;

[0027] sacThiC20-94-R: 5'-TCATGGTGATGTGTGGCT-3', SEQ ID NO:12.

[0028] A method for rapid detection of Thinopyrum intermedium 7J chromosome in plant materials, comprising the following steps:

[0029] (1) Extract the genomic DNA of the plant to be detected. Using the extracted genomic DNA as a template, perform PCR amplification with the primer pairs of the above-mentioned specific molecular marker sacThiC20-4 or the primer pairs of the above-mentioned specific molecular marker sacThiC20-32 or the primer pairs of the above-mentioned specific molecular marker sacThiC20-64 or the primer pairs of the above-mentioned specific molecular marker sacThiC20-94.

[0030] (2) Separate the amplification products by electrophoresis; if the target bands of the specific molecular marker sacThiC20-4 or the specific molecular marker sacThiC20-32 or the specific molecular marker sacThiC20-64 or the specific molecular marker sacThiC20-94 are amplified, it indicates that the plant to be detected contains Thinopyrum intermedium 7J chromosome.

[0031] Furthermore, the PCR reaction system is: 5 μL of 2×TaqPCR Mix premix, 1 μL of primer-F at 50 ng / μL, 1 μL of primer-R at 50 ng / μL, 1.5 μL of template DNA at 50 - 100 ng / μL, 1.5 μL of sterile deionized water, and the total volume of the reaction system is 10 μL.

[0032] Furthermore, the PCR amplification program is: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 45 seconds, extension at 72°C for 30 seconds, running for 35 cycles; finally, extension at 72°C for 10 minutes.

[0033] Application of the primer pair of the above-mentioned specific molecular marker in detecting the 7J chromosome of Thinopyrum intermedium

[0034] As can be seen from the above technical solution, compared with the prior art, the beneficial effects obtained by the present invention are as follows:

[0035] Four specific molecular markers of the 7J chromosome of Thinopyrum intermedium newly discovered by the present invention have not been reported before the present invention. The newly discovered molecular markers can be used for rapid detection of the 7J chromosome or 7J chromosome fragments in Thinopyrum intermedium or chromosome engineering lines (chromosome addition lines, substitution lines, translocation lines and double diploids) of the distant hybridization between wheat and Thinopyrum intermedium. The present invention has important value for the identification of the 7J chromosome in the field of genetic breeding of Thinopyrum intermedium. Description of the Drawings

[0036] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0037] Figure 1 The attached drawings are the amplification results of the molecular marker sacThiC20-4 primer provided by the present invention among different plant materials to be detected. From left to right in each lane are: 1 is the indicator band; 2 is Thinopyrum intermedium Z1141-1; 3 is Thinopyrum intermedium Z1141-2; 4 is common wheat Chinese Spring; 5 is common wheat Jintai 170; 6 is wheat-Thinopyrum intermedium 7J chromosome addition line CH52; the 114bp band indicated by the arrow represents the presence of the 7J chromosome or 7J chromosome fragment;

[0038] Figure 2 The attached drawings are the amplification results of the molecular marker sacThiC20-32 primer provided by the present invention among different plant materials to be detected. From left to right in each lane are: 1 is the indicator band; 2 is Thinopyrum intermedium Z1141-1; 3 is Thinopyrum intermedium Z1141-2; 4 is common wheat Chinese Spring; 5 is common wheat Jintai 170; 6 is wheat-Thinopyrum intermedium 7J chromosome addition line CH52; the 101bp band indicated by the arrow represents the presence of the 7J chromosome or 7J chromosome fragment;

[0039] Figure 3The attached figure shows the amplification results of the molecular marker sacThiC20-64 primer provided by the present invention among different plant materials to be detected. From left to right in each lane: 1 is the indicator band; 2 is Thinopyrum intermedium Z1141-1; 3 is Thinopyrum intermedium Z1141-2; 4 is common wheat Chinese Spring; 5 is common wheat Jintai 170; 6 is wheat-Thinopyrum intermedium 7J chromosome addition line CH52; the 124bp band indicated by the arrow represents the presence of the 7J chromosome or a 7J chromosome fragment.

[0040] Figure 4 The attached figure shows the amplification results of the molecular marker sacThiC20-94 primer provided by the present invention among different plant materials to be detected. From left to right in each lane: 1 is the indicator band; 2 is Thinopyrum intermedium Z1141-1; 3 is Thinopyrum intermedium Z1141-2; 4 is common wheat Chinese Spring; 5 is common wheat Jintai 170; 6 is wheat-Thinopyrum intermedium 7J chromosome addition line CH52; the 168bp band indicated by the arrow represents the presence of the 7J chromosome or a 7J chromosome fragment. Detailed implementation manners

[0041] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the attached figures in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0042] In the following specific embodiments, unless otherwise specified, the experimental methods used are all conventional methods known to those skilled in the art.

[0043] In the following specific embodiments, the sources of the experimental materials used are as follows:

[0044] Thinopyrum intermedium Z1141 can be purchased commercially or introduced from each breeding unit or germplasm bank;

[0045] The common wheat variety Chinese Spring can be purchased commercially or introduced from each breeding unit or germplasm bank;

[0046] The common wheat variety Jintai 170 can be purchased commercially or introduced from each breeding unit or germplasm bank;

[0047] The wheat-Thinopyrum intermedium 7J chromosome addition line CH52 can be purchased commercially or introduced from each breeding unit or germplasm bank;

[0048] The DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.;

[0049] The primer sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd.;

[0050] The Taq PCR Mix was purchased from Sangon Biotech (Shanghai) Co., Ltd., Order NO. B639295;

[0051] Sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd.;

[0052] For other experimental materials, reagents, or equipment, if not otherwise specified, they are all represented as commercially available and conventional in the art.

[0053] Example 1

[0054] Detection of the molecular marker sacThiC20-4 in the plant material to be tested (nucleotide sequence: ACCAATATTAGCCGCAGTCTCAAATGAGTCCTGGAGCTATCCAGGTTCT GCAGTTTCCAAGCTGCCATCATCCATCACAAATGCTCCCCCAGCCGACA CACCATGTCCGCATTG, SEQ ID NO: 1)

[0055] The primers for detecting the molecular marker sacThiC20-4 are sacThiC20-4-F and sacThiC20-4-R, and their sequences are as follows:

[0056] sacThiC20-4-F: 5'-ACCAATATTAGCCGCAGTCTCA-3', SEQ ID NO: 2;

[0057] sacThiC20-4-R: 5'-CAATGCGGACATGGTGTGTC-3', SEQ ID NO: 3.

[0058] The detection process is as follows:

[0059] Extract the genomic DNA of the plant to be tested. Using the extracted genomic DNA as a template, perform PCR amplification with sacThiC20-4-F and sacThiC20-4-R as primers. After the amplification is completed, separate the amplification products by electrophoresis. If a corresponding 114bp DNA band can be amplified, it is a plant material containing the Thinopyrum intermedium 7J chromosome or a 7J chromosome fragment.

[0060] Among them, the PCR reaction system used is shown in Table 1 below:

[0061] Table 1 PCR reaction system of Example 1

[0062] Reagent Volume Specification 2× TaqPCR Mix Premix 5 μL 1.0 mL sacThiC20-4-F 1 μL 50 ng / μL sacThiC20-4-R 1 μL 50 ng / μL Template DNA 1.5 μL 50 - 100 ng / μL Sterile Deionized Water 1.5 μL Total Volume 10 μL

[0063] The PCR amplification program was as follows: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 45 seconds, extension at 72°C for 30 seconds, for 35 cycles; finally, extension at 72°C for 10 minutes. The PCR amplification products could be stored at 4°C.

[0064] The electrophoresis detection conditions for the PCR amplification products were as follows: after adding 2 μL of 6× Loading Buffer to the amplification products, they were detected by 8% non-denaturing polyacrylamide gel electrophoresis. The electrophoresis conditions were a constant voltage of 220 V and an electrophoresis time of 60 minutes. The results of the electrophoresis detection were as Figure 1 shown. It could be seen from Figure 1 that for Thinopyrum intermedium Z1141 and CH52, DNA bands corresponding to the 114 bp position could be amplified, while for common wheat Chinese Spring and Jintai 170, no corresponding bands were observed, indicating that Thinopyrum intermedium Z1141 and CH52 contained chromosome 7J.

[0065] Example 2

[0066] Detection of the molecular marker sacThiC20-32 in the plant material to be tested (nucleotide sequence: TATCACTCGCCCAGGTTAGCGGTGTAGCTTTGGTCTTTTAACATCGAAT GATCGTTCAACAGCTTCCCAAAACATCTTCGCATGATCGCACTGCAAAA GGC, SEQ ID NO:4)

[0067] The primers for detecting the molecular marker sacThiC20-32 were sacThiC20-32-F and sacThiC20-32-R, and their sequences were as follows:

[0068] sacThiC20-32-F: 5'-TATCACTCGCCCAGGTTAGC-3', SEQ ID NO:5;

[0069] sacThiC20-32-R: 5'-GCCTTTTGCAGTGCGATCAT-3', SEQ ID NO:6.

[0070] The detection process was as follows:

[0071] Genomic DNA of the plant to be detected was extracted. Using the extracted genomic DNA as a template and sacThiC20-32-F and sacThiC20-32-R as primers for PCR amplification. After the amplification was completed, the amplification products were separated by electrophoresis. Those that could amplify the corresponding 101 bp DNA band were plant materials containing Thinopyrum intermedium chromosome 7J or chromosome 7J fragments.

[0072] Among them, the PCR reaction system and procedure used are the same as those in Example 1 except for the primers.

[0073] The electrophoresis detection conditions for the PCR amplification products are as follows: After adding 2 μL of 6× Loading Buffer to the amplification products, they are detected by 8% non-denaturing polyacrylamide gel electrophoresis. The electrophoresis conditions are a constant voltage of 220 V and an electrophoresis time of 60 minutes. The results of the electrophoresis detection are as Figure 2 shown. From Figure 2 it can be seen that for Thinopyrum intermedium Z1141 and CH52, DNA bands corresponding to the 101 bp position can be amplified, while for common wheat Chinese Spring and Jintai 170, there are no corresponding bands, indicating that Thinopyrum intermedium Z1141 and CH52 contain chromosome 7J.

[0074] Example 3

[0075] Detection of the molecular marker sacThiC20-64 in the plant material to be tested (nucleotide sequence: GTGTTCTCAAGAGGAGGAGCATATCGTGTACTGCAGAAACCAATTAGC ACATCACAAATATATTTGTGAGCGAGTGAGCACCTAAGTGTATACTCCT CCACCGTTTAGGGTTTAGCCGTGTGCG, SEQ ID NO:7)

[0076] The primers for detecting the molecular marker sacThiC20-64 are sacThiC20-64-F and sacThiC20-64-R, and their sequences are as follows:

[0077] sacThiC20-64-F: 5'-GTGTTCTCAAGAGGAGGAGCAT-3', SEQ ID NO:8;

[0078] sacThiC20-64-R: 5'-CGCACACGGCTAAACCCTA-3', SEQ ID NO:9.

[0079] The detection process is as follows:

[0080] Extract the genomic DNA of the plant to be detected. Using the extracted genomic DNA as a template, perform PCR amplification with sacThiC20-64-F and sacThiC20-64-R as primers. After the amplification is completed, separate the amplification products by electrophoresis. Those that can amplify the corresponding 124 bp DNA band are plant materials containing Thinopyrum intermedium chromosome 7J or chromosome 7J fragments.

[0081] Among them, the PCR reaction system and procedure used are the same as those in Example 1 except for the primers.

[0082] The electrophoresis detection conditions for the PCR amplification products are as follows: After adding 2 μL of 6× Loading Buffer to the amplification products, they are detected by 8% non-denaturing polyacrylamide gel electrophoresis. The electrophoresis conditions are a constant voltage of 220 V and an electrophoresis time of 60 minutes. The results of the electrophoresis detection are as Figure 3 shown. From Figure 3 it can be seen that for Thinopyrum intermedium Z1141 and CH52, DNA bands corresponding to the 124 bp position can be amplified, while for common wheat Chinese Spring and Jintai 170, there are no corresponding bands, indicating that Thinopyrum intermedium Z1141 and CH52 contain chromosome 7J.

[0083] Example 4

[0084] Detection of molecular marker sacThiC20-94 in the plant material to be tested (nucleotide sequence: AAAACAAGGCTTTCGCCCAAAGCCCTGCGCCCGTCCACCTGACCAAGCCCTGGGGAAGGGGCTCTGCCACTGCCAATGGAGAGCGCACTGCAGCCCGCACTGCACCGACAGCGTTAAACCATGGCCACCGGACCGAGAGCCCGCCGATCAAGCCACACATCACCATGA, SEQ ID NO:10)

[0085] The primers for detecting molecular marker sacThiC20-94 are sacThiC20-94-F and sacThiC20-94-R, and their sequences are as follows:

[0086] sacThiC20-94-F: 5'-AAAACAAGGCTTTCGCCC-3', SEQ ID NO:11;

[0087] sacThiC20-94-R: 5'-TCATGGTGATGTGTGGCT-3', SEQ ID NO:12.

[0088] The detection process is as follows:

[0089] Extract the genomic DNA of the plant to be detected. Using the extracted genomic DNA as a template, perform PCR amplification with sacThiC20-94-F and sacThiC20-94-R as primers. After the amplification is completed, separate the amplification products by electrophoresis. Those that can amplify the corresponding 168 bp DNA band are plant materials containing Thinopyrum intermedium chromosome 7J or chromosome 7J fragments.

[0090] Among them, the PCR reaction system and program used are the same as those in Example 1 except for the different primers.

[0091] The electrophoresis detection conditions for the PCR amplification products are as follows: After adding 2 μL of 6× Loading Buffer to the amplification products, they are detected by 8% non-denaturing polyacrylamide gel electrophoresis. The electrophoresis conditions are a constant voltage of 220 V and an electrophoresis time of 60 minutes. The results of the electrophoresis detection are as Figure 4 shown. From Figure 4 it can be seen that the DNA bands corresponding to the 168 bp position can be amplified from Thinopyrum intermedium Z1141 and CH52, while there are no corresponding bands in common wheat Chinese Spring and Jintai 170, indicating that Thinopyrum intermedium Z1141 and CH52 contain the 7J chromosome.

[0092] In this specification, each embodiment is described in a progressive manner. The key point of each embodiment is to illustrate the differences from other embodiments. For the same or similar parts among the embodiments, reference can be made to each other.

[0093] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer pair for rapid detection of the specific molecular marker sacThiC20-4 of chromosome 7J of Thinopyrum intermedium, wherein the nucleotide sequence of the specific molecular marker sacThiC20-4 is: ACCAATATTAGCCGCAGTCTCAAATGAGTCCTGGAGCTATCCAGGT TCTGCAGTTTCCAAGCTGCCATCCATCACAAATGCTCCCCCAGCCG ACACACCATGTCCGCATTG, SEQ ID NO: 1; The nucleotide sequence of the primer pair is: sacThiC20-4-F: 5'-ACCAATATTAGCCGCAGTCTCA-3', SEQ ID NO: 2; sacThiC20-4-R: 5'-CAATGCGGACATGGTGTGTC-3', SEQ ID NO:

3.

2. A primer pair for rapid detection of the specific molecular marker sacThiC20-32 of chromosome 7J of Thinopyrum intermedium, the nucleotide sequence of the specific molecular marker sacThiC20-32 is: TATCACTCGCCCAGGTTAGCGGTGTAGCTTTGGTCTTTAACATCG AATGATCGTTCAACAGCTTCCCAAAACATCTTCGCATGATCGCACTGCA AAAGGC, SEQ ID NO: 4; The nucleotide sequence of the primer pair is: sacThiC20-32-F: 5'-TATCACTCGCCCAGGTTAGC-3', SEQ ID NO: 5; sacThiC20-32-R: 5'-GCCTTTTGCAGTGCGATCAT-3', SEQ ID NO:

6.

3. A primer pair for rapid detection of the specific molecular marker sacThiC20-64 of chromosome 7J of Elymus intermedius, wherein the nucleotide sequence of the specific molecular marker sacThiC20-64 is: GTGTTCTCAAGAGGAGGAGCATATCGTGTACTGCAGAAACCAATT AGCACATCACAAATATATTTGTGAGCGAGTGAGCACCTAAGTGTATAC TCCTCCACCGTTTAGGGTTTAGCCGTGTGCG, SEQ ID NO: 7; The nucleotide sequence of the primer pair is: sacThiC20-64-F: 5'-GTGTTCTCAAGAGGAGGAGCAT-3', SEQ ID NO: 8; sacThiC20-64-R: 5'-CGCACACGGCTAAACCCTA-3', SEQ ID NO:

9.

4. A primer pair for rapid detection of the specific molecular marker sacThiC20-94 of chromosome 7J of Elymus intermedius, wherein the nucleotide sequence of the specific molecular marker sacThiC20-94 is: AAAACAAGGCTTTCGCCCAAAGCCCTGCGCCCGTCCACCTGACCAAGCCCTGGGGAAGGGGCTCTGCCACTGCCAATGGAGAGCGCACTGCAGCCCGCACTGCACCGACAGCGTTAAACCATGGCCACCGGACCGAGAGCCCGCCGATCAAGCCACACATCACCATGA, SEQ ID NO: 10; The nucleotide sequence of the primer pair is: sacThiC20-94-F: 5'-AAAACAAGGCTTTCGCCC-3', SEQ ID NO: 11; sacThiC20-94-R: 5'-TCATGGTGATGTGTGGCT-3', SEQ ID NO:

12.

5. A method for rapidly detecting chromosome 7J of Elytium intermedia in plant materials, characterized in that: The following steps are involved: (1) extracting genomic DNA from the plant to be tested, using the extracted genomic DNA as a template, and performing PCR amplification using the primer pair of the specific molecular marker sacThiC20-4 according to claim 1, the primer pair of the specific molecular marker sacThiC20-32 according to claim 2, the primer pair of the specific molecular marker sacThiC20-64 according to claim 3, or the primer pair of the specific molecular marker sacThiC20-94 according to claim 4; (2) separating the amplified products by electrophoresis; if the target band of the specific molecular marker sacThiC20-4, the specific molecular marker sacThiC20-32, the specific molecular marker sacThiC20-64 or the specific molecular marker sacThiC20-94 is amplified, it indicates that the plant to be tested contains the Elytium intermedia 7J chromosome.

6. The method according to claim 5, characterized in that The PCR reaction system was: 5 μL of 2×Taq PCR Mix premix, 1 μL of 50 ng / μL primer-F, 1 μL of 50 ng / μL primer-R, 1.5 μL of 50-100 ng / μL template DNA, 1.5 μL sterile deionized water, and the total volume of the reaction system was 10 μL.

7. The method according to claim 5, characterized in that The PCR amplification program was as follows: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 45 seconds, and extension at 72°C for 30 seconds for 35 cycles; and finally extension at 72°C for 10 minutes.

8. Use of the primer pair of specific molecular markers according to claim 1 or claim 2 or claim 3 or claim 4 in detecting chromosome 7J of Thinopyrum intermedium.

Images