Molecular marker for identifying citrus reticulata blanco and application of molecular marker

Abstract

The invention discloses a molecular marker for identifying Citrus reticulata 'Jianlan', and belongs to the field of molecular biology, and the sequences of an amplification primer pair of the molecular marker are shown as SEQ ID NO: 1 and SEQ ID NO: 2. Jian mandarin is an endemic broad-peel citrus variety and is expected to be processed into Jian mandarin orange peel comparable with citrus chachiensis hortorum, the method is based on plant re-sequencing and bioinformatics analysis, specific primers are used for amplifying corresponding molecular markers in sample DNA, a PCR product is subjected to agarose gel electrophoresis, and the sample is judged to be Jian mandarin according to an electrophoretic band. The invention provides a rapid and accurate citrus building germplasm identification means, and provides important technical support for citrus variety improvement and genetic research.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and relates to a molecular marker for identifying Jiangan oranges, and the present invention also relates to a method for identifying Jiangan oranges using molecular markers. Background Art

[0002] Jiangan oranges ( Citrus reticulata ‘Jiangan’) are local mandarin orange varieties in Yichang, Hubei. They have characteristics such as strong adaptability and good high-yielding properties, and are often used as rootstocks for mandarin orange plants. [1] . Guangdong tangerine peel is made from the dried peels of Chachiensis oranges ( Citrus reticulata ‘Chachiensis’), a local specialty citrus variety in Guangdong. It is highly regarded for its rich nutritional value and unique functional properties. In addition to Guangdong tangerine peel, other tangerine peels such as Sichuan tangerine peel and Zhejiang tangerine peel also have good edible and medicinal qualities, and the tangerine peel industry has broad prospects for diversified development. Jiangan-origin tangerine peel is a local specialty product made from the peels of Jiangan oranges in the Yichang area through processes such as sun-drying and aging.

[0003] Currently, due to the low efficiency, long time consumption, and high cost of traditional identification methods, Jiangan-origin tangerine peel faces problems such as difficulty in tracing raw materials during the industrialization process, restricting its industrial development. Molecular marker technologies such as restriction fragment length polymorphism (RFLP), simple sequence repeat (SSR), and random amplified polymorphic DNA (RAPD) can quickly and accurately identify different citrus germplasms by analyzing specific fragments of genomic sequences, and are widely used in work such as evaluating the genetic diversity of citrus germplasm resources [2,3,4] , providing a solution idea for the efficient identification of Jiangan orange germplasm. However, there is currently no relevant report on molecular markers for distinguishing Jiangan oranges from other mandarin oranges such as Chachiensis oranges. Therefore, developing an efficient and accurate molecular marker technology for Jiangan oranges is of great significance for promoting the healthy, standardized, and sustainable development of the Jiangan-origin tangerine peel industry. Summary of the Invention

[0004] The present invention aims to establish a molecular marker technology for Jiangan oranges. This technology integrates plant resequencing technology, bioinformatics analysis methods, and polymerase chain reaction (PCR) verification means to achieve the distinction between Jiangan oranges and other mandarin oranges. This technology will provide important technical support for Jiangan orange genetic breeding, germplasm resource management, and industrial development.

[0005] To achieve the above objective, the applicant designed specific high-quality primer pairs based on the genomic resequencing data of Jiangan oranges and screened the effectiveness of InDel marker primer pairs. Finally, a pair of InDel primers that can distinguish Jiangan oranges from other mandarin oranges was screened out, and their nucleotide sequences are respectively: JG-F: 5'-GCTAACTTAATTAGATTTCCAACGGT-3' (SEQ ID NO: 1); JG-R: 5'-GGGCTTGGAGATAAGACAAGG-3' (SEQ ID NO: 2).

[0006] It was found that compared with Citrus reticulata Blanco cv. Chachiensis, the original plant of Guangchenpi, the total volatile content, total flavonoid content, hesperidin and nobiletin content in the pericarp of Jiangan were all higher than those of Citrus reticulata Blanco cv. Chachiensis. Therefore, Jiangan is expected to become a high-value candidate raw material for Chenpi comparable to Guangchenpi. The molecular markers developed in the present invention are expected to achieve rapid identification of Jiangan germplasm resources and parental screening in citrus genetic breeding; traceability and quality control of Chenpi raw materials; and analysis of genetic diversity of ponkan oranges.

[0007] The present invention further provides a method for identifying Jiangan, comprising the following steps: (1) Extracting DNA of the sample to be tested; (2) Using the extracted DNA as a template, performing PCR amplification with the primer pair JG-F / JG-R described above, (3) Performing agarose gel electrophoresis on the PCR product and judging the result according to the specific bands.

[0008] Among them, the reaction system for the PCR amplification is: 5 μL of 2×Phanta Max Buffer, 0.2 μL of dNTPMix, 0.2 μL of Phanta Max Super-Fidelity DNA Polymerase, 0.4 μL of forward primer, 0.4 μL of reverse primer, 1 μL of DNA template, 2.8 μL of ddH 2 O.

[0009] Among them, the reaction program for the PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 56°C for 30 s, extension at 72°C for 3 min, for a total of 35 cycles; final extension at 72°C for 10 min.

[0010] Among them, the criterion for result judgment is: if the electrophoresis result shows two bands of about 750 bp and 200 bp, the sample is Jiangan.

[0011] The present invention also provides a molecular marker kit for identifying Jiangan, comprising the primer pair JG-F / JG-R described above.

[0012] Furthermore, the molecular marker kit further comprises a PCR reaction buffer, dNTP Mix and DNA polymerase.

[0013] The beneficial effects of the present invention are as follows: The molecular marker PCR method established by the present invention can specifically distinguish Jiangan from other common citrus fruits. The product bands are clear, and the results are accurate and reliable. Therefore, it provides a solution for the efficient identification of Jiangan, a high-quality citrus germplasm resource, which will greatly promote the development of the citrus industry. At the same time, it provides important technical support for citrus variety improvement and genetic research. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 : Gel electrophoresis map of molecular markers of different common citrus fruits. Note: M: Marker; NC: Negative control; The sample numbers and germplasm information are shown in Table 1. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0015] The technical solutions of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention and not to limit the protection scope of the present invention. Those skilled in the art making various modifications or equivalent replacements based on the following embodiments should also be regarded as falling within the protection scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually carried out according to conventional conditions or reference books such as "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor Laboratory, 2017), or according to the methods recommended in the operation manuals provided by the manufacturers. The materials without indicated sources in the embodiments are all commonly used materials in the art and can be obtained through commercial channels.

[0016] Embodiment 1. Materials and Methods 1.1 Reagents and Materials The high-fidelity enzyme (Phanta Max Super-Fidelity DNA Polymerase) and PCR reagents were purchased from Vazyme Biotech Co., Ltd. The PCR primers were synthesized by Tsingke Biotechnology Co., Ltd.

[0017] The information of 50 common citrus fruit samples is shown in Table 1, and they were all collected from the National Citrus Germplasm Repository of the Citrus Research Institute, Chinese Academy of Agricultural Sciences, Beibei District, Chongqing.

[0018] Table 1. Information of 50 common citrus fruit samples

[0019] 1.2 Experimental Methods 1.2.1 InDel Primer Design and Screening Based on the genome re-sequencing data of Jiangan oranges, specific high-quality primer pairs were designed. Sites with large fragment insertions / deletions (InDels) of more than 50 bp were selected, and primer pairs were designed at 200 bp upstream and downstream of the insertion / deletion sites using SnpGene 4.1.9 software. Then, the effectiveness of the InDel marker primer pairs was screened. Finally, a pair of InDel primers JG-F / R that can distinguish Jiangan oranges from other mandarin oranges was screened out, and their nucleotide sequences are as follows: JG-F: GCTAACTTAATTAGATTTCCAACGGT 5'-3' JG-R: GGGCTTGGAGATAAGACAAGG 5'-3' Using JG-F / R as primers and Jiangan orange DNA as a template, two sequences can be amplified, namely SEQ ID NO: 3 (820 bp) and SEQ ID NO: 4 (167 bp).

[0020] SEQ ID NO: 3 TTTTATTCCGAATTTGACCTTTCTGCATTTGATACAAATTGTGTATTTGGCTGCCCAATGACTTGAATAATGCCCACAATGCCTTGTCTTATCTCCAAGCCCAATTCATGATGTCTTGCATCTTGAATTGCATTTTCAATCCATATTTTCTCAATTAATCCATTTAAAGCAGCTTGCATCTTTTTGGCTCTTGCTCTTGTAATTGGGCCTCCATGAATGTGCAAAGGATCACTTGAAGTTTTAATGGTCCCTTGATGGTTCTCATCACGCCACAAGAATGCAAATTCTTGATAAGTTCACTAGTTCTCAAAAGAACCAAAGAAAGAATAATCTTTCAAATTCAAATAACATTAATCTCTTAATTATCATACATAGCAAGGTTGCTGAGTTTAAATAGGCTAAAAGAAACCCAAGATCCTAAAAATACAAATGGAAACATTGGAACAACCCTCCAAGTATAGGTTTGTCAAAGGGTGCTTTAAAAGCCTTCCCCAACCCACTATTATTAATGATAGACTTACCTAACACATTGATAAACTTGACGAAAACAAATAAATGAAGTTGAATAATCAAAGGAGTCGATTGAATTCCCAAGCCTGAACAAGCTGTAATAAATTGATCATAACTCCTTCTAGAGAACTCCAAATCCAACTCTGTAAAATGCATTGGAAAGCTAACTTAATTAGATTTCCAACGGTATATAGCTTGCACATTAATTCTGGCTCAATCAATACAGTTTTTATTCCGAATTTGACCTTTCTGCATTTGATACAAATTGTGTATTTGGCTGCCCAATAACTTGAATAATGCCCACAATGCC SEQ ID NO: 4 GCTAACTTAATTAGATTTCCAACGGTATATAGCTTGCACATTAATTCTGGCTCAATCAATACAGTTTTTATTCCGAATTTGACCTTTCTGCATTTGATACAAATTGTGTATTCGGTTGCCCAATAACTTGAATAATGCCCACAATGCCTTGTCTTATCTCCAAGCCC 1.2.2 PCR Amplification and Gel Electrophoresis Analysis Method The 10 μL PCR amplification system is as follows: 5 μL 2×Phanta Max Buffer, 0.2 μL dNTP Mix, 0.2 μL Phanta Max Super-Fidelity DNA Polymerase, 0.4 μL forward primer, 0.4 μL reverse primer, 1 μL DNA template, 2.8 μL ddH 2 O. The reaction program is: pre-denaturation at 95°C for 5 min; then denaturation at 95°C for 15 s, annealing at 56°C for 30 s, extension at 72°C for 3 min, for 35 cycles; finally extension at 72°C for 10 min. After amplification, the PCR product is stored at 4°C for later use.

[0021] The PCR product is subjected to gel electrophoresis using a DYY-6C gel electrophoresis apparatus. The voltage is set at 80 V, the current is set at 200 mA, and the electrophoresis time is 25 min. The electrophoresis picture is saved.

[0022] 1.2.3 Determination Method of Volatile Substances For the collected pericarp of immature fruits of jiankan and chazhigan, refer to Liu Yuan et al. [5]The described method was used to extract and detect volatile substances. The volatile substance extract was centrifuged at 4 °C and 12,000 rpm for 10 min. After centrifugation, it was filtered through a 0.22 μm filter membrane into a sample vial for detection. A gas chromatography-mass spectrometry (GC-MS) instrument (TRACE GC Ultra combined with DSQII mass spectrometer, Thermo Fisher, USA) was used to determine the volatile substances. The sample was injected into the GC-MS in split mode (20:1) at 250 °C, and the carrier gas helium (>99.99% purity) flow rate was set at 1 mL / min, and passed through a TRACE TR-5 (30 m × 0.25 mm, 0.25 μm) chromatographic column. The GC-MS instrument program temperature was as follows: maintained at 40 °C for 3 min; heated to 160 °C at a rate of 2 °C / min; then heated to 200 °C at a rate of 5 °C and maintained for 3 min; finally heated to 240 °C at a rate of 8 °C / min and maintained for 3 min. The transfer line temperature was set at 280 °C, and the ion source temperature was set at 260 °C. The mass range for analysis was 45 - 400 m / z.

[0023] The GC-MS raw data was processed and exported using Xcalibur 2.2 software. The volatile substances were qualitatively analyzed based on standard samples, the NIST / EPA / NIH Mass Spectral Database (NIST 2008), and the Wiley Registry Mass Spectral Database. Standard curves were prepared in the SIM mode based on standard samples. For each standard, six concentrations were diluted and the peak areas were measured. After calibration with methyl nonanoate as the internal standard, the standard curves of the standards were plotted (Table 2). Among all the identified volatile substances, the volatile substances with standards were quantified based on the standard curves in the SIM mode, and other volatile substances were relatively quantified based on the internal standard.

[0024] The formula for calculating the relative content of substances is: Relative content of substances (μg / g) =

[0025] where S 物质 is the peak area of the target substance; S 内标 is the peak area of the internal standard substance methyl nonanoate.

[0026] Table 2 Ten standard samples and standard curves for GC-MS analysis

[0027] 1.2.4 Determination method of flavonoids The extraction and detection of flavonoids refer to Chen Jiajing [6]Method. The peels of Jiangan and Chazhigan 60 days after flowering were ground into powder in liquid nitrogen respectively. After freeze-drying with a low-temperature freeze-drying instrument, 0.1 g of the freeze-dried powder of the sample was placed in a 10 mL centrifuge tube, 5 mL of 80% methanol was added, and ultrasonic extraction was carried out at 40 °C for 60 min. Then, centrifugation was carried out at 25 °C and 12,000 r / min for 10 min, and 1 mL of the supernatant was taken and filtered through a 0.22 μm microporous filter membrane. The sample was detected by high performance liquid chromatography (HPLC). The chromatographic column of the instrument was C 18 Hypersil GOLD (250×4.6 mm, 5 μm, Thermo Scientific, USA), mobile phase: A, 0.15% formic acid aqueous solution; B, acetonitrile containing 0.15% formic acid. The elution gradient was 10% B at 0 min, 15% B at 10 min, 17% B at 20 min, 20% B at 30 min, 25% B at 40 min, 30% B at 45 min, 35% B at 55 min, 45% B at 60 min, flow rate: 1 mL / min, column temperature 35 °C. The ultraviolet detection range was 210 nm - 400 nm.

[0028] 2. Results and Analysis 2.1 Comparison of the Contents of Volatile Substances and Flavonoids in the Peels of Jiangan and Chazhigan 60 days after Flowering As shown in Table 3, 40 and 33 volatile substances were detected in the peels of Jiangan and Chazhigan at the young fruit stage respectively. The content of volatile substances is an important index to measure the quality of Chenpi. The total content of volatile substances in Jiangan was 42693.69±4131.77 μg / g, and that in Chazhigan was 16524.84±750.86 μg / g. The total content of volatile substances in Jiangan was about 2.6 times that in Chazhigan ( P <0.05).

[0029] Table 3. Volatile Substances in the Fresh Peels of Jiangan and Chazhigan 60 days after Flowering

[0030] As shown in Table 4, 12 and 13 flavonoid substances were detected in the peels of Jiangan and Chazhigan at the young fruit stage respectively. Flavonoid substances have a variety of biological activities. The Chinese Pharmacopoeia (2020) clearly stipulates the relevant flavonoid content requirements that Chenpi should possess. For example, hesperidin should not be less than 20 mg / g. The total content of flavonoids in Jiangan was 81.89±6.48 mg / g, and that in Chazhigan was 36.59±0.61 mg / g. The total content of flavonoids, hesperidin and neohesperidin in Jiangan were about 2.2, 1.55 and 7.3 times that in Chazhigan respectively ( P <0.05).

[0031] Table 4. Flavonoids in the dried pericarp samples of Jiangan and Chazhigan 60 days after flowering

[0032] In summary, compared with Chazhigan, the original plant of Guangchenpi, the contents of limonene, hesperidin, nobiletin, etc. in the pericarp of Jiangan, which determine the fragrance quality and health quality, are all higher than those of Chazhigan. It is expected to become a candidate raw material for high-value Chenpi comparable to Guangchenpi. d-

[0033] 2.2 Amplification of InDel molecular markers in different mandarins DNA was extracted from the above 50 mandarin materials, and amplified using the molecular marker primers JG-F / R respectively, and then agarose gel electrophoresis was performed. The results are as Figure 1 shown. No bands were observed in the negative control. Using Jiangan DNA as a template, a band of about 750 bp and a band of about 200 bp could be amplified, while most other mandarin germplasms could only amplify a band of 200 bp, and a few could obtain multiple bands. For example, the 15th germplasm, Ota ponkan, only had 1 band at 200 bp, and the 25th germplasm, Chazhigan, could obtain 3 bands. This indicates that this molecular marker can effectively distinguish Jiangan from other mandarins.

[0034] References: [1] Deng Xiuxin. Chinese Citrus Varieties, Second Edition. China Agricultural Press, 2023. [2] Xi Xiuli, Huang Haibo, Lou Buqing, et al. Genetic polymorphism analysis of Chazhigan and its related species by SCoT molecular markers [J]. Chinese Traditional and Herbal Drugs, 2018, (10): 2426-2431. [3] Li Yingzhi. Genetic Diversity and Phylogenetic Study of Mandarin ( Citrus reticulata Blanco) [D]. Huazhong Agricultural University, 2006. [4] Xi Xiuli. Molecular Identification Study of Chazhigan and Its Related Species [D]. Guangzhou University of Chinese Medicine, 2017. [5] Liu Yuan, Xiang Simin, Wang Jiangbo, et al. GC-MS analysis of volatile substances and primary metabolites in Korla fragrant pears [J]. Journal of Huazhong Agricultural University, 2020, 39(01): 44-52. ​[6] Chen J, Zhang H, Pang Y, et al. Comparative study of flavonoidproduction in lycopene-accumulated and blonde-flesh sweet oranges ( Citrus sinensis ) during fruit development. Food Chem. 2015 Oct 1;184:238-46.

Claims

1. A molecular marker for identifying Citrus reticulata'Jiangan', characterized in that: The amplification primer pair of the molecular marker is: JG-F: 5'-GCTAACTTAATTAGATTTCCAACGGT-3'; JG-R: 5'-GGGCTTGGAGATAAGACAAGG-3'.

2. A method for identifying Jiangan, characterized in that: The following steps are involved: (1) Extract DNA from the sample to be tested; (2) using the extracted DNA as a template, and performing PCR amplification on JG-F / JG-R using the primers described in claim 1, (3) Perform agarose gel electrophoresis on the PCR products and determine the results based on specific bands.

3. The method for identifying Citrus aurantium as claimed in claim 2, characterized in that: The reaction system of the PCR amplification is: 5 μL 2×Phanta Max Buffer, 0.2 μL dNTP Mix, 0.2 μL Phanta Max Super-Fidelity DNA Polymerase, 0.4 μL forward primer, 0.4 μL reverse primer, 1 μL DNA template, and 2.8 μL ddH2O.

4. The method for identifying Citrus aurantium as claimed in claim 2, characterized in that: The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 56°C for 30 s, extension at 72°C for 3 min, for a total of 35 cycles; and final extension at 72°C for 10 min.

5. The method for identifying Citrus aurantium as claimed in claim 2, characterized in that: The standard for determining the result is: if the electrophoresis result shows two bands of 750 bp and 200 bp, the sample is Jian Gan.

6. Application of the molecular marker according to claim 1 in any of the following fields: (1) Rapid identification of Jiangan germplasm resources; (2) Parent selection in citrus genetic breeding; (3) Traceability and quality control of tangerine peel raw materials; (4) Analysis of genetic diversity of broad-skinned citrus.

7. A molecular marker kit for identifying Citrus aurantium, comprising the primer pair JG-F / JG-R described in claim 1.

8. The molecular labeling kit as claimed in claim 7, further comprising a PCR reaction buffer, a dNTP Mix and a DNA polymerase.

Images