Method for detecting lentivirus

Abstract

The invention relates to a method for detecting lentivirus. The present disclosure is based on methods of detecting and quantifying lentiviral (human immunodeficiency virus, HIV-1 or HIV-2) DNA and RNA in a biological sample.

Description

[0001] This application is a divisional application of the application with the filing date of September 7, 2017, application number 201780068868.7, and invention title "Method for Detecting Lentivirus".

[0002] Related application data

[0003] This application claims the priority of Australian Patent Application No. 2016903599, titled "Method for Detecting Lentivirus", filed on September 7, 2016. The entire content of this patent application is hereby incorporated by reference.

[0004] Sequence listing

[0005] This application is filed together with a sequence listing in electronic format. The entire content of the sequence listing is hereby incorporated by reference.

[0006] Field of disclosure

[0007] This disclosure is based on methods for detecting and quantifying lentivirus (human immunodeficiency virus, HIV-1 or HIV-2) DNA and RNA in biological samples. Background

[0009] Human immunodeficiency virus (HIV) is a lentivirus that causes HIV infection and is the pathogen of acquired immunodeficiency syndrome (AIDS) over time. HIV belongs to the family of retroviruses, and two types of HIV have been characterized: HIV-1 and HIV-2. HIV-1 is more virulent and thus more infectious, and is the cause of most infections globally.

[0010] HIV is transmitted as a single-stranded, positive-sense, enveloped RNA virus (ssRNA). The main targets of HIV are CD4 + T cells, macrophages, and dendritic cells. HIV virions adsorb to receptors on target cells through glycoproteins on their surface, then the viral envelope fuses with the cell membrane, and the HIV capsid is released into the cell, thus entering the target cell. Once inside the target cell, the nucleocapsid containing the viral genome dissociates, releasing the contents of the virus, including ssRNA, into the cytoplasm. The viral RNA genome is reverse transcribed into double-stranded DNA by the virus-encoded reverse transcriptase (RT). Then, the resulting viral DNA is imported into the nucleus and integrated into the cellular DNA by the virus-encoded integrase.

[0011] The integrated HIV DNA is flanked by identical 5’ and 3’ long terminal repeat (LTR) sequences from which HIV can initiate transcription of the integrated HIV genome. The integrated viral DNA may be dormant, in the latent stage of HIV infection or the viral DNA may be transcribed to produce new RNA genomes and viral proteins which are packaged and released from the cell as new virus particles.

[0012] The primary test for detecting HIV is the enzyme-linked immunosorbent assay (ELISA) for detecting HIV-1 antibodies. If a positive test result is received, a Western blot test is usually performed to confirm the diagnosis.

[0013] Treatment of HIV infection involves combination antiretroviral therapy (cART) which acts to inhibit HIV replication. The main goal of cART is to suppress plasma viral load to an undetectable level (<50 copies per milliliter) while maintaining immune system function and preventing opportunistic infections. Plasma viral load (pVL) monitoring is currently the most important predictor of response to cART treatment. Levels above 200 copies per milliliter are considered virologically failed. Although cART reduces the level of infection, residual virus forms a viral reservoir which resides in long-lived resting T cells and tissue-based macrophages. In the vast majority of patients, after ART cessation, pVL levels typically rebound rapidly within a few weeks. There is currently no reliable assay to monitor and evaluate treatment outcomes for ART in patients with HIV infection. Although pVL and CD4 + cell counts still play an important role in patient care, these markers are not sensitive enough to monitor activated HIV infection.

[0014] Accordingly, there is a need in the art to develop more sensitive assays that can detect and quantify HIV DNA and RNA, particularly HIV transcription in latent infection reservoirs, to guide improvements in antiretroviral therapy.

[0015] Disclosure Overview

[0016] The present disclosure is based on methods for detecting and quantifying lentiviral (human immunodeficiency virus, HIV-1 or HIV-2) DNA and RNA in biological samples. In particular, the present disclosure is based on the discovery that when both HIV DNA and HIV RNA are detected, a more sensitive detection of lentiviral infection in HIV-infected subjects is obtained. The inventors have developed PCR-based assays that provide a more sensitive detection of HIV-1 or HIV-2 DNA and RNA compared to prior art methods. In addition, the inventors have developed a PCR-based method for detecting and quantifying HIV DNA and RNA where existing assays cannot detect HIV DNA or RNA.

[0017] Current methods for detecting and quantifying HIV in diagnostic laboratories rely on detecting the HIV plasma viral load (VL) (the number of HIV RNA copies in plasma). This assay can quantify the number of HIV RNA copies in a patient's plasma to evaluate the efficacy of antiretroviral therapy (ART) in treating infected patients. This classical marker of pVL still plays an important role, but this assay is not sensitive enough to adequately identify patients receiving optimal antiretroviral therapy (ART), and patients are thus prone to relapse.

[0018] The present disclosure advantageously provides highly specific and sensitive methods based on the amplification of the R region within the long terminal repeat (LTR) of the lentiviral genome (e.g., the HIV genome). The 5’ LTR and 3’ LTR regions consist of three sub-regions, namely U3, R, and U5, and both 5’ LTR and 3’ LTR are present when the virus integrates into the host cell genome. In particular, the inventors have found that compared to R region detection, prior art strategies focusing on targeting 3’ LTR, pol, or gag are less sensitive because 3’ LTR, pol, or gag exist only as single copies in the viral genome, while the R region exists as two copies in both the transcribed viral mRNA and the viral HIV DNA integrated in the human genome. Thus, the methods of the present disclosure are based on the detection of the R region within both RNA and DNA of HIV-1 or HIV-2 in subjects with or suspected of having HIV infection. Thus, this method provides clinicians with knowledge of the HIV DNA level in the subject as well as the HIV transcription level (RNA) in latently infected reservoir cells (usually CD4 + T cells and monocytes / macrophages) in the subject to more accurately guide the appropriate treatment of antiretroviral therapy.

[0019] The present disclosure provides a method for detecting human immunodeficiency virus (HIV) in a subject having HIV or suspected of having an HIV infection (acquired immunodeficiency syndrome, AIDS), the method comprising PCR amplification of R region nucleic acid in a biological sample obtained from the subject, wherein the amplification comprises a forward primer and a reverse primer that hybridize to a sequence within the R region of the long terminal repeat (LTR) of HIV, and subsequent detection of any amplification, wherein detection of amplification indicates the presence of HIV in the subject.

[0020] Preferably, detection of the amplification is performed with a labeled oligonucleotide probe that hybridizes to a sequence within the amplified R region sequence.

[0021] In one instance, the nucleic acid is DNA or reverse transcribed RNA.

[0022] In one instance, the HIV is HIV-1 or HIV-2.

[0023] In one instance, the PCR amplification is real-time PCR or endpoint PCR. In another instance, the PCR amplification is real-time quantitative PCR.

[0024] In one instance, the detection method further comprises a labeled oligonucleotide probe. In another instance, the oligonucleotide probe binds to a sequence within the R region of the long terminal repeat (LTR) of HIV. In another instance, the oligonucleotide probe is a hydrolysis probe. In another instance, the probe is a probe. In another instance, the oligonucleotide probe is a fluorescently labeled hybridization probe. In certain instances, the probe may comprise one or more locked nucleic acids.

[0025] In one instance, the method further comprises:

[0026] (i) obtaining an aliquot of a sample in which DNA (or reverse transcribed RNA) has been extracted;

[0027] (ii) contacting the aliquot with a labeled hydrolysis oligonucleotide probe that hybridizes to the R region sequence of the long terminal repeat (LTR) of HIV DNA;

[0028] (iii) contacting the aliquot with a forward primer and a reverse primer that hybridize to a sequence within the R region sequence;

[0029] (iv) amplifying the R region sequence by PCR.

[0030] The present disclosure also provides a method for quantifying the copy number of HIV DNA in a biological sample from a subject with HIV or a subject suspected of having an HIV infection, the method comprising:

[0031] (i) amplifying and detecting the HIV-R region sequence as described herein; and

[0032] (ii) quantifying the amplified HIV-R region sequence by reference to a corresponding HIV plasmid standard to obtain the copy number of the HIV-R region of HIV DNA per volume of the sample.

[0033] In one example, the amplification is real-time PCR. In another example, the amplification is endpoint PCR.

[0034] In one example, the method further comprises normalizing the HIV DNA copy number against a DNA standard to obtain the copy number of HIV DNA per one or more cells in the biological sample.

[0035] The present disclosure also provides a method for quantifying the copy number of HIV DNA in a biological sample from a subject with HIV or a subject suspected of having an HIV infection by normalizing against a standard, the method comprising:

[0036] (i) amplifying and detecting the HIV-R region sequence as described herein;

[0037] (ii) quantifying the copy number of the HIV-R region of DNA per volume of the sample by quantitative PCR by reference to a corresponding HIV standard;

[0038] (iii) quantifying an endogenous housekeeping gene by quantitative PCR using a corresponding housekeeping standard to obtain the copy number of the endogenous gene, which is expressed as the copy number of the housekeeping gene per volume of DNA present in the sample;

[0039] (iv) dividing the copy number obtained by the copy number of the endogenous gene in the cell to obtain the number of cells per volume of DNA in the sample; and

[0040] (v) calculating the copy number of the HIV-R region DNA per cell by dividing the value obtained in (ii) by the value obtained in (iv) to normalize the HIV DNA copy number to obtain the copy number of the HIV-R region DNA in the biological sample (copy number / cell).

[0041] In one example, the DNA standard is actin.

[0042] In one example, the quantitative PCR is real-time PCR.

[0043] In another instance, the HIV DNA copy number is expressed as the HIV R region copy number / 10 6 cells.

[0044] Alternatively, quantification of the HIV DNA copy number in a sample can be obtained by measuring the absorbance of DNA in the sample.

[0045] The present disclosure also provides a method for quantifying the HIV DNA copy number in a biological sample from a subject with HIV or a subject suspected of having an HIV infection, the method comprising:

[0046] (i) amplifying and detecting the HIV-R region sequence as described herein;

[0047] (ii) quantifying the mass of DNA per volume (w / v) in the sample by measuring the absorbance of DNA in the sample;

[0048] (iii) calculating the number of cells per volume of DNA in the sample based on the DNA absorbance; and

[0049] (iv) calculating the HIV-R region DNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iii) to normalize the HIV DNA copy number to obtain the HIV-R region DNA copy number (copy number / cell) in the biological sample.

[0050] In one instance, the method for quantifying the mass of DNA per volume in a sample optionally includes adding a DNA intercalating dye and measuring the fluorescence emitted by the dye. In one instance, the DNA intercalating dye is selected from SyBr Green I, Syto-9, Syto-10-14, Syto-16, Syto-21, Syto-24, Syto-29, YoYo-1, YoYo-3, and ToTo-1.

[0051] In another instance, the HIV DNA copy number is expressed as the HIV R region copy number / 10 6 cells.

[0052] In one instance, the method as described herein may further include

[0053] (i) obtaining an aliquot in which the DNA sample has been extracted;

[0054] (ii) contacting the aliquot with a labeled hydrolyzable oligonucleotide probe that hybridizes to the R region sequence of the long terminal repeat (LTR) of HIV DNA;

[0055] (iii) Contact the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region sequence;

[0056] (iv) Amplify the R region sequence by PCR;

[0057] (v) Extrapolate the signal obtained from the labeled oligonucleotide to a standard curve obtained from the corresponding amplification of a serial dilution of an HIV standard to obtain the number of HIV-R region DNA copies per volume of DNA in the aliquot.

[0058] In one example, the PCR is real-time PCR or endpoint PCR.

[0059] In one example, the oligonucleotide is a hydrolyzable oligonucleotide probe (e.g., probe). In one example, the oligonucleotide is a fluorescently labeled hybridization probe.

[0060] In one example, the forward primer and the reverse primer bind to R region sequences upstream and downstream of the R region sequence to which the oligonucleotide binds, respectively.

[0061] In certain examples, the PCR amplification is carried out by endpoint PCR. In one example, the forward primer or the reverse primer is labeled. In one example, the forward primer or the reverse primer is labeled (e.g., with biotin). In one example, the oligonucleotide probe is labeled with digoxin (Dig).

[0062] In one example, the forward primer comprises or consists of a sequence according to: SEQ ID NO:29, SEQ ID NO:33, or SEQ ID NO:35.

[0063] In one example, the reverse primer comprises or consists of a sequence according to: SEQ ID NO:30, SEQ ID NO:34, or SEQ ID NO:36.

[0064] In one example, the labeled probe comprises or consists of a sequence according to: SEQ ID NO:4, SEQ ID NO:12, SEQ ID NO:37, SEQ ID NO:41, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, or SEQ ID NO:51.

[0065] The method for quantifying DNA described herein can be used to monitor antiretroviral therapy (ART) being administered to an HIV-positive subject. Accordingly, the present disclosure also provides a method for monitoring antiretroviral therapy (ART) being administered to an HIV-positive subject, the method comprising quantifying the HIV DNA copy number as described herein at at least two time points and comparing the difference in the HIV DNA copy number between the at least two time points, wherein a decrease in the HIV DNA copy number indicates that the subject is receiving optimal / effective ART.

[0066] Biological samples can be obtained at multiple time points in the life of a subject, including but not limited to three, four, five, six, eight, ten, twelve, fifteen, twenty, twenty-five, thirty, thirty-five, forty, etc. In another instance, the time period between at least two time points is days, weeks or months. In another instance, the time period between at least two time points is 1 week, 2 weeks, 1 month, 3 months, 4 months, 6 months, 8 months or 12 months.

[0067] In another instance, a decrease of at least 50%, at least 45%, at least 40%, at least 35%, at least 30%, at least 25%, at least 20%, at least 15%, at least 12%, at least 10%, at least 8% or at least 5% between time points indicates that the subject is receiving optimal / effective ART.

[0068] In another instance, about 800 or fewer HIV DNA copies per 10 6 cells indicates that the subject is receiving optimal / effective ART. In another instance, an HIV DNA copy number of about 80 or fewer, or about 8 or fewer copies of HIV R region DNA per 10 6 cells in a biological sample indicates that the subject is receiving optimal / effective ART.

[0069] In another instance, the method includes adjusting the dose or type of ART being administered to the subject. For example, adjusting the type of ART may include replacing one antiretroviral drug with another in combination therapy, or replacing combination therapy with another combination therapy.

[0070] The present disclosure also provides a method for quantifying the HIV RNA copy number in a biological sample from a subject having HIV or suspected of having an HIV infection, the method comprising:

[0071] (i) amplifying and detecting an HIV-R region sequence on a reverse-transcribed HIV RNA R region sequence as described herein; and

[0072] (ii) Quantifying the amplified HIV-R region sequence by reference to the corresponding HIV plasmid standard to obtain the copy number of HIV RNA per volume of sample.

[0073] In one instance, the amplification is real-time PCR or endpoint PCR.

[0074] In one instance, the method further includes normalizing the HIV RNA copy number against an RNA standard to obtain the copy number of HIV RNA per one or more cells in the biological sample.

[0075] The present disclosure also provides a method for quantifying the copy number (i.e., transcriptional activity) of HIV RNA in a biological sample from a subject with HIV or a subject suspected of having an HIV infection by normalizing against a standard, the method comprising:

[0076] (i) Amplifying and detecting the HIV-R region sequence on the reverse-transcribed HIV RNA R region sequence as described herein;

[0077] (ii) Quantifying the copy number of the HIV-R region per volume of RNA in the sample by quantitative PCR by reference to the corresponding HIV standard;

[0078] (iii) Quantifying an endogenous housekeeping gene by quantitative PCR using the corresponding housekeeping standard to obtain the copy number of the endogenous gene, which is expressed as the copy number of the housekeeping gene per volume of RNA present in the sample;

[0079] (iv) Dividing the obtained copy number by the copy number of the endogenous gene in the cell to obtain the number of cells per volume of RNA in the sample; and

[0080] (v) Calculating the copy number of HIV-R region RNA per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV RNA copy number to obtain the copy number of HIV-R region RNA (copy number / cell) in the biological sample.

[0081] In one instance, the RNA standard is GAPDH.

[0082] In one instance, the method further includes obtaining a biological sample from the subject and preparing RNA from the sample.

[0083] In one instance, the HIV RNA copy number is expressed as HIV R region copy number / 10 6 cells.

[0084] In another example, the housekeeping standard is amplified by real-time PCR. In another example, the housekeeping standard is the same as the endogenous gene. Methods for generating a standard curve based on serial dilutions of the amplified standard are known to those skilled in the art. For example, the housekeeping standard is serially diluted to provide 1, 20, 200, 2000, 20,000, 2x10 5 and 2x10 6 copies / μl.

[0085] Alternatively, methods for quantifying RNA in a sample are based on measuring the absorbance of the RNA in the sample.

[0086] The present disclosure also provides a method for quantifying the number of HIV RNA copies in a biological sample from a subject with HIV or a subject suspected of having an HIV infection, the method comprising:

[0087] (i) amplifying and detecting the HIV-R region sequence on the reverse transcribed HIV RNA R region sequence as described herein;

[0088] (ii) quantifying the mass of RNA per volume (w / v) in the sample by measuring the absorbance of the RNA in the sample;

[0089] (iii) calculating the number of cells per volume of RNA in the sample based on the RNA absorbance; and

[0090] (iv) calculating the number of HIV-R region RNA copies per cell by dividing the value obtained in (ii) by the value obtained in (iii), thereby normalizing the HIV RNA copy number to obtain the HIV-R region RNA copy number (copy number / cell) in the biological sample.

[0091] In one example, quantifying the mass of RNA per volume in the sample includes adding an RNA intercalating dye and measuring the fluorescence emitted by the dye.

[0092] In one example, the RNA copy number is expressed as the number of HIV-R region copies / 10 6 cells.

[0093] In another example, the method for quantifying the mass of RNA per volume in the sample includes adding an RNA intercalating dye and measuring the fluorescence emitted by the dye. In one example, the RNA intercalating dye is selected from SyBr Green II, Syto RNA select green-fluorescent, and ToTo-1.

[0094] Those skilled in the art will understand that methods for quantifying the mass of DNA or RNA per volume in a sample are known in the art. For example, such methods include, but are not limited to, Qubit (Thermo Fisher), Nanodrop (ThermoFisher), and QuantideX (Asuragen).

[0095] In one example, the HIV-R region is quantified by:

[0096] (i) obtaining an aliquot of the sample in which RNA has been extracted;

[0097] (ii) contacting the aliquot with a labeled hydrolyzable oligonucleotide probe that hybridizes to the R region sequence of the long terminal repeat (LTR) of reverse transcribed HIV RNA (cDNA);

[0098] (iii) further contacting the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region of reverse transcribed HIV RNA (cDNA);

[0099] (iv) amplifying the R region sequence by PCR;

[0100] (v) extrapolating the signal obtained from the labeled oligonucleotide to a standard curve obtained from the corresponding amplification of a serial dilution of an HIV standard to obtain the number of HIV-R region RNA copies per volume of RNA in the aliquot.

[0101] In one example, the forward primer and the reverse primer bind to R region sequences upstream and downstream of the R region sequence to which the oligonucleotide binds, respectively.

[0102] In one example, the method further includes obtaining a biological sample from a subject and preparing RNA from the sample. In one example, the housekeeping standard is amplified by real-time PCR. In another example, the housekeeping standard is the same as an endogenous gene.

[0103] The present disclosure also provides a method for evaluating the effectiveness of antiretroviral therapy (ART) administered to an HIV-positive subject, the method comprising:

[0104] (i) quantifying the number of HIV-R region DNA copies as described herein;

[0105] (ii) quantifying the number of HIV-R region RNA copies as described herein;

[0106] (iii) determining the normalized number of HIV RNA copies in a sample obtained from a subject by dividing the value obtained in step (i) by the value obtained in step (ii); and

[0107] (iv) Compare the normalized HIV RNA copy number with one or more previous normalized values obtained from the same subject;

[0108] where a decrease in the normalized HIV RNA copy number indicates that the subject is receiving optimal / effective ART.

[0109] In one instance, quantifying the HIV-R region DNA or RNA copy number is according to the methods described herein or methods known in the art.

[0110] In one instance, the method further comprises obtaining a biological sample from the subject and preparing DNA and RNA from the sample.

[0111] The HIV DNA copy number or HIV RNA copy number described herein can be expressed as the number of copies per 1,000,000 cells (10 6 copies), i.e., copies / 10 6 cells. In one instance, the HIV RNA copy number is expressed as a value per any fixed number of cells, including but not limited to 1.5×10 6 、2×10 6 、2.5×10 6 or 3×10 6 cells.

[0112] In one instance, the volume is expressed as μl or ml.

[0113] The above method is preferably carried out in a polymerase chain reaction (PCR) tube.

[0114] The biological sample can be a cell population selected from blood or tissue or any other biological fluid in which lentivirus-infected cells are present. The biological sample may be whole blood, plasma or peripheral blood mononuclear cells (PBMC), or a sorted sample enriched for CD4 + T cells and monocytes / macrophages, or an isolated sample using magnetic beads to enrich a subset of the cell population (e.g., CD4 + T cells and monocytes / macrophages). The biological sample may also contain DNA or RNA derived from whole blood or PBMC. PBMC may be isolated from whole blood using Ficoll or Ficoll-Paque. In one instance, the biological sample is obtained from the subject. In one instance, the subject is human or primate.

[0115] Those skilled in the art will understand that the R regions of the sequences within the 5'LTR and 3'LTR of the lentivirus / HIV nucleic acids will be amplified by the aforementioned methods. In one example, the amplified R region sequence is the sequence contained within the sequence consisting of the sequences listed in SEQ ID NO:1 or SEQ ID NO:2. In one example, the R region sequence consists of the sequences listed in SEQ ID NO:1 or SEQ ID NO:2.

[0116] In another example, the housekeeping standards may be selected from the group consisting of glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta-actin (β-actin), beta-2 microglobulin (B2M), peptidylprolyl isomerase A (PPIA), eukaryotic translation elongation factor 1 gamma (EEF1γ), succinate dehydrogenase complex subunit A (SDHA), hydroxymethylbilane synthase (HMBS), 18s ribosomal RNA (18s rRNA), and phosphoglycerate kinase 1 (PGK 1).

[0117] In one example, the housekeeping gene and housekeeping standard for HIV DNA is beta-actin. In another example, the housekeeping gene and housekeeping standard for HIV RNA is GAPDH.

[0118] In one example, the number of cells in a sample is determined by measuring the DNA quality after DNA extraction. In another example, the DNA quality is estimated by the absorbance at 260 nm using a spectrophotometer. In one example, the number of cells in a sample is determined by measuring the RNA quality after RNA extraction. In another example, the amount of RNA is estimated by the absorbance at 260 nm using a spectrophotometer.

[0119] In one example, the number of cells in a sample is determined by measuring the DNA quality after DNA extraction. In another example, the DNA quality is estimated by measuring the fluorescence emitted by a DNA intercalating dye; in one example, the number of cells in a sample is determined by measuring the RNA quality after RNA extraction. In another example, the amount of RNA is estimated by measuring the fluorescence emitted by an RNA intercalating dye.

[0120] In one example, the labeled oligonucleotide or hydrolyzed oligonucleotide is a probe. The probe contains a fluorophore covalently linked to the 5'-end of the oligonucleotide probe and a quencher at the 3'-end, and is used for real-time PCR quantification. In one example, the fluorophore is selected from the group consisting of hydroxycoumarin, methoxycoumarin, Alexa fluor, aminocoumarin, Cy2, Alexa fluor 488, 430, 532, 546, 555, 594, 633, 660, 680, FITC, TRITC, PE, LCCyan500, FAM, TET, JOE, Yakima Yellow, HEX, Cy3, TAMARA, ROX, Texas Red, LC Red610, LCRed640, Cy5, Cy5.5, Cy7, and IRD700. In one example, the quencher is selected from the group consisting of BHQ-1, BHQ-2, IBRQ, and IBFQ. In one example, the probe is a dual quencher. In another example, the probe is a dual quencher and contains ZEN combined with IBRQ and IBFQ quenchers. TM Internal quencher.

[0121] In one example, according to any method described herein, the oligonucleotide binds to the following sequence: comprising about 13 to 40 consecutive nucleotides located in the HIV-1R region sequence listed in SEQ ID NO:1 or a sequence at least 70% identical to said sequence, or a sequence consisting of about 13 to 40 consecutive nucleotides located in the HIV-1R region sequence listed in SEQ ID NO:1 or a sequence at least 70% identical to said sequence. In another example, the oligonucleotide binds to a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence listed in SEQ ID NO:1.

[0122] In one example, according to any method described herein, the oligonucleotide binds to the following sequence: comprising the sequence 5’TAAGCAGTGGGTTCCCT 3’ (SEQ ID NO:3) or a sequence at least 70% identical thereto, or a sequence consisting of the sequence 5’TAAGCAGTGGGTTCCCT 3’ (SEQ ID NO:3) or a sequence at least 70% identical thereto. In another example, the oligonucleotide binds to a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence listed in SEQ ID NO:3.

[0123] In another instance, the oligonucleotide comprises the sequence 5’AGGGAACCCACTGCTTA 3’ (SEQ ID NO:4) or consists of the sequence 5’AGGGAACCCACTGCTTA 3’ (SEQ ID NO:4). In another instance, the oligonucleotide comprises the sequence X-AGGGAACCCACTGCTTA-Z (SEQ ID NO:5) or consists of the sequence X-AGGGAACCCACTGCTTA-Z (SEQ ID NO:5), where X is a reporter molecule, Z is a quencher molecule, and the sequence optionally comprises at least one locked nucleic acid (LNA). In another instance, X is FAM (carboxyfluorescein) and Z is BHQ-1. In another instance, the oligonucleotide comprises between 1 and 6 LNAs, between 2 and 5 LNAs, or between 2 and 4 LNAs. In another instance, the oligonucleotide comprises the sequence FAM-AGG LNA GA LNA AC LNA CCAC LNA TG LNA CTTA-BHQ-1 (SEQ ID NO:6) or consists of the sequence FAM-AGG LNA GA LNA AC LN A CCAC LNA TG LNA CTTA-BHQ-1 (SEQ ID NO:6), where X is a reporter molecule, Z is a quencher molecule, and LNA is locked nucleic acid. For clarity, locked nucleic acid is referred to herein as N LNA , where N is the indicated A, T, C, or G nucleobase.

[0124] Those skilled in the art will understand that the LNA modifications are not limited to the above positions, and the number of LNA modification positions will be determined to increase specificity and reduce background in real-time PCR assays.

[0125] In one instance, the HIV-1 forward primer comprises the sequence 5’GAGCCTGGGAGCTCTCTG 3’ (SEQ ID NO:7) or a sequence that is at least 75% identical thereto, or consists of the sequence 5’GAGCCTGGGAGCTCTCTG 3’ (SEQ ID NO:7) or a sequence that is at least 75% identical thereto. In another instance, the forward primer comprises the following sequence or consists of the following sequence: a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence listed in SEQ ID NO:7.

[0126] In one example, the forward primer hybridizes to the following sequences: sequences that include the sequence 5'-CAGAGAGCTCCCAGGCTC-3' (SEQ ID NO:8) or sequences that are at least 75% identical thereto, or HIV-1R region sequences that consist of the sequence 5'-CAGAGAGCTCCCAGGCTC-3' (SEQ ID NO:8) or sequences that are at least 75% identical thereto. In another example, the forward primer hybridizes to a sequence that includes or consists of the following sequences: sequences that are at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% identical to the sequence listed in SEQ ID NO:8.

[0127] In one example, the reverse primer includes a sequence that is at least 75% identical to the sequence 5’ACTCAAGGCAAGCTTTATTGAGGC 3’ (SEQ ID NO:9), or consists of a sequence that is at least 75% identical to the sequence 5’ACTCAAGGCAAGCTTTATTGAGGC 3’ (SEQ ID NO:9). In another example, the reverse primer includes or consists of the following sequences: sequences that are at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% identical to the sequence listed in SEQ ID NO:9.

[0128] In one example, the reverse primer hybridizes to an HIV-1R region sequence that includes the sequence 5’GCCTCAATAAAGCTTGCCTTGAGT 3’ (SEQ ID NO:10) or a sequence that is at least 75% identical thereto, or consists of the sequence 5’GCCTCAATAAAGCTTGCCTTGAGT 3’ (SEQ ID NO:10) or a sequence that is at least 75% identical thereto. In another example, the reverse primer includes or consists of the following sequences: sequences that are at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% identical.

[0129] In another example, the forward primer comprises or consists of the sequence 5’GAGCCTGGGAGCTCTCTG 3’ (SEQ ID NO:7), and the reverse primer comprises or consists of the sequence 5’ACTCAAGGCAAGCTTTATTGAGGC 3’ (SEQ ID NO:9).

[0130] In another example, the oligonucleotide binds to the following sequence: a sequence comprising about 13 to 40 consecutive nucleotides within the HIV-2R region sequence listed in SEQ ID NO:2 or a sequence that is at least 70% identical to the consecutive nucleotides, or a sequence consisting of about 13 to 40 consecutive nucleotides within the HIV-2R region sequence listed in SEQ ID NO:2 or a sequence that is at least 70% identical to the consecutive nucleotides. In another example, the oligonucleotide binds to a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% identical to the sequence listed in SEQ ID NO:2.

[0131] In another example, the oligonucleotide binds to the following sequence: a sequence comprising the sequence 5’GCCTGGGTGTTCCCTGCTAGACTCT 3’ (SEQ ID NO:11) or a sequence that is at least 70% identical thereto, or a sequence consisting of the sequence 5’GCCTGGGTGTTCCCTGCTAGACTCT 3’ (SEQ ID NO:11) or a sequence that is at least 70% identical thereto. In another example, the oligonucleotide binds to a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% identical to the sequence listed in SEQ ID NO:11.

[0132] In another example, the oligonucleotide comprises or consists of the sequence 5’AGAGTCTAGCAGGGAACACCCAGGC 3’ (SEQ ID NO:12). In another example, the oligonucleotide comprises or consists of the sequence X-GCCTGGGTGTTCCCTGCTAGACTCT-Z (SEQ ID NO:13), where X is a reporter molecule and Z is a quencher molecule. In another example, X is FAM (carboxyfluorescein) and Z is BHQ-1.

[0133] In one instance, the HIV-2 forward primer comprises or consists of the following: the sequence SEQ ID NO:14, SEQ ID NO:31, SEQ ID NO:33, or SEQ ID NO:35, or a sequence that is at least 75% identical thereto. In another instance, the forward primer comprises or consists of the following: a sequence that is at least 75%, at least 80%, at least 82%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to SEQ ID NO:14, SEQ ID NO:31, SEQ ID NO:33, or SEQ ID NO:35.

[0134] In one instance, the forward primer hybridizes to the following sequence: a sequence comprising 5'-GAGAACCTCCCAGGGCTC-3' (SEQ ID NO:15) or a sequence that is at least 75% identical thereto, or an HIV-2R region sequence consisting of 5'-GAGAACCTCCCAGGGCTC-3' (SEQ ID NO:15) or a sequence that is at least 75% identical thereto. In another instance, the forward primer hybridizes to a sequence comprising or consisting of the following: a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 87%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence set forth in SEQ ID NO:15.

[0135] In one instance, the HIV-2 reverse primer comprises or consists of the following sequence: the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34, or SEQ ID NO:36, or a sequence that is at least 75% identical thereto. In another instance, the reverse primer comprises or consists of the following sequence: a sequence that is at least 75%, at least 80%, at least 82%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to the sequence set forth in SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34, or SEQ ID NO:36.

[0136] In another example, the forward primer comprises or consists of: SEQ ID NO:14, SEQ ID NO:31, SEQ ID NO:33, or SEQ ID No:35, and the reverse primer comprises or consists of: SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34, and SEQ ID NO:36.

[0137] The present disclosure provides a composition for amplifying HIV-1 nucleic acid, the composition comprising a labeled oligonucleotide probe, the labeled oligonucleotide probe comprising or consisting of a combination of a probe, a forward primer, and a reverse primer, the combination selected from one or more combinations of the following:

[0138] (i) oligonucleotide probe: SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, or SEQ ID NO:48;

[0139] (ii) forward primer: SEQ ID NO:7 or SEQ ID NO:29; and

[0140] (iii) reverse primer: SEQ ID NO:9 or SEQ ID NO:30.

[0141] The present invention also provides a composition for amplifying HIV-2 nucleic acid, which comprises a labeled oligonucleotide, the labeled oligonucleotide comprising or consisting of a combination of a probe, a forward primer, and a reverse primer, the combination selected from one or more combinations of the following:

[0142] (i) oligonucleotide probe: SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID:41, SEQ ID:42, SEQ ID:43, SEQ ID:44, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, or SEQ ID NO:53;

[0143] (ii) forward primer: SEQ ID NO:14, SEQ ID NO:31, SEQ ID NO:33, or SEQ ID NO:35;

[0144] (iii) Reverse primer: SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36.

[0145] The present disclosure also provides a method for identifying a subject in need of antiretroviral therapy (ART) and / or in need of adjustment of ART dosage, the method comprising performing one or more of the methods described herein.

[0146] The present disclosure also provides a method for treating an HIV-positive subject, the method comprising detecting or quantifying lentiviral nucleic acid or HIV DNA and / or RNA according to one or more of the methods described herein, and administering ART to the subject.

[0147] The methods described herein can be used to determine whether a subject suspected of being HIV-positive serologically has HIV-1 or HIV-2. In one example, this can be done in a reaction tube using different fluorescently labeled oligonucleotides. Then, the detectable signal emitted from the labeled oligonucleotides can be correlated with the presence of HIV-1 or HIV-2. For example, the presence of HIV-1 can be detected by yellow fluorescence, while the presence of HIV-2 can be detected by red fluorescence.

[0148] In another example, the GAPDH oligonucleotide comprises the sequence X-AAGGTCGGAGTCAACGGATTTGGTCGT-Z (SEQ ID NO:17) or a composition thereof, where X is a reporter molecule and Z is a quencher molecule. In one example, X is FAM and Z is BHQ-1.

[0149] In another example, the forward primer and the reverse GAPDH primer respectively comprise the following sequences or are composed of the following sequences: the sequence 5’GGCAACAATATCCACTTTACCAG 3’ (SEQ ID NO:18) and 5’TCGACAGTCAGCCGCATCTT 3’ (SEQ ID NO:19).

[0150] In another example, the β-actin oligonucleotide comprises the sequence X-ATGCCCTCCCCCATGCCATCCTGCG-Z (SEQ ID NO:20), or is composed of it, where X is a reporter molecule and Z is a quenching molecule. In one example, X is FAM and Z is BHQ-1.

[0151] In another example, the forward primer and the reverse β-actin primer respectively comprise the following sequences or consist of the following sequences: the sequence 5’TCACCCACACTGTGCCCATCTACGA 3’ (SEQ ID NO:21) and 5’CAGCGGAACCGCTCATTGCCAATGG 3’ (SEQ ID NO:22).

[0152] In another example, the 3’LTR oligonucleotide comprises the sequence 5’FAM-TTAGACCAGATCTGAGCCTGGGAGCTCTC-BHQ-1 3’ (SEQ ID NO:25), or consists of the same.

[0153] In another example, the forward primer and the reverse 3’LTR primer respectively comprise the sequence 5’CCAAAGAAGACAAGATATCCTTGA 3’ (SEQ ID NO:23), or consist of the same.

[0154] In another example, the gag oligonucleotide comprises the sequence 5′-FAM-ATCLNAALNAATGLNAAGGAAGLNACTGLNAC-BHQ-1 3′ (SEQ ID NO:28), or consists of the same.

[0155] In another example, the forward primer and the reverse gag primer respectively comprise the following sequences or consist of the following sequences: the sequence 5’AGTGGGGGGACATCAAGCAGCCATGCAAAT 3’ (SEQ ID NO:26) and 5’TACTAGTAGTTCCTGCTATGTCACTTCC 3’ (SEQ ID NO:27).

[0156] The present disclosure also provides a kit for detecting HIV-1, which kit comprises the composition as described herein, as well as suitable reagents and instructions for detecting and quantifying HIV-1 according to the methods described herein. In one example, the kit further respectively comprises the β-actin oligonucleotide according to SEQ ID NO:20 and the forward primer and the reverse primer according to SEQ ID NO:21 and 22. In another example, the kit further comprises a composition which comprises the GAPDH oligonucleotide according to SEQ ID No:17 and the forward primer and the reverse primer according to SEQ ID NO:18 and 19.

[0157] The present disclosure also provides a kit for detecting HIV-2, the kit comprising the composition described herein, as well as suitable reagents and instructions for detecting and quantifying HIV-2 according to the methods described herein. In one example, the kit further comprises a β-actin oligonucleotide according to SEQ ID NO:20 and forward and reverse primers according to SEQ ID NO:21 and 22, respectively. In another example, the kit further comprises a composition comprising a GAPDH oligonucleotide according to SEQ ID NO:17 and forward and reverse primers according to SEQ ID NO:18 and 19.

[0158] In one example, the PCR amplification is 40 cycles. In another example, the PCR amplification is 50 cycles.

[0159] In one example, the steps of the method are performed in sequence. Brief Description of the Drawings

[0161] Figure 1 Shows the genomic structure of HIV-1.

[0162] Figure 2 Shows the genomic structure of HIV-2.

[0163] Figure 3-1 Shows the positions of the PCR primers and oligonucleotide probes for the HIV-1 R region sequence (A). The R region of the HIV-1 sequence is 95 bases long. Figure 3-1 B of Figure 3-2 C and D of show the positions of the PCR primer and oligonucleotide probe combinations for the HIV-2 R region sequence exemplified herein. The R region of the HIV-2 sequence is 174 bases long. Locked nucleic acid modifications were introduced into some of the oligonucleotide probes to increase the annealing temperature of the probes.

[0164] Figure 4 Shows the alignment of the oligonucleotide probe (HIV-1 probe 1) with HIV-1 subtype sequences. Shading indicates positions where the sequence is conserved among HIV-1 subtypes to provide efficient PCR. The HIV sequences were obtained from the Los Alamos National Laboratory - HIV Sequence Consortium 2013 database (HIV Sequence Compendium 2013 Foley B, et al. Published by Theoretical Biology and Biophysics Group, Los Alamos Laboratory NM, LA-UR 13-26007).

[0165] Figure 5 Shows the sequences in the HIV-2 subtypes to which the HIV-2 probe 1 binds.

[0166] Figure 6 Shows a schematic diagram of the real-time PCR assay (A) and the end-point PCR assay (B). The real-time PCR assay uses Taqman probes and an unlabeled primer set. The end-point PCR assay in this embodiment uses a biotin-labeled reverse primer and an unlabeled forward primer and a digoxigenin (Dig)-labeled probe. An anti-Dig antibody labeled with peroxidase is added, and then a chemiluminescent reaction is carried out, thereby providing an output in relative light units (RLU).

[0167] Figure 7 Shows that plasma viral load measurements cannot distinguish between optimal ART subjects and suboptimal ART subjects. All 46 subjects (suboptimal ART and optimal ART groups) showed suppressed VL (VL < 20 copies / mL) at the time of blood collection.

[0168] Figure 8 Shows the intracellular RNA amplification and quantification using the GAPDH standard according to the present method, distinguishing between the "suboptimal ART" (n = 18) and "optimal ART" (n = 29) subject groups, and the difference is statistically significant (A). Further analysis based on the HIV-1 DNA level defined the "improved optimal ART" group, in which the HIV-1 DNA level was less than 800 HIV-1 DNA per 10 6 cells (B). The difference in the HIV-1 RNA transcriptional activity between the "improved optimal ART" (n = 6) and "optimal ART" (n = 23) was statistically significant (B and C). Patients who experienced "Blips" and "immune failure" were classified as suboptimal ART subjects, where a Blip was defined as at least one transient high pVL (less than 200 copies / mL) within 6 months. Immune failure was defined as pVL < 20 copies / ml and CD4 + T cell count < 350 cells / μl, while optimal ART subjects showed suppressed VL (VL < 20 copies / mL) for more than 6 months.

[0169] Figure 9Shows typical VL data of treatment - successful patients and HIV - 1 VL rebound after stopping ART. Four treatment - naive patients received ART for one year. During the 24 - week treatment period (A, B, and D) and during the 12 - week treatment period (C), the plasma viral load (pVL, black line with circles) in the four patients was below the detection limit. The pVL level remained below the detection level until week 52 (one year) of ART. Although the pVL was undetectable in these four patients, low - level intracellular HIV - 1 transcriptional activity (gray bars) was detected. After stopping treatment, the VL in the 4 patients increased rapidly, and the increase in VL was accompanied by an increase in intracellular HIV - 1 transcriptional activity. ART = antiretroviral therapy. STI = Stricture Treatment Interruption (STI: stopping ART).

[0170] Figure 10 In Figure 9 the subjects entered the second phase of ART treatment. During this second - phase ART, the VL was suppressed below the detection level. However, even when the VL was below the detection level, consistent detection of intracellular HIV - 1 transcriptional activity (gray bars) was present. After stopping the second phase of ART treatment, rapid - rebound VL was observed in both patients (A and B). ART = antiretroviral therapy. STI = Stricture Treatment Interruption (STI: stopping ART).

[0171] Figure 11 To investigate whether the increase in transcriptional activity originated from cells in the latent - infected reservoir, intracellular RNA levels at w1 (ART) and 4 weeks after stopping ART (sw4) are shown as gray circles on the horizontal axis. Plasma RNA of HIV - 1 that rebounded at week 16 after ART was collected and analyzed by Sanger sequencing. On the web - based HIV database (http: / / www.hiv.lanl.gov / content / sequence / HIV / HIVTools.html), the data were analyzed using the neighbor - joining clustering method. Samples isolated from the same subject clustered together (gray rectangular boxes), indicating that the latent viral reservoir has persistent HIV transcriptional activity, which contributes to the rebound of plasma viral load.

[0172] Figure 12Shows TaqMan probe-based PCR analysis and quantification of HIV-2 RNA obtained from plasma samples of two subjects. (A) Shows the analysis of HIV-2 copy number / ml plasma in the samples and the HIV-2 standard. The HIV-2 RNA copy number was estimated from the Cp values generated from 7 standards. (B) Shows the standard analysis of the HIV-2 assay. The Cp values generated from the standards are represented by open circles.

[0173] Figure 13 Shows intracellular HIV-2 transcriptional analysis performed in subjects with plasma viral load below the detection limit. Although the plasma viral load test was negative, HIV-2 intracellular transcripts (HIV-2 RNA) were detected when normalized to the integrated HIV-2 DNA copy number.

[0174] Figure 14 Shows the analysis of plasma viral load (A) in 28 subjects. As shown in (A), no detectable HIV-1 was present in the plasma of the subjects. (B) Shows the quantification of HIV-1 DNA in optimal (n = 7) and suboptimal (n = 21) ART subjects. (C) Shows the HIV-1 transcriptional activity (RNA).

[0175] Figure 15 Shows the HIV-1 transcriptional activity (RNA) in subjects with improved optimal ART, optimal ART, and suboptimal ART.

[0176] Figure 16 Shows HIV transcription normalized to GAPDH of activated HIV-1 in latently HIV-1-infected cells.

[0177] Figure 17 Shows the standard curve of 40-cycle end-point amplification of the HIV-1 DNA standard.

[0178] Sequence Listing

[0179] The following table summarizes the sequences mentioned in this disclosure.

[0180]

[0181]

[0182]

[0183]

[0184] Detailed Description

[0186] General Description

[0187] Throughout the specification, unless specifically stated otherwise or the context requires otherwise, references to a single step, a composition of matter, a group of steps, or a group of compositions of matter shall be considered to include one and a plurality (i.e., one or more) of these steps, compositions of matter, groups of steps, or groups of compositions of matter.

[0188] Those skilled in the art will understand that the aspects and embodiments described herein are susceptible to variations and modifications in addition to those specifically described. It is to be understood that the present disclosure encompasses all such variations and modifications. The present disclosure also encompasses all steps, features, compositions, and compounds individually or collectively mentioned or pointed out in this specification, as well as any or all combinations of any two or more of said steps or features.

[0189] The scope of the present disclosure is not limited by the specific examples described herein, which are for illustrative purposes only. Functionally equivalent products, compositions, and methods are clearly within the scope of the present disclosure.

[0190] Unless otherwise specifically stated, any example of the present disclosure herein shall be considered to be in reference to any other example applicable to the present disclosure.

[0191] Unless otherwise clearly defined, all technical and scientific terms used herein shall be considered to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).

[0192] Unless otherwise noted, the recombinant proteins, cell cultures, and immunological techniques used in this disclosure are standard procedures well known to those skilled in the art. These techniques are described and explained in the literature, e.g., J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates to date).

[0193] The term “and / or,” e.g., “X and / or Y” shall be understood to mean “X and Y” or “X or Y” and shall be understood to provide explicit support for both meanings or for either one of them.

[0194] Throughout this specification, the word "comprise" or variations such as "comprises" or "comprising" will be understood to imply the inclusion of a stated element, integer, or step, or a group of elements, integers, or steps but not to exclude any other element, integer, or step, or a group of elements, integers, or steps.

[0195] References to the singular forms "a", "an", and "the" are also to be construed to include the plural forms unless the context otherwise requires.

[0196] Any description of a document, statute, material, design, article, or the like that is included in this specification should not be taken as an admission that any or all of these matters form part of the prior art base or are common general knowledge in the technical field relevant to this invention by virtue of their existence before the priority date of each claim of this application.

[0197] Selected Definitions

[0198] As used herein, the term "lentivirus" refers to a genus of viruses of the Retroviridae family. Its genome contains two copies of positive-sense ssRNA within a conical capsid. Examples of lentiviruses include human (HIV), simian (SIV), and feline (FIV).

[0199] As used herein, the term "HIV" or "human immunodeficiency virus" refers to HIV-1 or HIV-2, including various subtypes. Subtypes of HIV-1 include A, B (the most prevalent form), C, D, E, F, G, H, J, and K. Subtypes of HIV-2 include A, B, C, F, or G. HIV-1 and HIV-2 are now classified into groups corresponding to phylogenetically related groups or clades (e.g., HIV-1 groups M, N, O, and P). Figure 1 The structures of HIV-1 and HIV-2 are provided.

[0200] As used herein, the term "hydrolysis oligonucleotide" or "probe" refers to an oligonucleotide that is dual-labeled, where the 5' end is labeled with a fluorescent reporter molecule and the 3' end is labeled with a quencher molecule. The sequence of the probe is complementary to the region of interest in the target molecule to be amplified (i.e., Figure 1The R region in) is specific. Usually, the probe length is between 20 - 30 bases. The probe is designed such that the length of the sequence places the 5'-fluorophore and the 3'-quencher close enough to inhibit fluorescence. In the amplification reaction, when extension reaches the bound hydrolysis probe, the 5'-3' exonuclease activity of Taq polymerase degrades the probe. Cleavage of the probe separates the fluorescent reporter from the rest of the probe, allowing the reporter to fluoresce. In subsequent PCR cycles, the amount of released fluorescent reporter accumulates and thus the amount of fluorescence accumulates. An example of a hydrolyzed oligonucleotide is probe.

[0201] The term "identity" and its grammatical variants mean that two or more recited entities are the same. Thus, when two sequences are identical, they have the same amino acid sequence at least within the region or portion being referenced. When two nucleic acid sequences are identical, they have the same polynucleotide sequence at least within the region or portion being referenced. Identity can be over a defined region (region or domain) of the sequence. The % identity of polynucleotides is determined by GAP (Needleman and Wunsch, J. Mol Biol) 48:444 - 453. 1970) analysis (GCG program), where the gap creation penalty = 5, and the gap extension penalty = 0.3. Unless otherwise specified, the query sequence length is at least 45 nucleotides, and GAP analysis aligns the two sequences within a region of at least 45 nucleotides. Preferably, the query sequence length is at least 100 nucleotides, and GAP analysis aligns the two sequences within a region of at least 100 nucleotides. Most preferably, the two sequences are aligned over their entire length.

[0202] The term "viral load or VL" as used herein refers to the measurement of the number of viral particles (i.e., HIV - 1 or HIV - 2) or the amount of viral genetic material in an organism, typically the number of viral particles per volume of plasma.

[0203] The term "antiretroviral therapy" or "ART" as used herein refers to the treatment of HIV - positive subjects with a combination of antiviral drugs that are used to reduce the rate of HIV multiplication in the body.

[0204] The term "optimal / effective ART" as used herein refers to subjects in whom the plasma viral load (pVL) has been suppressed for more than 6 months. "Suppressed viral load" means below the limit of detection according to pVL.

[0205] The term "primer" refers to an oligonucleotide that can act as a starting point for synthesis when placed under certain conditions, under which the synthesis of a primer extension product complementary to a nucleic acid strand (template) is initiated.

[0206] The term "suboptimal / ineffective ART" as used herein refers to subjects who have experienced at least one blip (BL) or immunological failure (IL). A blip refers to a transient increase in the virus, where the viral load rises to between 50 and 100 copies / ml (or approximately <200 copies / mL). Suboptimal ART subjects are those who exhibit one or more blips within 6 months. Immunological failure is defined as pVL < 20 copies / ml and CD4 + T cell count < 350 cells / μl. The term "improved optimal ART" as used herein refers to subjects with a DNA copy number of less than 800 DNA per 10 6 cells, especially among patients in the optimal ART group.

[0207] The term "real-time PCR" as used herein refers to any method of monitoring DNA amplification or reverse-transcribed RNA in real-time during the PCR process, rather than at the end of the PCR as in conventional PCR. Generally, the terms "real-time PCR" and "quantitative PCR" are used interchangeably. Methods for performing real-time PCR are known in the art from the resources described herein. Kits for performing real-time PCR using TaqMan probes are available from commercial suppliers such as Thermofisher or Applied Biosystems.

[0208] The term "Cp" or "crossing point" as used herein refers to the cycle during real-time PCR in which the fluorescence from the amplification exceeds the background fluorescence. For example, a lower Cp is associated with a higher level of target expression in the sample.

[0209] The term "RNA" as used herein is also intended to include mRNA.

[0210] As used herein, the terms "treat", "treating", "treatment" and their grammatical variants mean subjecting an individual to a procedure, protocol, process or therapy in which a physiological response or outcome is desired in the individual. Since every subject being treated may not respond to a particular treatment procedure, protocol, process or therapy, treatment does not require the achievement of the desired physiological response or outcome in every subject or group of subjects. Thus, a given subject or group of subjects may not respond or may respond inadequately to treatment.

[0211] The term "bind" means that an oligonucleotide reacts with a specific nucleic acid sequence more frequently, more rapidly, for a longer duration and / or with a greater affinity than it does with other nucleic acid sequences.

[0212] The term "hybridization" as used herein refers to the formation of double-stranded nucleic acids from complementary single-stranded nucleic acids. Hybridization can occur between two nucleic acids that are perfectly matched or have some mismatches but are substantially complementary. The complementarity of hybridization may depend on the hybridization conditions, particularly temperature. Detailed conditions for hybridization can be found in Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY (2001) and MLM Anderson, Nucleic acid hybridisation, Springer-Verlag, New York, NY (1999).

[0213] The term "locked nucleic acid" as referred to herein means a modified DNA nucleotide in which the deoxyribose moiety of the LNA nucleotide has been modified with an additional bridge connecting the 2'-oxygen and 4'-carbon.

[0214] The term "PBMC" as used herein refers to any peripheral blood cell with a round nucleus, such as T cells, B cells, NK cells, and monocytes. PBMCs also contain progenitor cells. They are typically isolated from whole blood using Ficoll or Ficoll-Paque.

[0215] Detection of HIV-1 or HIV-2 in subjects and discrimination between HIV-1 and HIV-2

[0216] Most HIV-infected individuals are receiving antiretroviral therapy (ART). ART can significantly and rapidly reduce the plasma viral load (pVL) (the number of HIV RNA copies in plasma) to levels below the limit of detection. ART has significantly improved the morbidity and mortality associated with HIV infection, but ART does not cure. Despite the long duration of ART, HIV still persists as integrated HIV DNA in many cell types, forming long-lived cell reservoirs. After ART is stopped, the pVL level rebounds rapidly, and most subjects typically rebound within a few weeks. There is currently no reliable assay to monitor and evaluate the ART treatment outcomes in HIV (HIV-1 or HIV-2) infected individuals. Generally, both pVL and CD4 + T cell counts are used to monitor ART for HIV-infected patients. In most successfully treated subjects, the pVL value is below the limit of detection, and the CD4 + cell count usually remains at a high level. Although these classical markers still play an important role, they are not sensitive enough to monitor active HIV infection.

[0217] Assays based on detecting HIV activity, including proviral DNA, HIV-integrated DNA, 2LTR circles, and ultrasensitive viral load in plasma, result in a lack of sensitivity and / or a need for a large number of samples.

[0218] Currently, the detection of HIV in subjects starts with the first serology-based screening assay (“HIV-1 / 2 antigen / antibody combination immunoassay”), in which a biological sample, usually blood, is tested for HIV antibodies and p24 antigen. If the sample is positive, a second confirmatory assay is performed using the “HIV-1 / HIV-2 antibody differentiation immunoassay”. Such tests include Western blot analysis, multiplex assays, or the Geenius TM supplemental assay. This test is used to distinguish between HIV-1 and HIV-2 in subjects. This test has good sensitivity but not good specificity, so in some cases, nucleic acid testing (NAT) is used to further test HIV-positive samples and subjects with unknown HIV-1 / 2 status.

[0219] Roche developed an HIV-1 DNA confirmatory assay (Amplicor HIV-1 DNA PCR Test). However, this assay has now been discontinued, and the HIV diagnostic algorithm is shifting from HIV-1 DNA detection to HIV-1 RNA detection using large automated machines (Cobas 6800 / 8800 systems, M2000, and Panther systems). This method is based on the simultaneous amplification and detection of two independent regions of the HIV-1 genome for quantifying HIV-1 RNA. This machine is used to process a large number of samples, but most HIV reference laboratories do not have a large number of samples for confirmatory test requests. In addition, it takes at least eight hours to obtain results, and this does not take into account the associated time for transporting samples to a facility with this machine. In many HIV-1 diagnostic laboratories, plasma viral load RNA assays are now used as an alternative to HIV-1 confirmatory assays. However, there are some risks associated with using the HIV-1 plasma VL RNA assay as an HIV-1 confirmatory assay. In the early stages of HIV-1 infection, the inventors were unable to detect plasma VL RNA in plasma because the HIV-1 plasma RNA level does not increase in the early stages of HIV-1 infection. Plasma LV increases 2-3 weeks after HIV-1 infection. Therefore, the plasma VL HIV-1 RNA assay is not entirely suitable as an HIV-1 confirmatory assay.

[0220] Since the trend has shifted to HIV-1 RNA assays, there is currently no HIV-1 DNA assay for confirmation. In addition, the machine cost and test cost make the Cobas 6800 / 8800 system too expensive for hospital laboratories.

[0221] Although HIV-1 RNA viral load testing is sensitive and reliable, due to the increasing prevalence of HIV-2, there is still a need for HIV-1 DNA detection in the art. In addition, there is a need for a more sensitive method to confirm the HIV status of a sample that is considered indeterminate HIV-1 / 2 and HIV positive by a second serology-based supplemental confirmation test.

[0222] There is currently no available HIV-2 DNA confirmation assay. The methods described herein provide for the detection and quantification of HIV-1 and HIV-2 DNA, which can be performed in a much shorter time frame at a much lower cost and without the need to ship samples to a suitable facility for testing.

[0223] Due to the current changes in HIV diagnostic strategies, where the focus has shifted to HIV plasma viral load RNA assays, there is still a great need for a confirmation assay that can distinguish between HIV-1 and HIV-2 infections in a subject. Such an assay is particularly important when a subject is evaluated as "indeterminate HIV-1 / 2" and "HIV positive" by a second serology-based supplemental confirmation test.

[0224] The methods described herein for detecting HIV-1 or HIV-2 are based on targeting the R region within the long terminal repeat (LTR) of lentiviruses. To develop such an assay, the inventors needed to overcome many technical difficulties. First, the R region is relatively short, approximately 95 - 175 bases in length (see SEQ ID NO:1 and 2 herein). Typically, the PCR primer lengths for forward and reverse primers are between 18 - 25 bases, and the probe length is approximately 20 - 30 bases. Thus, only limited sequence is available for oligonucleotide and primer binding. Another problem is the possibility of primer dimer formation. In addition, the primers and oligonucleotide probes must be designed to provide reliable and sensitive detection across all HIV subtypes (HIV-1 or HIV-2). For HIV-1, this is shown, for example, in Figure 4 and for HIV-2 in Figure 5 as shown in Figure 4 Alignment of oligonucleotide probes between HIV-1 subtypes A, B, C, D, F, and G is shown. Figure 5 Alignment of oligonucleotide probes between HIV-2 subtypes A and B is shown. The inventors found that good alignment of the 3' end of the forward primer and the 5' end of the reverse primer is necessary to achieve an effective PCR assay. The inventors also found that the oligonucleotide probe needs to have perfect match to the HIV-1 sequence at the 3' and 5' ends of the probe sequence to achieve effective PCR. The inventors successfully overcame the limitations of short sequences and multi-subtype sequence variations and designed a quantitative real-time PCR assay that can detect the R region of HIV lentiviruses.

[0225] Detection of HIV in subjects

[0226] The present disclosure provides a method for detecting HIV in a subject having human immunodeficiency virus (HIV) or suspected of having HIV infection (AIDS), the method comprising performing PCR amplification on nucleic acids in a biological sample obtained from the subject, wherein the amplification comprises primers that hybridize to sequences within the R region of the long terminal repeat (LTR) of HIV, and subsequently detecting any amplification, wherein detection of amplification indicates the presence of HIV in the subject.

[0227] Due to the presence of two copies of the R region in the HIV genome, amplification will result in amplification of both R regions present in the 5’ LTR and 3’ LTR.

[0228] PCR amplification can be performed using conventional PCR or quantitative PCR (RT-PCR). In one example, step (b) is performed using real-time PCR.

[0229] In one example, the method further comprises a probe. The probe can be a labeled hydrolysis oligonucleotide. In another example, the probe is a probe. The probe can also be a fluorescently labeled hybridization probe.

[0230] In one example, the method further comprises:

[0231] (i) contacting the nucleic acids in the sample with a labeled hydrolysis oligonucleotide that binds within the R region sequence of the long terminal repeat (LTR) of HIV;

[0232] (ii) further contacting the nucleic acids with a forward primer and a reverse primer that hybridize to sequences within the R region sequence;

[0233] (iv) amplifying the R region sequence; and

[0234] (v) detecting the amplification;

[0235] wherein the amplification is detected by a signal emitted by the labeled oligonucleotide, the signal indicating the presence of HIV in the subject.

[0236] Preferably, the forward primer and the reverse primer bind to R region sequences upstream and downstream, respectively, of the R region sequence to which the oligonucleotide binds.

[0237] In one example, the method further comprises obtaining a biological sample from the subject. In another example, the biological sample is whole blood, plasma, or peripheral blood mononuclear cells (PBMC). In another example, DNA is extracted from the biological sample.

[0238] The HIV may be HIV-1 or HIV-2. In another instance, the HIV nucleic acid is DNA or RNA. In another instance, the method detects integrated HIV. In another instance, the amplification is carried out by quantitative PCR. In another instance, the amplification is carried out by real-time PCR (RT-PCR). In another instance, the hydrolyzed oligonucleotide is a probe.

[0239] Quantification of HIV DNA

[0240] The present disclosure also provides a method for quantifying the copy number of HIV DNA in a biological sample. Accordingly, the present disclosure provides a method for quantifying the copy number of HIV DNA in a biological sample from a subject with HIV or suspected of having an HIV infection, the method comprising:

[0241] (i) detecting the HIV-R region sequence; and

[0242] (ii) quantifying the copy number of the HIV-R region in the sample by reference to an HIV standard, wherein the copy number of the HIV-R region is expressed as the copy number of the HIV-R region per volume of DNA present in the sample.

[0243] In one instance, detecting the HIV-R region sequence is performed as described herein or known in the art.

[0244] In one instance, the method further comprises:

[0245] (iii) quantifying an endogenous housekeeping gene by quantitative PCR using a corresponding housekeeping standard to obtain the copy number of the endogenous gene, which copy number is expressed as the copy number of the housekeeping gene per volume of DNA present in the sample;

[0246] (iv) dividing the obtained copy number by the copy number of the endogenous gene in the cell to obtain the number of cells per volume of DNA in the sample; and

[0247] (v) calculating the copy number of HIV-R region DNA per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the copy number of HIV DNA to obtain the copy number of DNA (copy number / cell) in the biological sample.

[0248] "Corresponding" means that the housekeeping standard is the same as the endogenous housekeeping gene.

[0249] Preferably, aliquots of the same sample obtained from the subject are used for the quantification of HIV-R region DNA and the endogenous housekeeping gene. In a particular instance, it is performed on an aliquot of the sample from which DNA has been extracted from the subject.

[0250] In one example, the HIV-R region is quantified by:

[0251] (i) obtaining an aliquot of a sample in which DNA has been extracted;

[0252] (ii) contacting the aliquot with a labeled oligonucleotide that binds within the R region sequence of the long terminal repeat (LTR) of HIV DNA;

[0253] (iii) further contacting the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region sequence;

[0254] (iv) amplifying the R region sequence by quantitative PCR;

[0255] (v) extrapolating the signal obtained from the labeled oligonucleotide to a standard curve obtained by corresponding amplification of a series of dilutions of an HIV standard to obtain the number of HIV-R region DNA copies per volume of DNA in the aliquot.

[0256] In another example, an endogenous housekeeping gene is quantified by:

[0257] (i) obtaining an aliquot of a sample containing extracted DNA;

[0258] (ii) contacting the housekeeping gene in the aliquot with a labeled oligonucleotide that binds to a sequence within the housekeeping gene;

[0259] (iii) further contacting the aliquot with a forward primer and a reverse primer that hybridize to upstream and downstream sequences, respectively, of a housekeeping gene sequence to which the oligonucleotide binds;

[0260] (iv) amplifying the housekeeping gene sequence using quantitative PCR; and

[0261] (v) extrapolating the signal obtained from the labeled oligonucleotide to a standard curve obtained by a series of dilutions of a corresponding amplification standard to obtain the number of endogenous housekeeping gene copies per volume of DNA in the aliquot.

[0262] In one example, the aliquots used to amplify the HIV R region and the endogenous gene are obtained from the same sample, preferably from DNA extracted from the same sample. In one example, the oligonucleotide is a hydrolyzed oligonucleotide.

[0263] Those skilled in the art will understand that any known housekeeping gene is suitable for use in the present method. In one example, the housekeeping gene is β-actin. In another example, the housekeeping standard is serially diluted to provide 1, 20, 200, 2000, 20,000, 2x10 5 and 2x10 6 copies / μl.

[0264] The number of cells per volume of DNA in a biological sample is obtained by quantifying an endogenous housekeeping gene by real-time PCR, which uses the same standard as the endogenous housekeeping gene to obtain the copy number of the endogenous gene, and the copy number of the endogenous gene is expressed as a value of X copies / μl DNA in the sample. Then, the cell number can be estimated from the actin copy number by dividing by 200 (assuming 200 copies of β-actin per cell) to provide a value of X cells / μl DNA in the sample. Those skilled in the art will understand that depending on the housekeeping gene used, the value of 200 for β-actin may need to be replaced with a different value corresponding to the copy number of the gene in the cell.

[0265] In one example, HIV is HIV-1 or HIV-2.

[0266] In another example, the HIV standard is a plasmid standard containing a single copy number of the HIV genome.

[0267] In another example, the HIV standard is serially diluted to provide 0, 4, 40, 400, 4×10 3 、4×10 4 、4×10 5 and 4×10 6 copies / μl.

[0268] Alternatively, the copy number of HIV DNA in a sample can be obtained by replacing the use of a housekeeping gene with a calculation based on DNA absorbance. Thus, the use of a housekeeping gene standard may be replaced by measuring the absorbance of the DNA. This method is familiar to those skilled in the art and generally involves measuring the absorbance at 260 nm.

[0269] Thus, in one example, the method for quantifying the copy number of HIV DNA further comprises:

[0270] (iii) quantifying the mass of DNA per volume (w / v) in the sample by measuring the absorbance of the DNA in the sample relative to the standard;

[0271] (iv) calculating the number of cells per volume of DNA in the sample based on the DNA absorbance; and

[0272] (v) Calculate the HIV-R region DNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV DNA copy number to obtain the HIV-R region DNA copy number (copy number / cell) in the biological sample.

[0273] In another example, the method for quantifying the mass of DNA per volume in a sample optionally includes adding a DNA intercalating dye and measuring the fluorescence emitted by the dye. In one example, the DNA intercalating dye is selected from SyBr Green I, Syto-9, Syto-10-14, Syto-16, Syto-21, Syto-24, Syto-29, YoYo-1, YoYo-3, and ToTo-1.

[0274] In one example, the HIV is HIV-1 or HIV-2.

[0275] In another example, the HIV DNA copy number is expressed as the number of HIV-R region copies per 1,000,000 cells (10 6 ), i.e., copy number / 10 6 cells. In another example, the HIV DNA copy number is expressed as a value for any fixed number of cells, including but not limited to 1.5×10 6 , 2×10 6 , 2.5×10 6 or 3×10 6 cells.

[0276] In one example, the volume is expressed as μl. In another example, the mass is the amount of DNA quantified by absorbance at 260 nm. In another example, the mass is expressed as ng.

[0277] The methods described herein can be used to quantify the pVL of HIV-1 in a subject. Two methods are illustrated below that can be used to calculate the pVL of HIV-1 in a subject (expressed as copy number / 10 6 cells). These methods are considered illustrative and not restrictive.

[0278] Method 1 (based on actin standard)

[0279] 1. In a biological sample from which DNA has been extracted, quantify the number of HIV-1R region copies A (e.g., 42.5 copies per microliter of extracted DNA) by real-time PCR using an HIV-1 standard

[0280] 2. Also quantify the actin copy number by real-time PCR using the same DNA-extracted sample with an actin standard (e.g., 2,520,000 copies per microliter of extracted DNA)

[0281] 3. Then estimate the cell count by dividing the actin copy number by 200 (actin has 200 copies per cell) (e.g., the estimated cell count is 12,600 cells in the DNA extracted per microliter) B

[0282] 4. The copy number of the HIV-1R region per cell is calculated by dividing the value of A by the value of B (A / B) (e.g., the estimated copy number of HIV-1 per cell is 0.003373 copies / cell) C

[0283] 5. The copy number of the HIV-1R region per 10 6 cells is calculated as C × 1,000,000 (e.g., the estimated copy number of HIV-1 per 10 6 cells is 3373 copies / 10 6 cells).

[0284] The HIV-1 standard is a plasma standard (0, 4, 40, 4x10 2 、4x 10 3 、4x 10 4 、4x 10 5 and 4x 10 6 copies / μl) used to generate the standard curve. The actin standard is used at 0, 20, 2×10 2 、2×10 3 、2×10 4 、2×10 5 and 2×10 6 copies / μl.

[0285] Method 2 is based on absorbance

[0286] Another method by which the HIV-1 level can be measured is to use the absorbance at 260 nm to determine the DNA quality in a sample from which DNA has been extracted, as follows:

[0287] 1. In a biological sample from which DNA has been extracted, the copy number of the HIV-1R region is quantified by real-time PCR using the HIV-1 standard (e.g., 42.5 copies per microliter of DNA extracted) A.

[0288] 2. The DNA quality in the solution of DNA extracted from the patient sample is quantified by the absorbance at 260 nm (e.g., the DNA extracted is 111.8 ng / μl).

[0289] 3. Then estimate the cell number based on the absorbance of DNA. After extracting 150 cells, it is estimated that 1 ng of DNA can be obtained (for example, the estimated number of cells in the extracted DNA per microliter is 16,673 cells) B.

[0290] 4. The copy number of the HIV-1R region per cell is calculated by dividing the value of A by the value of B (A / B) (for example, the estimated copy number of HIV-1 per cell is 0.002535 copies / cell) C

[0291] 5. The copy number of the HIV-1R region per 10 6 cells is calculated as C × 1,000,000 (for example, the estimated copy number of HIV-1 per 10 6 cells is estimated to be 2535 copies / 10 6 cells).

[0292] Therefore, the HIV-1 DNA level measured by the above method provides the clinician with the HIV-1 DNA level in a fixed number of cells.

[0293] Method 3 is based on the use of DNA intercalating dyes

[0294] Another method that can measure the HIV-1 level is to use a DNA intercalating dye.

[0295] 1. In a biological sample from which DNA has been extracted, quantify the copy number of the HIV-1R region by real-time PCR using an HIV-1 standard (for example, the extracted DNA is 42.5 copies / μl) A

[0296] 2. Quantify the DNA mass in the DNA-extracted solution from the patient sample by the fluorescence emission level of the DNA intercalating dye (for example, the extracted DNA is 111.8 ng / μl)

[0297] 3. Then estimate the cell number based on the fluorescence emission of the dye intercalated into the DNA. After extracting 150 cells, it is estimated that 1 ng of DNA can be obtained (for example, the estimated number of cells in the extracted DNA per microliter is 16,673 cells) B

[0298] 4. Calculate the copy number of the HIV-1R region per cell by dividing the value of A by the value of B (A / B) (for example, the estimated copy number of HIV-1 per cell is 0.002535 copies / cell)

[0299] 5. The copy number of the HIV-1R region per 10 6 cells is calculated as C × 1,000,000 (for example, the estimated copy number of HIV-1 per 10 6 cells is estimated to be 2535 copies / 10 6cells). C

[0300] Thus, the HIV-1 DNA level measured by the above method provides the clinician with the HIV-1 DNA level in a fixed number of cells.

[0301] Quantification of HIV RNA

[0302] The present disclosure also provides a method for quantifying HIV RNA in a biological sample, and more specifically, reverse-transcribing HIV RNA (cDNA). Thus, the present disclosure also provides a method for quantifying the copy number of HIV RNA in a biological sample obtained from a subject having HIV or suspected of having an HIV infection, the method comprising:

[0303] (i) performing real-time PCR amplification on the reverse-transcribed HIV RNA (cDNA) in the sample using a forward primer and a reverse primer that hybridize to a sequence within the R region of the long terminal repeat (LTR) of HIV cDNA; and

[0304] (ii) quantifying the copy number of the HIV-R region per volume of RNA in the sample by reference to an HIV standard.

[0305] In such an instance, the method further comprises:

[0306] (iii) quantifying an endogenous housekeeping gene via quantitative PCR using a corresponding housekeeping standard to obtain the copy number of the endogenous gene, wherein the copy number of the endogenous gene is expressed as the copy number of the housekeeping gene per volume of RNA present in the sample;

[0307] (iv) dividing the obtained copy number by the copy number of the endogenous gene in the cells to obtain the number of cells per volume of RNA in the sample; and

[0308] (v) calculating the copy number of HIV-R region RNA per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV RNA copy number to obtain the HIV-R region RNA copy number (copy number / cell) in the biological sample.

[0309] In one instance, the method further comprises obtaining a biological sample from a subject and extracting RNA from the sample.

[0310] In one instance, the housekeeping standard is amplified by real-time PCR.

[0311] As used herein, the term "corresponding" means that the housekeeping standard is the same as the endogenous housekeeping gene.

[0312] In one instance, the HIV-R region is quantified by:

[0313] (i) Obtain an aliquot of a sample from which RNA has been extracted;

[0314] (ii) Contact the aliquot with a labeled hydrolytic oligonucleotide that binds within the sequence of the R region of the long terminal repeat (LTR) of reverse transcribed HIV RNA (cDNA);

[0315] (iii) Further contact the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region sequence of the reverse transcribed HIV RNA;

[0316] (iv) Amplify the R region sequence by quantitative PCR;

[0317] (v) Extrapolate the signal obtained from the labeled oligonucleotide to a standard curve obtained by corresponding amplification of a series of dilutions of an HIV standard to obtain the number of HIV-R region RNA copies per volume of RNA in the aliquot.

[0318] In one example, the endogenous housekeeping gene is quantified by:

[0319] (i) Obtain an aliquot of an RNA sample prepared from a biological sample;

[0320] (ii) Contact the housekeeping gene in the aliquot with a labeled oligonucleotide that binds to a sequence within the housekeeping gene;

[0321] (iii) Further contact the aliquot with reverse transcriptase and a forward primer and a reverse primer that hybridize to sequences upstream and downstream, respectively, of the sequence of the housekeeping gene to which the oligonucleotide binds;

[0322] (iv) Amplify the reverse transcribed housekeeping gene sequence using quantitative PCR; and

[0323] (v) Extrapolate the signal obtained from the labeled oligonucleotide to a standard curve obtained by a series of dilutions of a corresponding amplification standard to obtain the number of endogenous housekeeping gene DNA copies per volume in the aliquot.

[0324] In one example, the oligonucleotide is a hydrolytic oligonucleotide.

[0325] The method alternatively provides for quantifying the number of HIV RNA copies in a biological sample based on RNA absorbance. Accordingly, the present disclosure also provides a method for quantifying the number of HIV RNA copies in a biological sample from a subject having HIV or suspected of having an HIV infection, the method comprising:

[0326] (i) Detect the HIV-R region sequence;

[0327] (ii) By reference to an HIV standard, quantify the copy number of the HIV-R region of reverse transcribed RNA (cDNA) per volume in the sample by real-time PCR, where the copy number is expressed as the copy number of the HIV-R region per volume of RNA in the sample;

[0328] (iii) Quantify the mass of RNA per volume in the sample by measuring the absorbance of the RNA in the sample;

[0329] (iv) Calculate the number of cells per volume of RNA in the sample based on the RNA absorbance; and

[0330] (v) Calculate the copy number of HIV-R region RNA per cell by dividing the value obtained in (ii) by the value obtained in (iv) to obtain the copy number of HIV-R region RNA in the biological sample (copy number / cell).

[0331] In one instance, detecting the HIV-R region sequence is according to the methods described herein or methods known in the art.

[0332] In one instance, the mass is the amount of RNA quantified by absorbance at 260 nm. In another instance, the mass is expressed as ng.

[0333] In one instance, the housekeeping gene is GAPDH.

[0334] In one instance, the housekeeping RNA standard is a plasmid standard. In another instance, the RNA standard is GAPDH. In another instance, the RNA standard is serially diluted to provide 1, 20, 200, 2000, 20,000, 2x10 5 and 2x10 6 copies / μl.

[0335] In another instance, the number of cells is determined by dividing the GAPDH copy number by 6.35 (assuming 6.35 GAPDH RNA copies per cell). Those skilled in the art will understand that depending on the control RNA standard used, the value of 6.35 for GAPDH may need to be replaced with a different value corresponding to the copy number of the gene in the cell.

[0336] In another instance, the method for quantifying the HIV RNA copy number further includes:

[0337] (iii) Quantify the mass (w / v) of RNA per volume in the solution from which RNA has been extracted from the patient sample by measuring the fluorescence emission of an RNA intercalating dye.

[0338] (iv) calculating the number of cells per volume of RNA in the sample based on the fluorescence emission of the embedded dye; and

[0339] (v) calculating the number of HIV-R region RNA copies per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the number of HIV-R region RNA copies to obtain the number of HIV-R region RNA copies (copies / cell) in the biological sample.

[0340] In one instance, the RNA copy number is expressed as the number of HIV R region copies / 10 6 cells.

[0341] Detection of HIV transcription in latently infected reservoir cells

[0342] The methods described herein provide for the detection and quantification of lentiviral transcription in latently infected cells. This is achieved by determining the HIV-1 transcriptional activity normalized to the level of HIV-1 DNA.

[0343] The methods described above for calculating HIV-1 DNA can also be applied to calculate HIV-1 RNA. In this case, as shown in the examples, a GAPDH standard is used. Real-time PCR is used to amplify the RNA that has been reverse transcribed.

[0344] To obtain a value for the HIV transcriptional activity normalized to the level of HIV DNA, the HIV RNA level is divided by the HIV DNA level. This normalized HIV transcriptional activity (RNA copies of the HIV-R region divided by DNA copies of the HIV-R region) provides a measure of the transcriptional activity that is occurring to identify activated HIV-1 transcription. The advantage of this method is that we are able to obtain the HIV transcriptional activity without sorting or isolating the cells in the reservoir (i.e., CD4 + T cells and macrophages). This intracellular transcription assay is very useful for obtaining the efficacy of ART treatment, especially in patients with a plasma viral load below the detection level (e.g., 20 copies / mL). The inventors were able to obtain and identify the HIV-1 transcriptional activity in latently infected reservoir cells. In this way, the applicant is able to separate subjects receiving optimal ART from those receiving suboptimal ART.

[0345] Using this formula, subjects receiving ART treatment can be monitored over time. If the treatment is effective, the level of integrated HIV-1 DNA in the subject will decline during treatment. Additionally, if the subject receives optimal ART, the HIV-1 infection will not expand within the reservoir cells and thus the level of HIV-1 DNA integration will be reduced.

[0346] Thus, the ratio of HIV-1 RNA copies to HIV-1 DNA copies provides diagnostic data for clinicians, indicating the current HIV-1 transcriptional activity normalized by the HIV-1 DNA level at the time of sample collection. This gives a measure of how ART affects the population of potentially infected cells. Since the level of integrated HIV DNA can vary among patients, it is important to detect the precise HIV transcriptional activity normalized against the amount of HIV DNA.

[0347] Evaluation of the effectiveness of antiretroviral therapy

[0348] Without being bound by theory, the inventors have found that HIV DNA copies and normalized HIV RNA copies provide a more sensitive method for separating subjects receiving antiretroviral therapy (ART) from those receiving suboptimal / sub-effective ART. Simply measuring HIV RNA copies does not distinguish between subjects because the level of integrated HIV DNA can vary among patients due to the initial amount of HIV present in the patient when first infected or at a later stage of infection. When HIV RNA copies are normalized relative to HIV DNA copies, a statistically significant difference can be observed between subjects receiving optimal and suboptimal ART. By performing this method at multiple time points, the normalized HIV RNA copies can be monitored and compared to one or more previously determined values to evaluate whether a subject is receiving optimal ART. Thus, it is crucial to detect the precise HIV transcriptional activity normalized against HIV DNA.

[0349] Accordingly, the present disclosure also provides a method for evaluating the effectiveness of antiretroviral therapy (ART) administered to an HIV-positive subject, the method comprising:

[0350] (i) quantifying the number of DNA copies of the HIV-R region;

[0351] (ii) quantifying the number of RNA copies of the HIV-R region;

[0352] (iii) determining the normalized number of HIV RNA copies in a sample obtained from the subject by dividing the value obtained in step (i) by the value obtained in step (ii); and

[0353] (iv) comparing the normalized HIV RNA copy number value to one or more previous normalized values obtained from the same subject;

[0354] wherein a decrease in the normalized number of HIV RNA copies indicates that the subject is receiving optimal / effective ART.

[0355] In one instance, quantification of HIV-R region DNA or RNA is performed using methods described herein or known in the art.

[0356] In one instance, the method further includes obtaining a biological sample from a subject and preparing DNA and RNA from the sample.

[0357] In another instance, HIV-R region RNA is quantified by:

[0358] (i) obtaining an aliquot of an RNA sample prepared from a biological sample;

[0359] (ii) contacting the aliquot with a labeled hydrolyzable oligonucleotide that binds within the R region sequence of the long terminal repeat (LTR) of reverse transcribed RNA (cDNA);

[0360] (iii) further contacting the aliquot with reverse transcriptase and a forward primer and a reverse primer that hybridize to sequences within the reverse transcribed R region sequence upstream and downstream of the R region sequence to which the oligonucleotide binds;

[0361] (iv) amplifying the reverse transcribed R region (cDNA) sequence by quantitative real-time DNA PCR;

[0362] (v) extrapolating the signal obtained from the labeled oligonucleotide to a standard curve obtained by corresponding amplification of serial dilutions of an HIV standard to determine the number of HIV-R region RNA copies per volume of RNA in the first aliquot.

[0363] In one instance, the HIV standard in the method for quantifying HIV DNA and RNA is the same.

[0364] The method for quantification of RNA copies has been described previously. Preferably, the aliquots used for quantification of endogenous housekeeping genes and quantification of HIV-R region RNA (cDNA) are from the same RNA prepared from a biological sample. Preferably, quantification of HIV DNA and HIV RNA is performed in the same biological sample from which DNA and RNA are separately prepared / extracted.

[0365] In one instance, the HIV is HIV-1 or HIV-2.

[0366] When evaluating whether a subject is receiving optimal ART, a clinician may compare the ratio of HIV RNA normalized by the HIV DNA value to the ratio of one or more previous values obtained from the same subject. If the ratio decreases over time, this may indicate to the clinician that the subject is receiving optimal ART. However, if the ratio increases, then this may suggest to the clinician to adjust the dose or type of ART. If the subject is receiving combination therapy, this may also include replacing one component of the combination therapy.

[0367] In another instance, the method includes adjusting the dose or type of ART administered to the subject.

[0368] In another instance, it is determined at at least two time points of the normalized HIV RNA copy number ratio of the subject. In another instance, the ratio is determined at multiple time points during the subject's lifetime, including but not limited to three, four, five, six, eight, ten, twelve, fifteen, twenty, twenty-five, thirty, thirty-five, forty, etc. In another instance, the time period between at least two time points is days, weeks or months. In another instance, the time period between at least two time points is 1 week, 2 weeks, 1 month, 3 months, 4 months, 6 months, 8 months or 12 months.

[0369] In another instance, a decrease in the ratio greater than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 8%, 5%, 2% indicates that the subject is receiving optimal ART.

[0370] Antiretroviral treatment and monitoring of treatment response

[0371] HIV RNA (viral load) and CD4 T lymphocyte (CD4) cell count are two surrogate markers of antiretroviral therapy (ART) response and HIV disease progression, and these two markers have been used for decades to manage and monitor HIV infection.

[0372] Viral load is a marker of ART response. The pre-ART viral load level of a patient and the magnitude of the viral load decline after the start of ART provide predictive information about the probability of disease progression. The primary goal of ART is to achieve and maintain durable viral suppression. Therefore, the most important use of viral load is to monitor the treatment effect after the start of ART.

[0373] Measurement of CD4 count is particularly useful before the start of ART. CD4 cell count provides information on the overall immune function of HIV-infected patients. This measurement is crucial for determining the thresholds for starting and stopping opportunistic infection (OI) prophylaxis and for assessing the urgency of starting ART.

[0374] CD4 count monitoring

[0375] CD4 count is the most important laboratory indicator of immune function in HIV-infected patients. Based on the findings of clinical trials and cohort studies, it is also the strongest predictor of subsequent disease progression and survival. CD4 count is highly variable; a significant change (2 standard deviations) between two tests is approximately a 30% change in the absolute count, or a 3 percentage point increase or decrease in the CD4 percentage.

[0376] HIV infection is characterized by a very high viral turnover rate throughout the course of the disease, ultimately leading to CD4 depletion and disease progression. (Wei X, Ghosh S K, Taylor M E, et al. (1995) Nature 343, 117 - 122 and Ho D D, Naumann A U, Perelson A S, et al. (1995) Nature 373, 123 - 126). The aim of antiretroviral therapy is to achieve substantial and prolonged suppression of viral replication. Achieving sustained viral control may involve the use of sequential therapies, typically each consisting of a combination of three or more antiretroviral drugs. The main rationale for combination therapy involves synergistic or additive activity to achieve greater suppression of viral replication. However, drug therapy tolerance remains crucial as treatment needs to be continued for many years.

[0377] In an untreated patient, approximately 10 10 new virus particles are produced daily. Coupled with the failure of the HIV reverse transcriptase (RT) to correct transcription errors through exonucleolytic proofreading, this high level of viral turnover results in 10 4 to 10 5 mutations per day at each position in the HIV genome. The result is the rapid establishment of a wide range of genotypic variations.

[0378] The early development of antiretroviral therapy focused on reverse transcriptase inhibitors. Both nucleoside and non-nucleoside inhibitors of this enzyme have shown significant antiviral activity (DeClerq, E. (1992) AIDS Res. Hum. Retrovir. 8: 119 - 134). However, due to drug resistance, limited efficacy, and host cell factors, the clinical benefits of these drugs are limited (Richman, D. (1993) Ann. Rev. Pharm. Tox. 32: 149 - 164).

[0379] Recent treatments have focused on the use of protease inhibitors. These drugs include saquinavir developed by Hoffmann-La Roche, ritonavir developed by Abbott Laboratories, indinavir developed by Merck & Co., nelfinavir developed by Agouron Pharmaceuticals, and amprenavir developed by Vertex Laboratories. Other protease inhibitors include atazanavir, darunavir, fosamprenavir, and tipranavir.

[0380] Other types of drugs available for treatment include fusion inhibitors such as enfuvirtide, CCR5 co-receptor antagonists such as maraviroc, and HIV integrase strand transfer inhibitors such as isentress, tivicay, and vitekta.

[0381] Combination antiretroviral therapies of protease and reverse transcriptase inhibitors have demonstrated the potential efficacy of antiretroviral therapy for treating AIDS. Such combinations include atripla, complera, evotaz, prezcobix, and stribild.

[0382] Those skilled in the art will understand that many changes and / or alterations can be made to the above specific embodiments without departing from the broad general scope of the invention. Accordingly, the listed embodiments are to be considered in all respects as illustrative and not restrictive. The present disclosure includes the following non-limiting examples. Examples

[0383] Materials and methods

[0384] Design of primer and probe sequences

[0385] In Figure 1 the genomic structure of HIV-1 is shown. In Figure 2 the genomic structure of HIV-2 is shown. Primer sets were designed to target the same "R" region sequences located within the 5' LTR and 3' LTR of the HIV-1 or HIV-2 genome. The primer sets were designed according to the following criteria: (a) located in a conserved region of all HIV-1 and HIV-2 subtypes for reliable detection; (b) primer length between 18-25 bases long; (c) not forming primer dimers while maintaining sensitive detection. Forward primers were designed to provide good alignment at the 3' end of the primer for all HIV subtypes, and reverse primers were designed to provide good alignment at the 5' end of the primer for all HIV subtypes. The forward and reverse primers are shown in Table 1 below.

[0386] Table 1 Sequences of forward and reverse primers for PCR

[0387]

[0388] The probe is designed to bind to conserved regions in all HIV subtypes to ensure effective detection. Locked nucleic acid (LNA) modifications are used to allow for increased annealing temperature and the use of short TaqMan probes.

[0389] The sequences of the HIV-1 oligonucleotide probes are as follows:

[0390] 5’FAM-AGG LNA GA LNA AC LNA CCAC LNA TG LNA CTTA-BQH-13’ (SEQ ID NO:6), where FAM is a fluorescent reporter, BHQ1 is a quenching molecule, and N LNA represents a locked nucleic acid analogue, where N is the A, T, G, or C nucleobase shown.

[0391] The sequences of the HIV-2 oligonucleotide probe No.1 are as follows:

[0392] 5’FAM-GCCTGGGTGTTCCCTGCTAGACTCT-BQH-13’, where FAM is a fluorescent reporter, and BHQ1 is a quenching molecule.

[0393] The sequences of the HIV-2 oligonucleotide probe No.2 are as follows:

[0394] 5’FAM-CT LNA GC LNA TA LNA GT LNA G LNA CTGG LNA A-BQH-13’ (SEQ ID NO:40), where FAM is a fluorescent reporter, BHQ1 is a quenching molecule, and N LNA represents a locked nucleic acid analogue, where N is the A, T, G, or C nucleobase shown.

[0395] The sequences of the HIV-2 oligonucleotide probe No.3 are as follows:

[0396] 5’FAM TC LNA CA LNA GC LNA AC LNA TA LNA GC LNA AG-BQH-1 3’ (SEQ ID NO:44), where N LNA represents a locked nucleic acid analogue, where N is the A, T, G, or C nucleobase shown.

[0397] Figure 3-1 A and B of Figure 3-2 C and D of show an alignment of probes and PCR primers used in the HIV-R region sequences of HIV-1 and HIV-2. Figure 3-1 A of represents the alignment on HIV-1, and Figure 3-1 B of Figure 3-2 C and D of represent the alignment on HIV-2.

[0398] The alignment of the HIV-1 oligonucleotide probes of the HIV-1 subtypes is as Figure 4 shown.

[0399] The alignment of the oligonucleotide probes of the HIV-2 subtypes of the HIV-2 probes is as Figure 5 shown.

[0400] The sequence of the GAPDH probe is 5’FAM-AAGGTCGGAGTCAACGGATTTGGTCGT-BQH-1 3’ (SEQ ID NO:17), where FAM corresponds to the fluorescent reporter and BHQ1 is the quenching molecule.

[0401] The sequence of the β-actin probe is 5’FAM-ATGCCCTCCCCCATGCCATCCTGCG BHQ-1 3’ (SEQ ID NO:20).

[0402] Labeling of primers and probes

[0403] All primers were synthesized through standard commercial oligonucleotide DNA synthesis services. Biotinylated primers were used for end-point PCR detection. The biotin modification was performed at the 5’ end of the oligonucleotide DNA primers.

[0404] Cell lines and plasmid standards

[0405] The HIV-1 plasmid standard used herein was obtained from the genomic HIV-1 plasmid of pNL4-3 (NIH Cat No.114). The TA-cloned HIV-2 plasmid standard was generated through standard procedures. Initially, HUT78 cells were infected with the HIV-2 CBL-20 virus (NIH Cat No 600). Genomic DNA was isolated and then subjected to PCR amplification. T / A-cloned HIV-2 was obtained from this amplicon to generate a plasmid containing the HIV-2 R region. The HIV-2 plasmid copy number was determined using the 260 nm absorption spectrum and the molecular weight of each plasmid.

[0406] The HUT78 cells (CD4+ T cell line, Cat No. 89) and OM10.1 cells (HIV-1 latent cell line, Cat No. 1319) were also obtained from the NIH. The OM10.1 cell line contains a single copy of the HIV-1 genomic DNA in a single OM10.1 cell.

[0407] HIV subject data

[0408] Plasma viral load data of the subjects were obtained from the Diagnostic Laboratory of St Vincent’s Hospital. According to the manufacturer's instructions, data on the HIV status of the subjects were obtained using the Roche TaqMan HIV-1 assay. The subjects were adult subjects over 18 years old, and informed consent for the use of their blood samples was obtained.

[0409] Isolation and preparation of peripheral blood mononuclear cells (PBMCs)

[0410] Whole blood was obtained from the subjects using a standard blood collection protocol. Fresh blood no more than 4 days old was obtained from the HIV Diagnostic Laboratory of St Vincent’s Hospital.

[0411] Peripheral blood mononuclear cells (PBMCs) were isolated from whole blood using a conventional Ficoll gradient centrifugation method. Briefly, blood was collected in 9 mL acid citrate dextrose anticoagulant (ACD) tubes and 9 mL phosphate-buffered saline (PBS) was added. After inverting to mix, 15 mL of Ficoll-plaque medium was added and centrifuged at 400 g for 40 minutes at 18 - 20 °C. The upper layer containing plasma and platelets was discarded and the mononuclear cell layer was transferred to a clean tube. 30 mL of PBS was added, mixed and centrifuged at 400 g for 15 minutes at 18 - 20 °C. The supernatant was removed, and the mononuclear cells were washed in 10 mL of PBS and centrifuged at 400 g for 10 minutes at 18 - 20 °C. The supernatant was removed and the mononuclear cells were retained for future analysis.

[0412] Isolation and preparation of whole blood

[0413] For whole blood experiments, 4 mL of red blood cell lysis buffer (from Roche) was added to a 15 mL Falcon tube. The whole blood collection tube was inverted 10 times and then 2 mL of whole blood was added to the 15 mL Falcon tube containing 4 mL of lysis buffer. The tube was incubated on a rotating platform at room temperature (RT) with slow rotation for 10 minutes. Then the tube was centrifuged at 500 x g for 5 minutes at room temperature using a tabletop centrifuge. After centrifugation, the supernatant was poured into a waste bottle. The cells were resuspended in 1800 μl of PBS. Two equal aliquots of 900 μl of cell suspension were made in two O-ring tubes.

[0414] Then centrifuge the tubes at 7800 x g (9000 rpm) for 3 minutes at room temperature using a microcentrifuge. Use a P1000 pipette to remove the supernatant without disturbing the leukocyte pellet.

[0415] Two cell pellet tubes were prepared from each patient. One tube was used for DNA extraction and the other for RNA extraction.

[0416] The concentration of DNA extracted from the samples was measured by absorbance at 260 nm (A 260 ) and the nucleic acid concentration was determined from the absorbance of the nucleic acid preparation using the average extinction coefficient of double-stranded (ds) DNA (1 A 260 = 50 μg / ml).

[0417] Preparation of PBMCs

[0418] PBMC were obtained from whole blood by Ficol-Paque separation method. The patient's blood was collected in 9 mL ACD (acid citrate dextrose, anticoagulant) tubes. Transfer 9 mL of blood to a 50 mL Falcon tube and add 9 mL of PBS. Invert the tube several times to mix the blood and buffer. Slowly add 15 mL of Ficoll-Paque medium to the bottom of the 50 mL Falcon tube without disturbing the interface between the Ficoll-Paque medium and the blood phase. Centrifuge the tube at 400 g for 40 minutes at 18 °C to 20 °C (turn off the brake of the centrifuge). Aspirate the upper layer from the plasma and platelets using a sterile pipette, leaving the monocyte layer undisturbed at the interface. Then transfer the monocyte layer to a 50 mL Falcon tube. Add 30 mL of PBS to the cells and mix by inverting the tube several times. Centrifuge the tube at 400 g for 15 minutes at 18 °C to 20 °C (turn on the brake). Remove the supernatant. Resuspend the monocytes in 10 ml of PBS. Centrifuge at 400 x g for 10 minutes at 18 °C to 20 °C. Then remove the supernatant.

[0419] Purification of leukocyte subtypes

[0420] To purify RO+R5+, RO+R5- and RO-R5- cell populations, PBMC cells were sorted based on surface markers on PBMC using a FACS Aria cell sorter (BD Biosciences).

[0421] The PBMC (approx. 2 x 10 6The cells were incubated with anti-CD4 monoclonal antibody (PerCP; Becton Dickinson), anti-CD3 monoclonal antibody (APC; Becton Dickinson), anti-CCR5 monoclonal antibody (clone 2D7, FITC-conjugated; PharMingen), and anti-CD45RO monoclonal antibody (PE; PharMingen). The cells were incubated with the markers at room temperature for 30 min. Then the tubes were centrifuged at 400 g for 5 min, and the cells were resuspended in 1 mL PBS with 10% FCS. This was repeated twice, and the cells were resuspended in 1 mL PBS with 10% FCS. The cells were sorted using an "Aria cell sorter" to obtain the following three T cell subsets

[0422] CD3+CD4+CD45RO+ccr5+

[0423] CD3+CD4+CD45RO+ccr5-

[0424] CD3+CD4+CD45RO-ccr5-.

[0425] Magnetic-labeled particles were used according to the manufacturer's instructions to isolate PBMCs with CD14.

[0426] DNA extraction

[0427] Genomic DNA was extracted using the QIAamp DNA mini kit (Qiagen) according to the manufacturer's instructions.

[0428] Briefly, 200 μl of AL buffer (provided in the kit) was added to the cell pellet, and the tube was vortexed until the pellet dissolved. A proteinase-K master mix was prepared.

[0429] 200 μl of PBS × number of tubes

[0430] 20 μl of proteinase K × number of tubes

[0431] 220 μl of proteinase-K master mix was added, and the tube was vortexed. The DNA was digested at 56 °C for 10 min, and then briefly vortexed every 2 - 3 min. Then the tube was briefly centrifuged, 200 μl of EtOH was added, followed by vortexing for 15 s. Then the tube was briefly centrifuged, and all the lysed solution was added to the QIAamp DNA Minicolumn and centrifuged at 6 at room temperature ,Centrifuge at 000xg for 1 minute. The upper part of the QIAamp column is transferred to a new liquid collection tube (provided in the kit). The used lower part of the collection tube is discarded as waste. Add 500 μl of AW1 buffer (provided in the kit) and centrifuge at 6,000xg for 1 minute at room temperature. The upper part of the QIAamp column is transferred to a new liquid collection tube (provided in the kit). The used lower part of the collection tube is discarded as waste. Add 500 μl of AW2 buffer and centrifuge at 13 , 000xg for 3 minutes.

[0432] Empty the liquid in the collection tube and centrifuge for an additional 1 minute at 13 , 000xg at room temperature. Remove the upper column and place it in a 1.5 mL ampule. Add 60 μl of AE buffer (provided in the kit) and hold at room temperature for 1 minute, then hold at room temperature in a centrifuge at 6 , 000xg for 1 minute. The upper part of the used collection tube is discarded and the lower part of the centrifuge tube is stored at 4°C.

[0433] RNA extraction

[0434] According to the manufacturer's instructions, use ReLiaprep TM RNA cell system (Promega) to extract total RNA from blood samples.

[0435] Briefly, add 250 μl of Bl+TG buffer (provided in the kit) to each cell pellet. The tube is vortexed until the pellet dissolves. Add 85 μl of isopropanol and vortex the tube. Transfer the lysed solution to a ReliaPrep Minicolumn (provided in the kit) and centrifuge at 14,000xg for 1 minute at room temperature. The liquid from the collection tube is emptied as waste.

[0436] Prepare the DNA-1 master mix in a new tube to obtain the volume required for all tubes.

[0437] 24 μl Yellow Core buffer x number of tubes

[0438] 3 μl 0.09 M MnCl 2 x number of tubes

[0439] 3 μl DNase I enzyme. Mix this tube well for x number of tubes

[0440] Add 30 ul of DNA-1 master mix to the filter of the ReliaPrep Minicolumn and incubate at room temperature for 15 minutes. Add 200 μl of Column Wash Solution (provided in the kit) and centrifuge at 14,000 x g for 1 minute at room temperature. Add 500 μl of RNA Wash Solution (with ethanol added) and centrifuge at 14,000 x g for 1 minute at room temperature. The ReliaPrep TM Minicolumn is placed in a new collection tube and 300 μl of RNA Wash Solution (provided in the kit) is added. The tube is centrifuged at maximum speed for 2 minutes at room temperature and then transferred to a 1.5 mL ampule. Add 60 μl of nuclease-free water and keep the tube at room temperature for 1 minute, then centrifuge at 13,000 x g for 1 minute at room temperature in a centrifuge. The upper part of the used collection tube is discarded and the lower part of the centrifuge tube is stored at 4 °C.

[0441] All DNA and RNA samples are analyzed using a spectrophotometer to confirm the quality using Qubit Fluorometric Quantitation (ThermoFisher).

[0442] Real-time DNA amplification assay

[0443] Figure 6 A and B schematically show the real-time PCR method used in the present disclosure using a set of PCR primers and TaqMan TM probe. For DNA analysis, two sets of real-time PCR are performed using the SensiFAST Probe No-ROX One-step kit (BIO76005). Each reaction mixture with a final volume of 40 μl contains: 2×PCR buffer, 20 μM forward primer, 20 μM reverse primer, 6 μl of DNA, 5 μM Taqman probe, and PCR-grade water. The cycling and denaturation conditions are as follows: using LightCycle480 (Roche), 94 °C for 30 seconds, followed by 50 cycles of: 95 °C for 7 seconds, and 60 °C for 30 seconds. The HIV-1 DNA standard is serially diluted to provide 0, 40, 400, 4000, 40000, 4×10 5 and 4×10 6 copies / μl.

[0444] For β-actin analysis, the reaction mixture in a final volume of 40 μl contained: 2×PCR buffer, 20 μM forward primer, 20 μM reverse primer, 6 μl DNA, 5 μM Taqman probe, and PCR-grade water. The cycling and melting conditions were as follows: using LightCycle 480 (Roche), 94 °C for 30 s, followed by 50 cycles of: 95 °C for 7 s, and 60 °C for 30 s. The β-actin standard was serially diluted to provide 0, 20, 200, 2000, 20000, 2×10 5 and 2×10 6 copies / μl. The β-actin standard was a plasmid containing a single-copy β-actin gene. The β-actin plasmid standard was prepared by TA cloning using PCR-amplified β-actin DNA and standard cloning methods. The β-actin primer and probe sequences were as described above.

[0445] The HIV-1 cloning plasmid was obtained from NIH, and a single plasmid contained a single copy of the HIV-1 genome.

[0446] Real-time RNA amplification assay

[0447] For RNA analysis, two sets of real-time PCR were performed using the SensiFAST Probe No-ROX One-step kit (BIO76005). For RNA analysis, the reaction mixture in a final volume of 40 μl contained: 2×PCR buffer, 20 μM forward primer, 20 μM reverse primer, 6 μl RNA, 5 μM Taqman probe, 0.45 μl reverse transcriptase, 0.8 μl RNase inhibitor, and PCR-grade water. The cycling and melting conditions were as follows: using LightCycle 480 (Roche), 45 °C for 20 min, 94 °C for 2 min, followed by 50 cycles of: 95 °C for 7 s, and 60 °C for 30 s. Unless otherwise stated, each PCR amplification was repeated three times.

[0448] For glyceraldehyde 3-phosphate dehydrogenase (GAPDH) analysis, the reaction mixture in a final volume of 40 μl contained: 2×PCR buffer, 20 μM forward primer, 20 μM reverse primer, 6 μl RNA, 5 μM Taqman probe, 0.45 μl reverse transcriptase, 0.8 μl RNase inhibitor, and PCR-grade water. The cycling and melting conditions were as follows: using LightCycle 480 (Roche), 45 °C for 20 min, 94 °C for 2 min, followed by 50 cycles of: 95 °C for 7 s, and 60 °C for 30 s.

[0449] The GAPDH standard was serially diluted to provide 0, 20, 200, 2,000, 20,000, 2×10 5 and 2×10 6 copies / μl. The GAPDH standard is a plasmid containing a single copy of the GAPDH gene. The GAPDH plasmid control was achieved by TA cloning of PCR-amplified GAPDH DNA by standard cloning methods.

[0450] The GAPDH primer and probe sequences are as described above.

[0451] Endpoint PCR assay

[0452] The inventors developed an end-point PCR assay, herein referred to as the Streptavidin (SA)-plate end-point assay. Figure 6 B schematically shows the assay, and it is performed using biotin-labeled primers. After PCR, the PCR product is hybridized to a probe labeled with digoxin (Dig). The newly hybridized product is captured on the surface of a streptavidin-coated 96-well plate. After washing away the unbound Dig probe, a peroxidase (POD)-labeled anti-Dig antibody is added, followed by a chemiluminescent reaction. The light emitted is then detected by a luminometer plate reader.

[0453] All PCR reactions were carried out in the same manner as the TaqMan-based real-time PCR method (see "Real-time Assays for DNA Amplification" and "Real-time Assays for RNA Amplification" above), except for the following two conditions: i) no TaqMan probe was used and it was replaced by water in the reaction; and ii) one of the primers in a set of primers was biotinylated at the 5'-end of the oligonucleotide DNA. After PCR was completed, 10 μl of the PCR amplicon was transferred to a PCR tube containing 40 μl of hybridization buffer, which had 20 pmol of the Dig-labeled probe and 3.85× SSC buffer (e.g., 20× SSC contains 3.0 M NaCl and 0.3 M sodium citrate pH 7.0). To hybridize the PCR amplicon and the Dig-labeled probe, the temperature of the solution in the PCR tube was raised to 95 °C for 2 minutes, then to 40 °C for 2 minutes, and then to 4 °C. The hybridization product with a total volume of 50 μl was transferred to a streptavidin-coated 96-well plate, which contained 50 μl of dilution buffer, which had 10 mM Tris-HCl pH 7.6, 150 mM NaCl, 1 mM EDTA, and 0.0002% Tween20. The 96-well plate was incubated at 37 °C for 30 minutes. The hybridization product of the biotinylated PCR amplicon and the Dig probe bound to the streptavidin plate during the incubation. Unbound products were washed off the plate during 3× washing with wash buffer (10 mM Tris-HCl pH 7.5, 0.15 M NaCl, 1 mM EDTA, 0.01% Tween20). Subsequently, 100 μl of peroxidase-conjugated anti-Dig antibody (1 / 5000 dilution) was added, using a dilution buffer of 5% BSA, 10 mM Tris-HCl pH 7.5, 0.15 M NaCl. Then the 96-well plate was incubated at 37 °C for 30 minutes, followed by 6× washing with wash buffer. Then 100 μl of chemiluminescent peroxidase substrate (CPS260, Sigma) was added. Then the plate was incubated at room temperature for 5 minutes. The light generated from the substrate was detected with a luminometer plate reader to obtain relative light units (RLU). The gain (adjusted value) of the luminometer plate reader was 1200.

[0454] Example 1 HIV-1 RNA copy number (pVL) normalized by HIV-1 DNA copy number

[0455] As detailed above, samples were obtained from forty-seven (47) HIV-1 subjects who were on ART, and DNA and RNA were extracted from whole blood cell lysates. At the time of collection, the plasma viral load (pVL) of all patients was suppressed and was >20 copies / mL( Figure 7 ).

[0456] Based on plasma viral load over the past six months, HIV-1 patients were assigned to receive "optimal ART" or "suboptimal ART". Patients with a pVL < 20 copies / mL over the past six months were considered to be on "optimal ART", while patients with occasional elevations in pVL over the past six months (i.e., > 20 to < 200 copies / mL; referred to as blips (BL)) were designated to receive "suboptimal ART".

[0457] Quantification of HIV-1 RNA and DNA based on amplification of the HIV-1 R region sequences was performed by real-time PCR analysis as described in the above protocol, using β-actin standards for DNA quantification and GAPDH standards for RNA quantification. Forty-seven samples obtained from the SVH Diagnostic Laboratory were analyzed.

[0458] At the time of collection, the RNA plasma viral load (pVL) of these 47 samples was completely suppressed (< 20 copies number / mL). As Figure 7 can be seen, there was no difference between optimal and suboptimal ART subjects using the standard pVL assay.

[0459] As Figure 8 shown, when the HIV-1 RNA copy number was normalized against the HIV-1 DNA copy number, this assay could distinguish between subjects on optimal ART and those on suboptimal ART due to a statistically significant difference in intracellular viral activity (p = 0.0016) found between "optimal ART" (n = 29) and "suboptimal ART" (n = 18) subjects ( Figure 8 A). Subjects who had previously experienced blips (BL) in viral load, i.e., at least one episode of transiently high HIV-1 DNA levels, and four subjects with immune failure (IF) were identified as having significantly higher mean ratios of normalized HIV-1 RNA in the suboptimal ART category ( Figure 8 B). Subjects with pVL suppressed for more than six months had lower mean ratios of normalized HIV-1 RNA.

[0460] Thus, although the pVL RNA assay showed no difference between the two groups of subjects, the inventors' assay was able to distinguish between subjects on optimal or suboptimal ART based on normalization.

[0461] As Figure 8 shown in C, according to the inventors' assay, another category was found among subjects with < 800 HIV-1 DNA per 10 6 cells of HIV-1 DNA, named "improved optimal ART", which was statistically significant (p = 0.012) compared to the rest of the optimal ART group.

[0462] This data indicates that primers located in the 5' and 3' LTR R regions can be used to detect HIV activity in latent infection reservoirs, and determining intracellular HIV-1 copy number as shown herein provides a more sensitive indicator of treatment response than standard pVL. Additionally, as the RNA transcription level is normalized against the integrated DNA level, an increase in intracellular HIV load indicates that the latent viral reservoir is transcriptionally activated.

[0463] The results also show that both a low ratio of normalized HIV-1 RNA (i.e., low transcriptional activity) and a low ratio of low HIV-1 DNA in the subjects indicate improved optimal ART. Thus, clinicians may refer to these two measurements, namely the ratio of normalized HIV-1 RNA (less than 0.05) and the HIV-1 DNA copy number less than 800 HIV-1 DNA per 10 6 cells, when determining whether a subject is receiving appropriate (i.e., optimal) ART.

[0464] Example 3 Evaluation of HIV-1 R region DNA detection

[0465] This study evaluated two subjects (A and B in Table 3) known to be infected with HIV-1. HIV-1-infected peripheral blood mononuclear cells (PBMCs) from the subjects were sorted by flow cytometry based on the expression of the markers CD3+, CD4+, CD45RO+, CD45RO-, and CCR5+. PBMCs have previously been shown to contain an enriched population of infected cells.

[0466] Briefly, according to the manufacturer's instructions, PBMCs were sorted using a FACS ARIA cell sorter (BD Biosciences) based on cell surface markers. Briefly, 2x10 6 cells were incubated with monoclonal antibodies against CD4 (PerCP, Becton Dickinson), CD3 (APC, Becton Dickinson), CCR5 (clone 2D7, FITC-conjugated; PharMingen), and CD45 RO (PE; PharMingen). CD45 RO+ cells generally distinguish memory T cells, while CD45 RO- cells generally distinguish naive T cells. CD3 is a pan-T cell marker used to separate T cells and non-T cells. CD4 is typically found on T helper cells, monocytes, macrophages, and dendritic cells. CCR5 is a chemokine receptor found on white blood cells and is commonly used by HIV to infect white blood cells.

[0467] The cells were incubated at room temperature for 30 minutes and centrifuged at 400 g for 5 minutes. The cells were washed three times in 1 mL PBS / 10% FCS. The washed cells were sorted to isolate the following T cell subsets:

[0468] · CD3+CD4+CD45 RO+CCR5+

[0469] · CD3+CD4+CD45 RO+CCR5-

[0470] · CD3+CD4+CD45 RO-CCR5-

[0471] Samples were analyzed using primer sets targeting three different intracellular locations within the HIV-1 DNA:

[0472] (1) 5’ and 3’ LTR R regions,

[0473] (2) 3’ LTR region

[0474] (3) gag region.

[0475] The 5’ and 3’ LTR R region primers were as described previously herein.

[0476] The 3’ LTR amplification forward and reverse primers were 5′-CCAAAGAAGACAAGATATCCTTGA-3′ (SEQ ID NO:23) and 5′-TTGAGGCTTAAGCAGTGG-3′ (SEQ ID NO:24), respectively. The sequence of the oligonucleotide probe was 5′-FAM-TTAGACCAGATCTGAGCCTGGGAGCTCTC-BHQ1 -3′ (SEQ ID NO:25), where FAM is a fluorescent labeling dye and BQ1 is a quencher for that fluorescent dye. This primer set amplifies a region spanning the U3 and R regions of the 3’ LTR.

[0477] The gag forward and reverse primers were 5’AGTGGGGGGACATCAAGCAGCCATGCAAAT 3’ (SEQ ID NO:26) and 5’TACTAGTAGTTCCTGCTATGTCACTTCC 3’ (SEQ ID NO:27), respectively. The sequence of the oligonucleotide probe was 5′-FAM-ATC LNA A LNA ATG LNA AGGAAG LNA CTG LNA C-BHQ1-3′ (SEQ ID NO:28), where FAM corresponds to the fluorescent reporter and BHQ1 is the quenching molecule. Locked nucleic acid is composed of N LNAwhere N is an A, T, G, or C nucleobase of the representation.

[0478] The results are shown in Table 3 below. R region primers detected intracellular HIV-1 DNA in unsorted samples from two subjects. After cell sorting, in Subject A, HIV-1 DNA detection using 3’LTR and gag primers was variable, while in Subject B, neither primer set detected HIV-1 DNA. In contrast, R region primers detected HIV-1 DNA in all samples from Subject A and at low levels in CD3+CD4+CD45RO-CCR5- in Subject B.

[0479] These results indicate that detection of HIV-1 DNA using primers targeting the R region is more sensitive compared to detection based on non-R region amplification.

[0480] Table 3: Evaluation of HIV-1 R Region DNA Detection

[0481]

[0482] Example 4: Evaluation of the sensitivity of HIV-1 R region RNA detection

[0483] To evaluate HIV-1 RNA in patient samples, eight (8) subjects known to be HIV-1 positive were selected and analyzed using primer sets targeting three different intracellular locations: (1) the 5’ and 3’ LTR R regions, (2) the 3’ LTR region, and (3) the gag region, similar to the HIV-1 DNA analysis in Example 3.

[0484] As previously described, primers for the 5’ and 3’ LTR R regions, the 3’ LTR region, and the gag region were used.

[0485] Contrary to Example 3 above, cells isolated from whole blood were analyzed as previously described. RNA extraction and PCR amplification were performed as previously described.

[0486] As shown in Table 4 below, primers located in the R regions of the 5’ and 3’ LTR were able to detect intracellular HIV transcripts in all 8 subjects, while primers located in the 3’ LTR and gag regions detected HIV loads in only 4 and 3 subjects, respectively.

[0487] This data indicates that primers located in the R regions of the 5’ and 3’ LTR are more sensitive for detection of intracellular DNA copy number when compared to primers located in the 3’ LTR and gag regions. Although the VL of these subjects was below the detection level, consistent detection of intracellular HIV-1 transcriptional activity based on the R region was detected.

[0488] Table 4: Evaluation of HIV-1 R Region RNA Detection

[0489]

[0490] Example 5: Intracellular HIV load indicates persistent HIV transcriptional activity and contributes to plasma viral load rebound

[0491] To investigate whether low but persistent intracellular HIV load levels indicate HIV transcriptional activity, subjects were sampled during antiretroviral therapy (ART) and structured treatment interruption (STI) (i.e., without ART).

[0492] During ART, subjects' plasma viral load and viral RNA were analyzed every 12 weeks. After treatment was stopped, subjects were sampled up to every 16 weeks. Intracellular transcriptional activity was detected using the R region assay as described previously.

[0493] Four treatment-naive patients received ART for one year. During the 24-week treatment period ( Figure 9 A, B, and D) and during the 12-week treatment period ( Figure 9 C), plasma viral load (pVL, circle lines) levels in four patients were below the limit of detection. The pVL levels remained below the detection level until week 52 (one year) of ART. Although pVL was undetectable in these four patients, low levels of intracellular HIV-1 transcriptional activity (gray columns) were detected. After treatment was stopped, VL in the 4 patients increased rapidly, and accompanying the increase in VL was an increase in intracellular HIV-1 transcriptional activity.

[0494] The ART treatment period is shown in the gray horizontal bar, and the narrow treatment interruption (STI: stopping ART) periods are shown in the white horizontal bars ( Figure 9 ).

[0495] Figure 9 The subjects in Figure 10 entered the second phase of ART ( Figure 10 ). During the second phase of ART, VL was suppressed below the detection level. However, even with VL below the detection level, consistent detection of intracellular HIV-1 transcriptional activity (gray columns) was detected. After stopping the second phase of ART, a rapid rebound in VL was observed in two subjects ( Figure 10 A and B).

[0496] To study whether the increase in transcriptional activity originated from cells in the latent infection reservoir, intracellular RNA at baseline (before ART) and 2 weeks after stopping ART (gray circles on the horizontal axis), and rebound HIV-1 plasma RNA at 16 weeks after ART (represented by the upper gray circle) were collected and analyzed by Sanger sequencing.

[0497] Analyze the data on the web-based HIV database (http: / / www.hiv.lanl.gov / content / sequence / HIV / HIVTools.html) using the neighbor-joining clustering method. Samples isolated from the same subject are clustered together (gray rectangular boxes), indicating that the potential viral reservoir has persistent HIV transcriptional activity, which prompts the rebound of plasma viral load ( Figure 11 ).

[0498] Example 7 Evaluation of HIV-2 transcription

[0499] Two plasma samples containing HIV-2 RNA were analyzed. An automated extractor (NucliSENSE easyMAG system, BioMedirux) was used to extract RNA from plasma for the analysis of HIV-2 RNA. The results are shown in Figure 12 .

[0500] The assay detected 2.4 copies / ml of HIV-2 RNA in Patient B and 0.1 copy / ml of HIV-2 RNA in Patient A.

[0501] Example 7 Evaluation of HIV-2 transcription

[0502] The same strategy used for HIV-1 transcriptional analysis was applied to HIV-2 transcriptional analysis. Single subject samples were available. The method for HIV-2 analysis was as described previously herein.

[0503] The results are shown in Figure 13 . The HIV-2 plasma viral load of the subject was below the detection level. However, when intracellular HIV-2 RNA transcripts were detected and the RNA copy number was normalized against the HIV-2 DNA copy number, a relatively high level of intracellular HIV-2 RNA was observed.

[0504] Example 8 Comparison of the sensitivity of PCR assays for HIV-1 DNA detection

[0505] The inventors developed two different forms of PCR assays for detecting HIV-1 DNA, which are compared below.

[0506] As described in the method and Table 1 (SEQ ID NO:6), a real-time PCR assay was performed on DNA extracted from PBMCs using HIV-1 forward and reverse primers and a Taqman probe. An end-point assay was performed using a biotin-labeled HIV-1 forward primer, an unlabeled reverse primer, and a digoxigenin-labeled probe (SEQ ID NO:45). The probe sequence used for the end-point assay is a shorter version of the same probe used for real-time PCR.

[0507] The samples for PCR analysis are as follows:

[0508] Digoxigenin probe: Dig / -TTTTTTTTTTTTTTTGGAACCCACTGCTTA (SEQ ID.NO:45)

[0509] HIV-1 plasmid standards: 0, 4, 40, 400, 4,000, 40,000 copies of HIV-1 plasmid

[0510] HUT-78 and OM10.1 mixed samples: 0, 4, 40, 400, 4000, 40,000 HIV-1 cells / million (1×10 6 uninfected cells)

[0511] HUT-78 cells are a CD4+ T cell line (uninfected with HIV-1). OM10.1 cells are a CD4+ HIV-1 latently infected cell line, where each cell contains an integrated HIV-1 provirus. To prepare the "HIV-1 spiked" samples, HUT-78 and OM10.1 cells were mixed together such that 0, 4, 40, 400, 4000, 40,000 OM10.1 cells were mixed with 1×10 6 HUT-78 cells. This was designed to mimic actual HIV-1-infected clinical samples from subjects.

[0512] Serial dilutions of the plasmid standards were prepared as described above and 8 μl of the standards were used in a 50 μl PCR reaction.

[0513] For the control HIV-1 plasmid standards, real-time PCR analysis and end-point PCR analysis were performed on DNA extracted from the HUT-78 / OM10.1 cell mixture using 50 PCR cycles. The results are shown in Table 5 below. 10 μl of the PCR product was used for end-point determination analysis.

[0514] Table 5: Comparison of real-time PCR and end-point PCR assays

[0515]

[0516] The results shown are the average of two replicate assays.

[0517] Using real-time PCR, HIV-1 plasmid standards from 4 to 40,000 copies were detected using the generated linear standard curve (not shown). As shown in Table 5, the minimum detection limit of the HUT-78 / OM10.1 cell mixture was 40 OM10.1 cells in 1×10 6 HUT-78 cells.

[0518] Using end - point PCR with 40 cycles, HIV - 1 plasmid standards between 4 and 40,000 copies were clearly detected. As shown in Table 5, the minimum detection limit of the HUT - 78 / OM10.1 cell mixture was 4 OM10.1 cells in 1×10 6 HUT - 78 cells. A luminescence reading > 1,000 RLU was considered a positive detection.

[0519] The results showed that both PCR assays provided very sensitive HIV - 1 detection.

[0520] Example 9 Comparison of the specificity of PCR assays

[0521] The detection of HIV - 2 DNA was measured using HIV - 2 plasmid standards, and the results were compared with HIV - 1 plasmid standards to show specificity. HIV - 1 and HIV - 2 plasmid standards containing 0, 4, 40, 400, 4000, and 40,000 copies were assayed by both real - time PCR and end - point PCR, amplified with 50 PCR cycles.

[0522] For real - time PCR, HIV - 1 DNA was amplified with a forward primer (SEQ ID NO:7) and a reverse primer (SEQ ID NO:9). The amplicon was probed with a Taqman probe (SEQ ID NO:6), and the copy number was determined.

[0523] As shown in Table 6 below, the HIV - 1 probe was able to detect 4 to 40,000 copies of HIV - 1 DNA and was specific for HIV - 1 because only HIV - 1 DNA was amplified. In addition, HIV - 2 DNA was amplified with a forward primer (SEQ ID NO:35) and a reverse primer (SEQ ID NO:36). As shown in Table 6, the HIV - 2 Taqman probe (SEQ ID NO:44) was able to detect 4 to 40,000 copies of HIV - 2 and was specific for HIV - 2 because no HIV - 1 amplicon was detected with the HIV - 2 probe.

[0524] Table 6 Real - time assays of HIV - 1 and HIV - 2 standards

[0525]

[0526] For end - point PCR, HIV - 1 DNA was amplified with a biotin - labeled forward primer (SEQ ID NO:7) and an unlabeled reverse primer (SEQ ID NO:9). The amplicon was probed with an HIV - 1 probe (SEQ ID NO:45) labeled with digoxin (Dig). The results are shown in Table 7 below.

[0527] HIV-2 DNA was amplified using an unlabeled forward primer (SEQ ID NO: 35) and a biotin-labeled reverse primer (SEQ ID NO: 36). The amplicons were detected using an HIV-2 probe labeled with digoxigenin (Dig) (SEQ ID NO: 49).

[0528] Dig HIV-1: Dig / -TTTTTTTTTTTTTTTGGAACCCACTGCTTA (SEQ ID NO: 45)

[0529] Dig HIV-2: Dig / -TTTTTTTTTTTTTTTCCAGCAGTAGCAGGT (SEQ ID NO: 49)

[0530] As shown in Table 7, the HIV-1 probe was able to detect 4 to 40,000 copies of HIV-1 and was specific for HIV-1. The HIV-2 probe was also able to detect 4 to 40,000 copies of HIV-2 and was specific for HIV-2.

[0531] Table 7 Endpoint PCR assays of HIV-1 and HIV-2 standards

[0532]

[0533] The results shown are the average of two replicate assays.

[0534] These results indicate that both real-time PCR and endpoint PCR assays provide specific detection of HIV-1 or HIV-2 without cross-reactivity.

[0535] Example 10 Comparison of real-time and endpoint PCR assays for CD14+ isolated cells

[0536] The assay described in Example 8 was repeated. However, in the experiment, the HIV-1 plasma standard was further diluted to provide 0.2 copies / μl and 0.4 copies / μl. The number of PCR cycles for endpoint PCR was also reduced from 50 to 40.

[0537] Blood samples were obtained from HIV-1-infected subjects, and their white blood cells were separated into CD14-positive (CD14+) and CD14-negative (CD14-) cells. CD14+ cells constitute approximately one-third of the white blood cells and are mainly a monocyte population. These cells differentiate into macrophages in the peripheral blood and into microglia in the brain. CD14- cells constitute approximately two-thirds of the white blood cells and contain CD4+ T cells.

[0538] Six milliliters of blood samples were obtained from the subjects for the separation into CD14+ and CD14- cell populations. The subjects were divided into two categories, subjects with successful antiviral treatment and subjects with treatment failure. Subjects with successful treatment were defined as those with HIV-1 plasma levels controlled by antiretroviral therapy (ART). Their HIV-1 viral load was below the detection level for two consecutive years. Subjects with treatment failure were defined as those with detectable HIV-1 plasma viral load (i.e., 20 - 400 copies / ml in plasma) within 2 years.

[0539] HIV-1 DNA was amplified by end-point PCR for 40 cycles using a forward primer (SEQ ID NO:7) and a reverse primer (SEQ ID NO:9). HIV-1 DNA was amplified by real-time PCR for 50 cycles using a forward primer (SEQ ID NO:7) and a reverse primer (SEQ ID NO:9).

[0540] Serial dilutions of plasmid standards were prepared as described above, and 8 μl of the standards were used in a 50 μl PCR reaction.

[0541] The results are shown in Table 8.

[0542] Table 8 Real-time and end-point PCR assays of CD14+ and CD14- cells isolated from blood

[0543]

[0544] Subjects with successful treatment are indicated by ^. Subjects with treatment failure are indicated by #.

[0545] The results shown are the average of two replicate assays.

[0546] As shown in Table 8, the detection limit of real-time PCR was 4 copies / μl of HIV-1 DNA standard. The end-point assay was able to detect 0.4 copies / μl of HIV-1 DNA and was thus more sensitive than the real-time PCR assay.

[0547] Real-time PCR analysis showed that HIV-1 was detected in most CD14 cell populations from the subjects. However, the assay did not detect HIV-1 in the CD14+ cell population from subjects with treatment failure. In contrast, the end-point assay was able to detect HIV-1 DNA in all CD14- cell populations (regardless of treatment positive or negative) and in the CD14+ cell population from subjects with treatment failure, indicating that the end-point assay provides a more sensitive detection method.

[0548] Example 11 Analysis of HIV-2 clinical samples

[0549] In this example, the inventors wanted to determine whether plasma HIV-2 levels would increase (i.e., rebound) after stopping ART. This example shows subjects with latent HIV-2 infection under ART treatment.

[0550] This example relates to a subject whose HIV-2 plasma viral load (pVL, i.e., the number of HIV-2 copies in plasma) has been continuously suppressed due to her ART treatment. For two years, this subject has been monitored and her pVL has been below the detection limit. This subject, against the doctor's advice, stopped taking her ART in mid-June 2017. One month after stopping ART, a blood sample was obtained from this subject.

[0551] Plasma was extracted from the subject's sample, and the presence of HIV-2 RNA was determined using a forward primer (SEQ ID NO: 35) and a reverse primer (SEQ ID NO: 36) and a probe (SEQ ID NO: 37). Endpoint and real-time PCR amplification were performed with 50 PCR cycles.

[0552] The subject's sample was compared with (i) an HIV-2 plasmid standard (2 to 20,000 copies of HIV-2 plasmid DNA), (ii) an HIV-2 positive control sample, (iii) two HIV-2 RNA-spiked controls, which were prepared by spiking two different concentrations (one high concentration and one low concentration) of HIV-2 RNA (released into the culture supernatant of HIV-2-infected CD4+ cells) into normal plasma, and (iv) a negative control (negative plasma sample).

[0553] The results of the real-time PCR analysis and the endpoint PCR analysis are shown in Table 9 below.

[0554] Table 9 PCR assay of HIV-2 clinical samples

[0555]

[0556] As shown in Table 9, real-time PCR was able to detect the presence of HIV-2 in the subject's sample as well as in the spiked controls and the positive control. Therefore, the assay confirmed that this subject still had HIV-2 in her blood.

[0557] In addition, endpoint PCR detected the presence of HIV-2 in the subject's sample as well as in the spiked controls and the positive control. Therefore, the assay also confirmed that this subject still had HIV-2 in her blood.

[0558] Example 12 Analysis of HIV-1 clinical samples

[0559] Two subject case studies are presented in this example. The first subject (subject 320) had a high HIV-1 antibody titer. Western blot analysis showed the presence of HIV-1 antibodies against all HIV-1 (env, gag, pol) in the subject's plasma. Based on serology, the subject had a confirmed HIV-1 infection, but her pVL was negative. She had not received any ART.

[0560] Regarding the second subject (subject 321), the Western blot analysis was inconclusive and had been ongoing for several years. The subject's pVL was negative and he had not received any ART. Based on serology, the subject was considered likely to be HIV-1 negative, but more sensitive assays were needed to determine if the subject was ultimately HIV-1 negative.

[0561] As described in Methods and DNA Extraction, PBMCs were isolated from whole blood. For assay validation, samples were run together with the following controls: (i) HIV-1 plasmid standards containing 0, 0.2, 0.4, 4, 40, and 400 copies / μl, (ii) a positive control containing 40 OM10.1 cells in 1×10 6 HUT78 cells; (iii) another positive control was a sample from a known HIV-1 positive subject (subject 291), and (iv) the HUT-78 cell line as a negative control. The assay was considered valid when it detected 40 OM10.1 cells.

[0562] Real-time PCR was performed in duplicate using the forward primer (SEQ ID NO:7) and the reverse primer (SEQ ID NO:9) and the HIV-1 probe (SEQ ID NO:6). End-point PCR was also performed in duplicate using the biotinylated reverse primer (SEQ ID NO:9), the unlabeled forward primer (SEQ ID NO:7), and the diaminoxanthene-labeled HIV-1 probe (SEQ ID NO:45). Both real-time PCR and end-point PCR were performed in the same run for 50 cycles.

[0563] The analysis of the subjects is shown in Table 10 below.

[0564] Table 10 PCR Assays of HIV-1 Clinical Samples

[0565]

[0566] Regarding the real-time assay, subject 320 showed one positive result and one negative result, indicating that the HIV-1 level was just at the detection limit of the assay. The estimated HIV-1 copy number for this subject was per 10 6There were 27 HIV-1 infected cells (0.0027%) in the PBMCs. Subject 321 was clearly negative for HIV-1.

[0567] Regarding the endpoint assay, Subject 320 was clearly positive and Subject 321 was clearly negative.

[0568] Example 13 Analysis of HIV-1 in mothers and newborns

[0569] This example describes the analysis of a mother (Subject 118) and her 2-month-old infant (Subject 142). The mother had previously been diagnosed as HIV-1 positive, but HIV-1 could not be detected when tested with the assay (Cepheid) and the standard viral load assay. A more sensitive assay was needed to determine the HIV status of the mother and the infant.

[0570] According to the method described in the present disclosure, the quantification of HIV-1 DNA and RNA was performed by real-time PCR. DNA and RNA were extracted from 2 ml of whole blood (4 ml of whole blood in total), where PBMCs were separated using standard ficoll-hypaque density gradient centrifugation. Samples obtained from Subject 118 were run in duplicate. Samples obtained from Subject 142 were run four times.

[0571] The copy numbers determined by each assay are shown below:

[0572] Table 11 HIV-1 Copy Numbers

[0573] Subjects <![CDATA[HIV-1 copies / 10 6 cells]]> HIV status HIV-1 DNA assay Subject 118 (mother) 1.82 Positive Subject 142 (infant) 0 Negative Negative control 0 Negative Positive control (Subject 95) 34 Positive Positive control (Subject 97) 1410 Positive HIV-1 RNA transcription assay Subject 118 (mother) 51 Positive Negative control 0 Negative Positive control (Subject 95) 598 Positive

[0574] Subject 95 is an HIV-1 positive individual with a pVL below 20 copies / ml and a CD4 + count of 588.

[0575] Subject 97 is an HIV-1 positive individual with immune failure; the VL is suppressed below 20 copies / ml and the CD4 count is low.

[0576] Therefore, this assay could clearly diagnose the mother as HIV-1 positive and the infant as HIV-1 negative. T / A cloning confirmed that the amplified sequence was the R region sequence of HIV-1. The sequence data indicated that the HIV-1 Taqman probe assay detected the HIV-1 R region sequence extracted from the samples.

[0577] Example 14 Analysis of samples determined to be negative by GeneXpert and viral load.

[0578] This example describes the quantification of HIV-1 DNA in a subject (Subject 197) who was previously found to be HIV-1 negative by GeneXpart assay and viral load assay.

[0579] According to the method described in the present disclosure, the quantification of HIV-1 DNA was performed by real-time PCR (in triplicate). The results are summarized in Table 12.

[0580] Table 12 HIV-1 copy number

[0581] Subjects <![CDATA[HIV-1 copies / 10 6 cells]]> HIV status Subject 197 108 Positive Negative control (Subject 94) 0 Negative Positive control (Subject 124) 983 Positive

[0582] Subject 124 was an HIV-1 positive control with immune failure; the VL was suppressed to less than 20 copies / ml and the CD4 count was low. DNA was extracted from the sample using lysis buffer.

[0583] Therefore, the assay could clearly diagnose the subject as HIV-1 positive. T / A cloning confirmed that the amplified sequence was the R region sequence of HIV-1. The sequence data showed that the HIV-1 Taqman probe assay detected the HIV-1 R region sequence extracted from the sample.

[0584] Example 15 HIV-1 transcription assay

[0585] Automated extraction of DNA and RNA from 26 subject samples obtained from St Vincent’s Hospital was prepared using a Maxwell extractor (Promega). Quantification of DNA and RNA was determined according to the protocol described herein. The medical records of 28 subjects were examined and the subjects were divided into two groups: the first group was the “optimal ART” group (n = 7), and the second group was the “suboptimal ART” group (n = 21). The optimal ART group was those subjects whose pVL was continuously suppressed for at least 6 months and whose CD4 + T cell count exceeded 500. The “suboptimal ART” group (n = 21) experienced transient fluctuations (occasional and transient increases in pVL within a 6-month period) and immune failure (CD4+ T cell count below 500 counts / μl).

[0586] As Figure 14 shown in A, there was no difference in plasma VL between the two groups of subjects (i.e., the optimal ART and suboptimal ART groups), and their levels were below the detection limit of the assay.

[0587] When examining the HIV-1 DNA level ( Figure 14 B), some differences were observed between the two groups. This was even more evident when examining the RNA level (transcriptional activity) ( Figure 14 C). As described herein, the quantification was determined and normalized.

[0588] As Figure 15As shown, another group in the "optimal ART" group was identified, which is called "improved optimal ART". This group was defined as subjects with less than 400 copies of HIV-1 DNA per 1×10 6 cells. In this group, ongoing RNA expression was rarely shown, most likely due to transcriptional repression. Therefore, the integration of HIV-1 into the genome was reduced. Ideally, the goal of ART is to get subjects into the improved optimal ART category.

[0589] Therefore, the data shown provide a method for assessing HIV RNA transcriptional activity in subjects, especially when the subjects are receiving ART.

[0590] Example 16A Evidence of HIV-1 activation in latently infected HIV-1 cells

[0591] As is well known, when exposed to HIV-1 stimulants, HIV-1 can be activated from latently infected cell reservoirs. If the latently infected cell reservoirs are activated, an increase in transcriptional levels is expected. This example tests this hypothesis by measuring RNA transcription after exposure to various stimulants.

[0592] Fourteen (14) subjects successfully treated with ART were tested. The pVL levels of these subjects were below the detection limit, and the CD4 + T cell count exceeded 500 cells / μl.

[0593] PBMC (between 3 - 6 ml) were obtained from each subject and divided into four equal parts (preferably each part containing >1×10 6 cells). If the cell number was not sufficient for a given subject, then the PBMC were divided into three parts.

[0594] These groups were designated as follows:

[0595] Group 1: BI (BI-2536); Polo-like kinase (PLK) inhibitor

[0596] Group 2: JQ1; Bromodomain inhibitor

[0597] Group 3: PMA; phorbol-12-myristate-13-acetate (HIV activator)

[0598] Group 4: control group (no stimulant)

[0599] PBMC were cultured in a CO 2 incubator in 24-well plates in RPMI medium with 20% FBC in the presence of the designated reagents for 14 hours. After 14 hours, total RNA was extracted from the cultured PBMC. HIV-RNA analysis was performed according to the method described herein.

[0600] As Figure 16 shown, in the presence of an activating stimulus, HIV-1 transcription is activated and this increased transcription can be detected, although the degree of activation varies among subjects, indicating that the mechanisms of HIV-1 latency are diverse and may require more than one mechanism to transition from the latent state to the activated state. Thus, the assay allows detection of HIV in latently infected cells, the pVL of which is typically below the limit of detection of the patient plasma VL. The data confirm that the transcriptional activity detected by the developed assay is a true signal as the level of transcriptional activity is increased in the presence of HIV-1 stimulus in the culture medium compared to control cultures (absence of stimulus).

[0601] Example 16B Quantification of HIV by endpoint assay

[0602] This example illustrates the quantification of HIV-1 by endpoint PCR. The number of PCR cycles was reduced to 40 cycles instead of performing 50 amplification cycles. Samples from eight (8) subjects were examined. Briefly, DNA from PBMC obtained from each subject was extracted using the Maxwell Extraction System (Promega) and then subjected to 40 cycles of PCR amplification. Amplification was performed using the forward primer (SEQ ID NO:7) and the reverse primer (SEQ ID NO:9) and the probe (SEQ ID NO:6). The PCR curve generated from the plasmid standard is as Figure 17 shown and the estimated copy number was determined according to this standard curve.

[0603] The results are summarized in Table 13 below.

[0604] Table 13 Quantification of endpoint PCR amplification products

[0605]

[0606] Example 17 PCR assay for dried blood spot test (DBS) biosampling

[0607] Dry blood spot (DBS) samples were analyzed by real-time PCR and endpoint PCR. For this analysis, eight samples with different HIV-1 RNA copy numbers (pVL) were amplified by real-time PCR and endpoint PCR. From these samples, 70 μl of whole blood was spotted on DBS paper and RNA was extracted from these spotted samples.

[0608] As shown in Table 14, HIV-1 RNA in a sample can be detected using real-time PCR and end-point PCR assay methods. For real-time PCR, amplification is carried out using a forward primer (SEQ ID NO:7), a reverse primer (SEQ ID NO:9), and a probe (SEQ ID NO:6). For end-point PCR, amplification is carried out using an unlabeled forward primer (SEQ ID NO:7), a biotin-labeled reverse primer (SEQ ID NO:9), and a Dig-labeled probe (SEQ ID NO:45).

[0609] These results indicate that samples can be collected from remote areas or areas with underdevelopment or insufficient resources and transferred to a location where analysis can be performed.

[0610] Table 14 PCR analysis of DBS

[0611]

[0612] The present disclosure also relates to the following items:

[0613] 1. A method for detecting human immunodeficiency virus (HIV) in a subject having human immunodeficiency virus (HIV) or a subject suspected of having HIV infection (AIDS), the method comprising performing PCR amplification on R region nucleic acid in a biological sample obtained from the subject, wherein the amplification comprises a forward primer and a reverse primer that hybridize to sequences located within the R region of the long terminal repeat (LTR) of HIV, and subsequently detecting any amplification, wherein detection of amplification indicates the presence of HIV in the subject.

[0614] 2. The method according to item 1, wherein detection of amplification is performed using a labeled oligonucleotide probe that hybridizes to a sequence within the amplified R region sequence.

[0615] 3. The method according to any one of items 1 to 2, wherein the nucleic acid is DNA or reverse transcribed RNA (cDNA).

[0616] 4. The method according to any one of items 1 to 3, wherein the HIV is HIV-1 or HIV-2.

[0617] 5. The method according to any one of items 1 to 4, wherein the PCR is real-time PCR.

[0618] 6. The method according to any one of items 1 to 4, wherein the PCR is end-point PCR.

[0619] 7. A method for quantifying the number of HIV DNA copies in a biological sample from a subject with HIV or a subject suspected of having an HIV infection, the method comprising:

[0620] (i) amplifying and detecting the HIV-R region sequence as described in item 1; and

[0621] (ii) quantifying the amplified HIV-R region sequence by reference to a corresponding HIV plasmid standard to obtain the number of HIV DNA copies per volume of the sample.

[0622] 8. The method according to item 7, wherein the amplification is real-time PCR or endpoint PCR.

[0623] 9. The method according to item 7 or 8, further comprising normalizing the HIV DNA copy number against a DNA standard to obtain the number of HIV DNA copies per one or more cells in the biological sample.

[0624] 10. A method for quantifying the number of HIV DNA copies in a biological sample from a subject with HIV or a subject suspected of having an HIV infection by normalizing against a standard, the method comprising:

[0625] (i) amplifying and detecting the HIV-R region sequence as described in any one of items 1 to 6;

[0626] (ii) quantifying the number of copies of the HIV-R region of DNA per volume in the sample by quantitative PCR by reference to a corresponding HIV standard;

[0627] (iii) quantifying an endogenous housekeeping gene by quantitative PCR using a corresponding housekeeping standard to obtain the number of copies of the endogenous gene, the number of copies of the endogenous gene being expressed as the number of housekeeping gene copies per volume of DNA present in the sample;

[0628] (iv) dividing the number of copies obtained by the number of copies of the endogenous gene in the cells to obtain the number of cells per volume of DNA in the sample; and

[0629] (v) calculating the number of HIV-R region DNA copies per cell by dividing the value obtained in (ii) by the value obtained in (iv) to normalize the HIV DNA copy number to obtain the HIV-R region DNA copy number (copies / cell) in the biological sample.

[0630] 11. The method according to item 10, wherein the DNA standard is actin.

[0631] 12. A method for quantifying the number of HIV DNA copies in a biological sample from a subject with HIV or a subject suspected of having an HIV infection, the method comprising:

[0632] (i) Amplifying and detecting the HIV-R region sequence as described in any one of items 1-6;

[0633] (ii) Quantifying the mass of DNA per volume (w / v) in the sample by measuring the absorbance of the DNA in the sample;

[0634] (iii) Calculating the number of cells per volume of DNA in the sample based on the DNA absorbance; and

[0635] (iv) Calculating the number of HIV-R region DNA copies per cell by dividing the value obtained in (ii) by the value obtained in (iii), thereby normalizing the number of HIV DNA copies to obtain the number of HIV R region DNA copies (copies / cell) in the biological sample.

[0636] 13. The method according to item 12, wherein quantifying the mass of DNA per volume in the sample comprises adding a DNA intercalating dye and measuring the fluorescence emitted by the dye.

[0637] 14. The method according to any one of items 7-13, comprising:

[0638] (i) Obtaining an aliquot of the sample from which DNA has been extracted;

[0639] (ii) Contacting the aliquot with a labeled hydrolyzable oligonucleotide probe that hybridizes to the R region sequence of the long terminal repeat (LTR) of HIV DNA;

[0640] (iii) Contacting the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region sequence;

[0641] (iv) Amplifying the R region sequence by PCR;

[0642] (v) Extrapolating the signal obtained from the labeled oligonucleotide to a standard curve obtained by serial dilution of an HIV standard and corresponding amplification to obtain the number of HIV-R region DNA copies per volume of DNA in the aliquot.

[0643] 15. The method according to any one of items 1-4 or 7-8, wherein the forward primer or the reverse primer is labeled with biotin and the probe is labeled with digoxin (Dig).

[0644] 16. The method according to item 15, wherein the forward primer comprises a sequence according to or consists of a sequence according to: SEQ ID NO: 29, SEQ ID NO: 33 or SEQ ID NO: 35.

[0645] 17. The method according to item 15 or 16, wherein the reverse primer comprises a sequence according to or consists of a sequence according to: SEQ ID NO: 30, SEQ ID NO: 34 or SEQ ID NO: 36.

[0646] 18. The method according to any one of items 15 to 17, wherein the labeled probe comprises a sequence according to or consists of a sequence according to: SEQ ID NO: 4, SEQ ID NO: 12, SEQ ID NO: 37, SEQ ID NO: 41, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, or SEQ ID NO: 51.

[0647] 19. A method for monitoring antiretroviral therapy (ART) being administered to an HIV-positive subject, comprising quantifying the HIV DNA copy number according to any one of items 7 to 18 at at least two time points and comparing the difference in the HIV R region DNA copy number between the at least two time points, wherein a decrease in the HIV R region DNA copy number indicates that the subject is receiving optimal / effective ART.

[0648] 20. The method according to item 19, further comprising adjusting the dose or type of ART being administered to the subject.

[0649] 21. A method for quantifying the HIV RNA copy number in a biological sample from a subject having HIV or suspected of having an HIV infection, the method comprising:

[0650] (i) amplifying and detecting the HIV-R region sequence on the reverse transcribed HIV RNA R region sequence according to any one of items 1 to 6; and

[0651] (ii) quantifying the amplified HIV-R region sequence by reference to a corresponding HIV plasmid standard to obtain the copy number of HIV RNA per volume of the sample.

[0652] 22. The method according to item 21, wherein the amplification is real-time PCR or endpoint PCR.

[0653] 23. The method according to item 21 or 22 further includes normalizing the HIV RNA copy number against an RNA standard to obtain the HIV RNA copy number per one or more cells in the biological sample.

[0654] 24. A method for quantifying the HIV RNA copy number in a biological sample from a subject with HIV or a subject suspected of having an HIV infection by normalizing against a standard, the method comprising:

[0655] (i) Amplifying and detecting the HIV-R region sequence on the reverse transcribed HIV RNA R region sequence as described in any one of items 1 to 6;

[0656] (ii) Quantifying the HIV-R region copy number per volume of RNA in the sample by quantitative PCR with reference to the corresponding HIV standard;

[0657] (iii) Quantifying an endogenous housekeeping gene by quantitative PCR using the corresponding housekeeping standard to obtain the copy number of the endogenous gene, which is expressed as the copy number of the housekeeping gene per volume of RNA present in the sample;

[0658] (iv) Dividing the obtained copy number by the copy number of the endogenous gene in the cell to obtain the number of cells per volume of RNA in the sample; and

[0659] (v) Calculating the HIV-R region RNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV RNA copy number to obtain the HIV R region RNA copy number (copy number / cell) in the biological sample.

[0660] 25. The method according to item 24, wherein the RNA standard is GAPDH.

[0661] 26. A method for quantifying the HIV RNA copy number in a biological sample from a subject with HIV or a subject suspected of having an HIV infection, the method comprising:

[0662] (i) Amplifying and detecting the HIV-R region sequence on the reverse transcribed HIV RNA R region sequence as described in any one of items 1 to 6;

[0663] (ii) Quantifying the mass of RNA (w / v) per volume in the sample by measuring the absorbance of the RNA in the sample;

[0664] (iii) Calculating the number of cells per volume of RNA in the sample based on the RNA absorbance; and

[0665] (iv) Calculate the HIV-R region RNA copy number per cell by dividing the value obtained in (ii) by the value obtained in (iii), thereby normalizing the HIV RNA copy number to obtain the HIV R region RNA copy number (copy number / cell) in the biological sample.

[0666] 27. The method according to item 25, wherein quantifying the mass of RNA per volume in the sample comprises adding an RNA intercalating dye and measuring the fluorescence emitted by the dye.

[0667] 28. The method according to any one of items 21 to 27, wherein the HIV-R region is quantified by:

[0668] (i) Obtain an aliquot of the sample from which RNA has been extracted;

[0669] (ii) Contact the aliquot with a labeled hydrolyzable oligonucleotide probe that hybridizes to the R region sequence of the long terminal repeat (LTR) of reverse transcribed HIV RNA (cDNA);

[0670] (iii) Further contact the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region of reverse transcribed HIV RNA (cDNA);

[0671] (iv) Amplify the R region sequence by PCR;

[0672] (v) Extrapolate the signal obtained from the labeled oligonucleotide to a standard curve obtained by corresponding amplification of a series of dilutions of an HIV standard to obtain the HIV-R region RNA copy number per volume of RNA in the aliquot.

[0673] 29. The method according to any one of items 21 to 28 further comprises obtaining a biological sample from the subject and preparing RNA from the sample.

[0674] 30. A method for evaluating the effectiveness of antiretroviral therapy (ART) administered to an HIV-positive subject, the method comprising:

[0675] (i) Quantify the HIV-R region DNA copy number according to any one of items 7 to 14;

[0676] (ii) Quantify the HIV-R region RNA copy number according to any one of items 21 to 29;

[0677] (iii) Determine the normalized HIV RNA copy number in the sample by dividing the value obtained in step (i) by the value obtained in step (ii); and

[0678] (iv) Compare the value of the normalized HIV RNA copy number with one or more previous normalized values obtained from the same subject;

[0679] wherein a decrease in the normalized HIV RNA copy number indicates that the subject is receiving optimal / effective ART.

[0680] 31. The method according to item 30, further comprising obtaining a biological sample from the subject, and preparing DNA and RNA from the sample.

[0681] 32. The method according to any one of the preceding items, wherein the biological sample is a cell population selected from blood or tissue or any other biological fluid in which HIV-infected cells are present.

[0682] 33. The method according to item 32, wherein the biological sample is PBMC.

[0683] 34. The method according to any one of the preceding items, wherein the R region sequence consists of the sequence listed in SEQ ID NO:1 or SEQ ID NO:2.

[0684] 35. The method according to any one of the preceding items, wherein the hydrolyzed oligonucleotide is a probe.

[0685] 36. The method according to any one of the preceding items, wherein the oligonucleotide probe binds to the following sequence: a sequence comprising about 13 to 40 consecutive nucleotides within the HIV-1 R region sequence listed in SEQ ID NO:1 or a sequence at least 70% identical to the consecutive nucleotides, or a sequence consisting of about 13 to 40 consecutive nucleotides within the HIV-1 R region sequence listed in SEQ ID NO:1 or a sequence at least 70% identical to the consecutive nucleotides.

[0686] 37. The method according to item 32, wherein the oligonucleotide probe binds to the following sequence: a sequence comprising the sequence 5’TAAGCAGTGGGTTCCCT 3’ (SEQ ID NO:3) or a sequence at least 70% identical thereto, or a sequence consisting of the sequence 5’TAAGCAGTGGGTTCCCT 3’ (SEQ ID NO:3) or a sequence at least 70% identical thereto.

[0687] 38. The method according to item 36 or 37, wherein the oligonucleotide probe comprises the following sequence or consists of the following sequence: sequence SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, or SEQ ID NO:48.

[0688] 39. The method according to any one of the preceding items, wherein the forward primer is an HIV-1 primer, the HIV-1 primer comprises the sequence SEQ ID NO:7 or SEQ ID NO:29 or a sequence at least 75% identical thereto, or consists of the sequence SEQ ID NO:7 or SEQ ID NO:29 or a sequence at least 75% identical thereto.

[0689] 40. The method according to any one of the preceding items, wherein the forward primer hybridizes with the HIV-1R region sequence, the HIV-1R region sequence comprises the sequence 5'-CAGAGAGCTCCCAGGCTC-3' (SEQ ID NO:8) or a sequence at least 75% identical thereto, or consists of the sequence 5'-CAGAGAGCTCCCAGGCTC-3' (SEQ ID NO:8) or a sequence at least 75% identical thereto.

[0690] 41. The method according to any one of the preceding items, wherein the reverse primer is an HIV-1 primer, the HIV-1 primer comprises the sequence SEQ ID NO:9 or the sequence SEQ ID NO:30 or a sequence at least 75% identical thereto, or consists of the sequence SEQ ID NO:9 or the sequence SEQ ID NO:30 or a sequence at least 75% identical thereto.

[0691] 42. The method according to any one of the preceding items, wherein the reverse primer hybridizes with the HIV-1R region sequence, the HIV-1R region sequence comprises the sequence 5’GCCTCAATAAAGCTTGCCTTGAGT 3’ (SEQ ID NO:10) or a sequence at least 75% identical thereto, or consists of the sequence 5’GCCTCAATAAAGCTTGCCTTGAGT 3’ (SEQ ID NO:10) or a sequence at least 75% identical thereto.

[0692] 43. The method according to any one of the preceding items, wherein the oligonucleotide probe binds to the following sequence: a sequence comprising about 17 to 30 consecutive nucleotides in the HIV-2R region sequence listed in SEQ ID NO:2 or a sequence that is at least 70% identical to the consecutive nucleotides, or a sequence consisting of about 17 to 30 consecutive nucleotides in the HIV-2R region sequence listed in SEQ ID NO:2 or a sequence that is at least 70% identical to the consecutive nucleotides.

[0693] 44. The method according to item 43, wherein the oligonucleotide binds to the following sequence: a sequence comprising the sequence 5’GCCTGGGTGTTCCCTGCTAGACTCT 3’ (SEQ ID NO:11) or a sequence that is at least 70% identical thereto, or a sequence consisting of the sequence 5’GCCTGGGTGTTCCCTGCTAGACTCT 3’ (SEQ ID NO:11) or a sequence that is at least 70% identical thereto.

[0694] 45. The method according to item 43 or 44, wherein the oligonucleotide probe comprises the following sequence or consists of the following sequence: the sequences SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40, SEQ ID:41, SEQ ID:42, SEQ ID:43, SEQ ID:44, SEQ ID NO:49, SEQ IDNO:50, SEQ ID NO:51, SEQ ID NO:52 or SEQ ID NO:53.

[0695] 46. The method according to any one of the preceding items, wherein the HIV-2 forward primer comprises the sequence according to SEQ ID NO:14, SEQ ID NO:31, SEQ ID NO:33 or SEQ ID NO:35 or a sequence that is at least 75% identical thereto, or consists of the sequence according to SEQ ID NO:14, SEQ ID NO:31, SEQ ID NO:33 or SEQ ID NO:35 or a sequence that is at least 75% identical thereto.

[0696] 47. The method according to any one of the preceding items, wherein the forward primer hybridizes to an HIV-2R region sequence, the HIV-2R region sequence comprising the sequence 5’-GAGAACCTCCCAGGGCTC-3’ (SEQ ID NO:15) or a sequence that is at least 75% identical thereto, or consisting of the sequence 5’-GAGAACCTCCCAGGGCTC-3’ (SEQ ID NO:15) or a sequence that is at least 75% identical thereto.

[0697] 48. According to the method of any one of the preceding items, wherein the HIV-2 reverse primer comprises the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36 or a sequence at least 75% identical thereto or consists of the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36 or a sequence at least 75% identical thereto.

[0698] 49. A composition for amplifying HIV-1 nucleic acid, comprising a labeled oligonucleotide probe, the labeled oligonucleotide probe comprising or consisting of a combination of a probe, a forward primer and a reverse primer, the combination of the probe, the forward primer and the reverse primer being selected from one or more of the following combinations:

[0699] (i) oligonucleotide probes: SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, or SEQ ID NO:48;

[0700] (ii) forward primers: SEQ ID NO:7 or SEQ ID NO:29; and

[0701] (iii) reverse primers: SEQ ID NO:9 or SEQ ID NO:30.

[0702] 50. A composition for amplifying HIV-2 nucleic acid, comprising a labeled oligonucleotide, the labeled oligonucleotide comprising or consisting of a combination of a probe, a forward primer and a reverse primer, the combination of the probe, the forward primer and the reverse primer being selected from one or more of the following combinations:

[0703] (i) oligonucleotide probes: SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID:41, SEQ ID:42, SEQ ID:43, SEQ ID:44, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52 or SEQ ID NO:53;

[0704] (iii) Forward primer: SEQ ID NO:14, SEQ ID NO:31, SEQ ID NO:33, or SEQ ID NO:35;

[0705] (iii) Reverse primer: SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36.

[0706] 51. A method for treating an HIV-positive subject, comprising detecting or quantifying lentiviral nucleic acid or HIV DNA and / or RNA as described in any one of items 1 to 48, and administering ART to the subject.

[0707] 52. A kit, which is used for detecting HIV-1 or, when used for detecting HIV-1, contains the composition according to item 49, and suitable reagents and instructions for detecting and quantifying HIV-1 as described in any one of items 1 to 48.

[0708] 53. A kit, which is used for detecting HIV-2 or, when used for detecting HIV-2, contains the composition according to item 50, and suitable reagents and instructions for detecting and quantifying HIV-2 as described in any one of items 1 to 48.

Claims

1. A method for in vitro quantifying the copy number of HIV DNA in a biological sample obtained from a subject with HIV or a subject suspected of having HIV infection by normalizing against a standard, the method comprising: (i) performing PCR amplification on the nucleic acid of the R region in the biological sample obtained from the subject with a forward primer and a reverse primer, and subsequently detecting any amplification, wherein: i) the forward primer is an HIV-1 primer comprising the sequence SEQ ID NO:7 or SEQ ID NO:29, or consisting of the sequence SEQ ID NO:7 or SEQ ID NO:29; and the reverse primer is an HIV-1 primer comprising the sequence SEQ ID NO:9 or SEQ ID NO:30, or consisting of the sequence SEQ ID NO:9 or SEQ ID NO:30; or ii) the forward primer is an HIV-2 primer comprising the sequence SEQ ID NO:14, SEQ ID NO:33 or SEQ ID NO:35, or consisting of the sequence SEQ ID NO:14, SEQ ID NO:33 or SEQ ID NO:35; and the reverse primer is an HIV-2 primer comprising the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36, or consisting of the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36; (ii) quantifying the copy number of HIV-R region per volume of DNA in the biological sample via quantitative PCR by reference to the corresponding HIV standard; (iii) quantifying an endogenous housekeeping gene by quantitative PCR using the corresponding housekeeping standard to obtain the copy number of the endogenous housekeeping gene, the copy number of the endogenous housekeeping gene being expressed as the copy number of the endogenous housekeeping gene per volume of DNA present in the biological sample; (iv) dividing the obtained copy number of the endogenous housekeeping gene by the copy number of the endogenous gene in the cell to obtain the number of cells per volume of DNA in the biological sample; and (v) calculating the copy number of HIV-R region DNA per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the copy number of HIV DNA to obtain the copy number of HIV-R region DNA in the biological sample in terms of copies / cell.

2. The method according to claim 1, wherein the housekeeping standard is actin.

3. A method for in vitro quantifying the copy number of HIV DNA in a biological sample obtained from a subject with HIV or a subject suspected of having HIV infection, the method comprising: (i) performing PCR amplification on the nucleic acid of the R region in the biological sample obtained from the subject with a forward primer and a reverse primer, and subsequently detecting any amplification, wherein: (i) The forward primer is an HIV-1 primer comprising the sequence SEQ ID NO:7 or SEQ ID NO:29, or consisting of the sequence SEQ ID NO:7 or SEQ ID NO:29; and the reverse primer is an HIV-1 primer comprising the sequence SEQ ID NO:9 or SEQ ID NO:30, or consisting of the sequence SEQ ID NO:9 or SEQ ID NO:30; or (ii) The forward primer is an HIV-2 primer comprising the sequence SEQ ID NO:14, SEQ ID NO:33 or SEQ ID NO:35, or consisting of the sequence SEQ ID NO:14, SEQ ID NO:33 or SEQ ID NO:35; and the reverse primer is an HIV-2 primer comprising the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36, or consisting of the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36; (ii) Quantifying the mass of DNA per volume in the biological sample in w / v by measuring the absorbance of the DNA in the biological sample; (iii) Calculating the number of cells per volume of DNA in the biological sample based on the DNA absorbance; and (iv) Calculating the number of HIV-R region DNA copies per cell by dividing the value obtained in (ii) by the value obtained in (iii), thereby normalizing the HIV DNA copy number to obtain the number of HIV-R region DNA copies per cell in the biological sample in copies / cell. (v) Quantifying the mass of DNA per volume in the biological sample includes adding a DNA intercalating dye and measuring the fluorescence emitted by the dye. (vi) The method according to any one of claims 1 to 4, comprising: (i) Obtaining an aliquot of the biological sample from which DNA has been extracted; (ii) Contacting the aliquot with a labeled hydrolyzable oligonucleotide probe that hybridizes to the R region sequence of the long terminal repeat (LTR) of HIV DNA; (iii) Contacting the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region sequence; (iv) Amplifying the R region sequence by PCR; (v) Extrapolating the signal obtained from the labeled hydrolyzable oligonucleotide probe to a standard curve obtained by corresponding amplification of a series of dilutions of an HIV standard to obtain the number of HIV-R region DNA copies per volume of DNA in the aliquot. (vi) A method for in vitro quantification of the number of HIV RNA copies in a biological sample obtained from a subject with HIV or a subject suspected of having HIV infection, the method comprising: ​ (i) PCR amplify the nucleic acid of the R region in a biological sample obtained from the subject using a forward primer and a reverse primer, and subsequently detect any amplification, wherein: i) The forward primer is an HIV-1 primer comprising the sequence SEQ ID NO:7 or SEQ ID NO:29, or consisting of the sequence SEQ ID NO:7 or SEQ ID NO:29; and the reverse primer is an HIV-1 primer comprising the sequence SEQ ID NO:9 or SEQ ID NO:30, or consisting of the sequence SEQ ID NO:9 or SEQ ID NO:30; or ii) The forward primer is an HIV-2 primer comprising the sequence SEQ ID NO:14, SEQ ID NO:33 or SEQ ID NO:35, or consisting of the sequence SEQ ID NO:14, SEQ ID NO:33 or SEQ ID NO:35; and the reverse primer is an HIV-2 primer comprising the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36, or consisting of the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36; and (ii) Quantify the amplified HIV-R region sequence by reference to a corresponding HIV plasmid standard to obtain the number of HIV RNA copies per volume of the biological sample.

7. The method according to claim 6, wherein the amplification is real-time PCR or end-point PCR.

8. The method according to claim 6 or 7, further comprising normalizing the number of HIV RNA copies against an RNA standard to obtain the number of HIV RNA copies per one or more cells in the biological sample.

9. A method for in vitro quantification of the number of HIV RNA copies in a biological sample obtained from a subject with HIV or a subject suspected of having HIV infection by normalizing against a standard, the method comprises: (i) PCR amplify the nucleic acid of the HIV RNA R region reverse transcribed in a biological sample obtained from the subject using a forward primer and a reverse primer, and subsequently detect any amplification, wherein: i) The forward primer is an HIV-1 primer comprising the sequence SEQ ID NO:7 or SEQ ID NO:29, or consisting of the sequence SEQ ID NO:7 or SEQ ID NO:29; and the reverse primer is an HIV-1 primer comprising the sequence SEQ ID NO:9 or SEQ ID NO:30, or consisting of the sequence SEQ ID NO:9 or SEQ ID NO:30; or (ii) The forward primer is an HIV-2 primer comprising the sequence SEQ ID NO:14, SEQ ID NO:33 or SEQ ID NO:35, or consisting of the sequence SEQ ID NO:14, SEQ ID NO:33 or SEQ ID NO:35; and the reverse primer is an HIV-2 primer comprising the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36, or consisting of the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36; (ii) Quantifying the copy number of the HIV-R region per volume of RNA in the biological sample by quantitative PCR with reference to the corresponding HIV standard; (iii) Quantifying the endogenous housekeeping gene by quantitative PCR using the corresponding housekeeping standard to obtain the copy number of the endogenous housekeeping gene, which is expressed as the copy number of the endogenous housekeeping gene per volume of RNA present in the biological sample; (iv) Dividing the obtained copy number of the endogenous housekeeping gene by the copy number of the endogenous gene in the cell to obtain the number of cells per volume of RNA in the biological sample; and (v) Calculating the copy number of HIV-R region RNA per cell by dividing the value obtained in (ii) by the value obtained in (iv), thereby normalizing the HIV RNA copy number to obtain the copy number of HIV-R region RNA in the biological sample in copies / cell.

10. The method according to claim 9, wherein the housekeeping standard is GAPDH.

11. A method for in vitro quantification of the copy number of HIV RNA in a biological sample obtained from a subject with HIV or a subject suspected of having HIV infection, the method comprises: (i) PCR amplifying the nucleic acid of the R region in the biological sample obtained from the subject with a forward primer and a reverse primer, and subsequently detecting any amplification, wherein: i) The forward primer is an HIV-1 primer comprising the sequence SEQ ID NO:7 or SEQ ID NO:29, or consisting of the sequence SEQ ID NO:7 or SEQ ID NO:29; and the reverse primer is an HIV-1 primer comprising the sequence SEQ ID NO:9 or SEQ ID NO:30, or consisting of the sequence SEQ ID NO:9 or SEQ ID NO:30; or (ii) The forward primer is an HIV-2 primer comprising the sequence SEQ ID NO:14, SEQ ID NO:33 or SEQ ID NO:35, or consisting of the sequence SEQ ID NO:14, SEQ ID NO:33 or SEQ ID NO:35; and the reverse primer is an HIV-2 primer comprising the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36, or consisting of the sequence SEQ ID NO:16, SEQ ID NO:32, SEQ ID NO:34 or SEQ ID NO:36; (ii) Quantifying the mass of RNA per volume in the biological sample in w / v by measuring the absorbance of the RNA in the biological sample; (iii) Calculating the number of cells per volume of RNA in the biological sample based on the RNA absorbance; and (iv) Calculating the number of HIV-R region RNA copies per cell by dividing the value obtained in (ii) by the value obtained in (iii), thereby normalizing the number of HIV RNA copies to obtain the number of HIV-R region RNA copies per cell in the biological sample in copies / cell.

12. The method according to claim 11, wherein quantifying the mass of RNA per volume in the biological sample comprises adding an RNA intercalating dye and measuring the fluorescence emitted by the dye.

13. The method according to any one of claims 6 to 12, wherein the HIV-R region is quantified by: (i) Obtaining an aliquot of the biological sample from which RNA has been extracted; (ii) Contacting the aliquot with a labeled hydrolyzable oligonucleotide probe that hybridizes to the R region sequence of the long terminal repeat (LTR) of reverse transcribed HIV RNA (cDNA); (iii) Further contacting the aliquot with a forward primer and a reverse primer that hybridize to sequences within the R region of reverse transcribed HIV RNA (cDNA); (iv) Amplifying the R region sequence by PCR; (v) Extrapolating the signal obtained from the labeled hydrolyzable oligonucleotide probe to a standard curve obtained by corresponding amplification of a serial dilution of an HIV standard to obtain the number of HIV-R region RNA copies per volume of RNA in the aliquot.

14. The method according to any one of claims 6 to 12, further comprising obtaining a biological sample from the subject and preparing RNA from the biological sample.

15. The method according to any one of claims 1, 3, 6, 9 and 11, wherein the biological sample is a cell population selected from blood or tissue or any other biological fluid in which HIV-infected cells are present.

16. The method according to claim 15, wherein the biological sample is PBMC.

17. The method according to any one of claims 1, 3, 6, 9 and 11, wherein the R region sequence consists of the sequence listed in SEQ ID NO: 1 or SEQ ID NO: 2.

Images