Application of menRNA in screening and / or preparing medicine for treating remodeled trabecular meshwork tissue damage

Abstract

The invention provides application of menRNA in screening and / or preparing a medicine for treating remodeled trabecular meshwork tissue damage. The sequence of the menRNA is shown as SEQ ID NO. 1. The invention also provides application of the menRNA in screening and / or preparing a medicine for treating remodeled trabecular meshwork tissue damage. Through comparison, it is found for the first time that the expression level of menRNA in iPSC-TM cells is obviously higher than that in pTM cells, and further experiments prove that menRNA overexpression has the function of promoting para-nuclear plaque assembly and plays a role in promoting cell proliferation and cell reprogramming, so that the application of the menRNA in the field of cell proliferation and cell reprogramming is promoted. And a foundation is laid for subsequent research on diagnosis and treatment means of the primary open-angle glaucoma and discussion on pathogenesis of the primary open-angle glaucoma.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid detection and treatment, and particularly relates to the application of menRNA in screening and / or preparing drugs for treating trabecular meshwork tissue injury remodeling. Background Art

[0002] Glaucoma is an ophthalmic disease that causes visual loss due to apoptosis of retinal ganglion cells, and is the second leading cause of blindness after cataract (Weinreb RN, Khaw PT. Primary open-angle glaucoma. Lancet. 2004 May 22;363(9422):1711-20. doi: 10.1016 / S0140-6736(04)16257-0. PMID: 15158634.). Glaucoma has become a major public health issue of global concern. As of 2020, the number of glaucoma patients in China reached 21 million, bringing a huge economic burden to Chinese society and the families of patients (Quigley HA, Broman AT. The number of people with glaucoma worldwide in 2010 and 2020. Br J Ophthalmol. 2006 Mar;90(3):262-7. doi: 10.1136 / bjo.2005.081224. PMID: 16488940; PMCID: PMC1856963.). Global epidemiological statistics show that primary open angle glaucoma (POAG) is the main type of glaucoma (Tham YC, Li X, Wong TY, Quigley HA, Aung T, Cheng CY. Global prevalence of glaucoma and projections of glaucoma burden through 2040: a systematic review and meta-analysis. Ophthalmology. 2014 Nov;121(11):2081-90. doi: 10.1016 / j.ophtha.2014.05.013. Epub 2014 Jun 26. PMID: 24974815.). With the development of China's social economy, due to population aging and the improvement of detection accuracy, the proportion of patients with primary open angle glaucoma has been increasing year by year and has become the main type of glaucoma in China.

[0003] Aqueous humor (AH) is produced by the ciliary body, flows into the anterior chamber through the gap between the iris and the lens, and is drained out of the eye through the aqueous humor drainage pathway. The aqueous humor drainage pathway mainly includes the trabecular meshwork (TM) pathway and the uveoscleral pathway. 80-90% of the aqueous humor drainage depends on the TM pathway, which is mainly concentrated in the cribriform trabecular meshwork tissue and the endothelial cell layer of Schlemm's canal located at the base of the cornea and adjacent to the ciliary body. The maintenance of the trabecular meshwork tissue function plays a crucial role in the aqueous humor circulation and intraocular pressure balance. However, along with the aging process and the pathogenesis of primary open-angle glaucoma, the trabecular meshwork tissue structure and function are damaged to varying degrees, and the number of trabecular meshwork cells decreases significantly, resulting in reduced AH outflow and increased intraocular pressure (IOP), ultimately leading to cell stress, dysfunction, and death of retinal ganglion cells, thus causing vision loss.

[0004] Among the many pathogenic factors of primary open-angle glaucoma, a key risk factor for TM dysfunction is gene mutation. Therefore, gene therapy brings hope for the treatment of TM dysfunction. Given the physiological and anatomical characteristics of TM tissue, gene therapy has great application prospects: (i) The eye has immune privilege characteristics, and (ii) The TM tissue is located at the limbus corneae, and due to the transparency of the cornea, the TM tissue is clearly visible. The above advantages facilitate the possibility of gene therapy to reshape the TM tissue. Means such as the regulation of the extracellular matrix, cytoskeleton, and cell volume have all achieved a reduction in intraocular pressure in various glaucoma animal models. Nevertheless, the gene therapy targets for TM tissue remodeling are extremely limited.

[0005] Long non-coding RNA nuclear paraspeckle assembly transcript 1 (NEAT1), as a kind of "structural RNA", is an essential RNA molecule for the formation of nuclear substructures. Human NEAT1 contains two transcriptional isoforms: NEAT1_1 (3.7 kb) and NEAT1_2 (23 kb). Among them, NEAT1_2 is the structural scaffold of nuclear paraspeckles. Nuclear paraspeckles are assembled by NEAT1_2 and its recruited RNA-binding proteins (including NONO, SFQP, FUS, TDP43, etc.). Nuclear paraspeckles drive liquid-liquid phase separation to form a dynamic, membraneless, stratified cell nucleus. Research shows that nuclear paraspeckles are involved in the occurrence and development of various diseases such as viral infections, neurodegenerative diseases, autoimmune diseases, inflammatory diseases, and cancers.

[0006] NEAT1_2 matures in the nucleus, and its 3'-end mimics the tRNA-like structure, recruiting RNase P to cleave and generate menRNA. Subsequently, ELAC2 (RNase Z) cleaves the 3'-tail of menRNA, and the CCA-adding enzyme adds a 3'-CCA tail to menRNA. The addition of two rounds of CCACCA recruits exonuclease A to degrade menRNA intracellularly. Although menRNA faces the fate of being rapidly degraded in the nucleus, it has been reported that menRNA escaping into the cytoplasm has unique functions, such as innate immune regulation. However, there is still no research and report on the role of menRNA in primary open-angle glaucoma, especially in the TM tissue, in the prior art. Summary of the Invention

[0007] Aiming at the problems existing in the prior art, the purpose of the present invention is to provide the application of menRNA in screening and / or preparing drugs for treating trabecular meshwork tissue injury. The present invention discovers for the first time by comparison that the expression level of menRNA in iPSC-TM cells is significantly higher than that in pTM cells. Further experiments confirm that overexpression of menRNA has the function of promoting paraspeckle assembly, playing a role in promoting cell proliferation and cell reprogramming, laying a foundation for subsequent research on the diagnosis and treatment methods of primary open-angle glaucoma and exploring the pathogenesis of primary open-angle glaucoma.

[0008] The purpose of the present invention is achieved by the following technical solutions: The first aspect of the present invention provides the application of a reagent for detecting the expression level of menRNA in screening drugs for remodeling trabecular meshwork tissue, wherein the sequence of the menRNA is as shown in SEQ ID NO. 1: GGCGCUGGUGGUGGCACGUCCAGCACGGCUGGGCCGGGGUUCGAGUCCCCGCAGUGUUG.

[0009] Furthermore, the method for screening drugs for remodeling trabecular meshwork tissue includes: 1) Treat a system expressing and / or containing menRNA with a candidate substance; set a parallel control without treating with the candidate substance; 2) After completing step 1), detect the expression level of menRNA in the system; compared with the parallel control, if the expression level of menRNA in the system treated with the candidate substance is significantly increased, the candidate substance can be used as a candidate drug for remodeling trabecular meshwork tissue.

[0010] The second aspect of the present invention provides the application of a biological material overexpressing menRNA in preparing drugs for treating trabecular meshwork tissue injury, wherein the sequence of the menRNA is as shown in SEQ ID NO. 1.

[0011] Furthermore, the expression level of menRNA in a biological material is detected. When menRNA is overexpressed, it is determined that the biological material can be used to prepare a drug for remodeling trabecular meshwork tissue.

[0012] The third aspect of the present invention provides the use of menRNA in the preparation of a drug for treating trabecular meshwork tissue injury, wherein the sequence of the menRNA is as shown in SEQ ID NO. 1.

[0013] Furthermore, the drug is one or more of the following: (1) The drug can promote the high expression of menRNA in trabecular meshwork tissue cells; (2) The drug can promote paraspeckle assembly, and further promote the proliferation and reprogramming of trabecular meshwork tissue cells.

[0014] The fourth aspect of the present invention provides a drug for remodeling trabecular meshwork tissue, wherein the drug can promote the expression of menRNA in trabecular meshwork tissue cells.

[0015] Furthermore, the drug includes menRNA and its transcription agent. Preferably, the transcription agent is Lipofectamine TM 3000-menRNA.

[0016] The beneficial effects of the present invention compared with the prior art are as follows: 1. For the first time, the present invention constructs Lipofectamine TM 3000-menRNA and finds that overexpression of menRNA can promote the formation of paraspeckles and the high expression of the proliferation marker protein Ki-67, suggesting the important role of the menRNA-Ki-67 signaling pathway in promoting the proliferation of trabecular meshwork cells. Overexpression of menRNA can promote the proliferation of TM cells and remodel TM tissue, laying a theoretical foundation for screening drugs for remodeling trabecular meshwork tissue.

[0017] 2. For the first time, the present invention discovers that Lipofectamine TM 3000-menRNA stimulates the primary TM cells to highly express stem cell and neural crest cell markers, and the cell morphology changes. The rejuvenation of TM cells plays a key role in remodeling trabecular meshwork tissue. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The present invention will be further described below with reference to the drawings and embodiments: Figure 1 Immunofluorescence images of ITGA6 and NONO (marking paraspeckles) proteins in iPSC-TM cells and pTM cells described in Example 1 and a violin plot of paraspeckle quantification, scale bar: 10 μm; Figure 2 Bar chart of menRNA degradation efficiency of iPSC-TM cells and pTM cells; Figure 3 Bar chart of the fold change in the mRNA expression level of menRNA in pTM cells after transfection with menRNA and control for 12 h, 24 h, 36 h, and 48 h; Figure 4 Immunofluorescence images and nuclear speckle quantification violin plots of NONO (marking nuclear speckles) protein in pTM cells after transfection with menRNA and control for 12 h and 48 h. Scale bar: 10 μm; Figure 5 Immunofluorescence images (DAPI staining nuclei) of pTM cells after transfection with menRNA and control for 48 h and quantitative bar chart of pTM cells. Scale bar: 100 μm; Figure 6 Bar chart of the fold change in the mRNA expression level of stem cell markers and cell proliferation markers in pTM cells after transfection with menRNA and control for 12 h, 24 h, 36 h, and 48 h; Figure 7 Bar chart of the fold change in the mRNA expression level of stem cell markers and neural crest cell markers in pTM cells after transfection with menRNA and control for 12 h, 24 h, 36 h, and 48 h; Figure 8 Morphological change images of pTM cells after transfection with menRNA and control for 12 h and 48 h. Scale bar: 100 μm. Detailed implementation manners

[0019] To better understand the present invention, the present invention will be further described in detail below with reference to the accompanying drawings, so that those skilled in the art can implement it according to the description.

[0020] It should be noted that the experimental methods described in the following specific examples are all conventional methods unless otherwise specified, and the reagents and materials are all commercially available unless otherwise specified.

[0021] The main reagents and materials in the following examples include: NONO antibody: NONO Antibody (NOVUS, NB100-1556); ITGA6 antibody: ITGA6 monoclonal antibody (Abcam, ab20142); menRNA: Tsingke Biological; The basal medium used for cell culture in the examples: MEM-α basic medium.

[0022] Primary TM cells (pTM cells) are TM cells isolated from normal human eye donors and are commercially available. The pTM cells in the examples are from the Lion Eye Bank in the United States.

[0023] iPSC-TM cells (TM cells differentiated from induced pluripotent stem cells): The preparation process refers to Zhu W et al., Transplantation of iPSC-TM stimulates division of trabecular meshwork cells in human eyes. Sci Rep. 2020 Feb 19;10(1):2905. doi: 10.1038 / s41598-020-59941-0. PMID: 32076077; PMCID: PMC7031365. This literature evaluated whether transplantation of induced pluripotent stem cell-derived TM-like cells (iPSC-TM cells) could restore the structure and function of human eye TM cells obtained from elderly donors. The study showed that transplantation of iPSC-TM cells could stimulate the proliferation of endogenous TM cells. Example 1

[0024] In this example, the expression levels of paraspeckles in the nuclei of iPSC-TM cells and pTM cells were quantitatively analyzed respectively.

[0025] (1) Experimental method: 1×10 4 iPSC-TM cells and pTM cells were respectively seeded on 14 mm cell culture slides. 100 μL of MEM-α basic medium containing 10% serum was added to each cell culture slide, and the cells were cultured in an incubator at 37°C and 5% CO 2 for 48 h. From CO 2Take out the culture media of iPSC-TM cells and pTM cells from the incubator, aspirate and discard the cell supernatant, wash the cells 3 times with 1×PBS buffer for 5 minutes each time; fix the cells with 4% paraformaldehyde for 15 minutes; wash the cells 3 times with 1×PBS buffer for 5 minutes each time, add 200 μL of 0.3% Tritonx-100 to each cell slide, and incubate at room temperature for 5 minutes; aspirate 0.3% Tritonx-100, add 200 μL of blocking solution (1% BSA solution containing 0.3% Tritonx-100) to each cell slide, and incubate at room temperature for 1 h; dilute the primary antibody with the blocking solution, add 200 μL of the diluted primary antibody to each cell slide, and incubate overnight at 4 °C; wash the cells 3 times with 1×PBS buffer for 5 minutes each time, dilute the secondary antibody with 1×PBS buffer, add 200 μL of the diluted secondary antibody to each cell slide, and incubate in the dark at room temperature for 1 h; wash the cells 3 times with 1×PBS buffer for 5 minutes each time, add 200 μL of DAPI working solution to each cell slide, and incubate in the dark at room temperature for 15 minutes; wash the cells 3 times with 1×PBS buffer for 5 minutes each time, mount the slides with a mounting medium containing an anti-fluorescence quencher, dry in the dark, and perform fluorescence photography under a 100-fold confocal microscope. The statistical analysis of the paraspeckle quantification results was performed using GraphPad Prism.

[0026] (2)Experimental results: The immunofluorescence results and paraspeckle quantification analysis results of ITGA6 and NONO proteins in iPSC-TM cells and pTM cells are as Figure 1 shown. The results show that the number of paraspeckles in iPSC-TM cells is significantly higher than that in pTM cells, and the number of paraspeckles is closely related to cell proliferation, suggesting that paraspeckle assembly is an important factor for iPSC-TM cells to promote the proliferation of pTM cells. Example 2

[0027] In this example, the degradation efficiency of menRNA in iPSC-TM cells and pTM cells was detected respectively.

[0028] (1)Experimental method: Seed 1.5×10 6 iPSC-TM cells and pTM cells into 6 cm culture dishes respectively, add 2 mL of MEM-α basic medium containing 10% serum to each culture dish, and place them in an incubator at 37 °C and 5% CO 2 for 48 h. From CO 2Take out the iPSC-TM cells and pTM cell culture medium from the incubator, centrifuge to separate the cell pellet and cell supernatant. Wash the cell pellet twice with pre-cooled 1×PBS buffer, add 1 mL / tube of Trizol reagent, and lyse on ice for 2 min. Transfer the sample to a 1.5 mL EP tube, add 200 μL of pre-cooled chloroform, shake vigorously for 15 s, let stand on ice for 15 min, and centrifuge at 4°C and 12,000 rpm for 15 min. After centrifugation, the sample is divided into three layers. The top layer is a colorless aqueous phase. Carefully aspirate and transfer it to a 1.5 mL EP tube, add 500 μL of pre-cooled isopropanol, shake vigorously for 15 s, let stand on ice for 15 min, and centrifuge at 4°C and 10,000 rpm for 15 min. The feathery precipitate at the bottom of the tube is RNA. Discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 4°C and 7,500 rpm for 5 min, and repeat this step twice. Dry in the fume hood for 10 min. When the precipitate at the bottom of the tube becomes transparent, add 10 μL of enzyme-free water and let stand in a 60°C oven for 10 min to dissolve the RNA. Take 1 μL of the RNA sample and quantify it using Nanodrop. Judge its purity by A260 / A280. A ratio between 1.8 and 2.0 indicates good purity. Use a reverse transcription kit and a real-time quantitative kit to complete RT-PCR quantitative analysis. Store the remaining samples at -80°C. Detect the mRNA expression levels of NEAT1_2 and menRNA in iPSC-TM cells and pTM cells by RT-PCR. 1 - (mRNA expression level of menRNA / mRNA expression level of NEAT1_2) × 100% is the degradation efficiency of menRNA.

[0029] (2)Experimental results: The results of the degradation efficiency of menRNA in iPSC-TM cells and pTM cells are as Figure 2 shown. The RT-PCR results show that menRNA in pTM cells is basically degraded, while there is still some menRNA in iPSC-TM cells, and its expression level is significantly higher than that in pTM cells, further suggesting that menRNA may be a key signal mediating pTM cell division by iPSC-TM cells and plays an important role in promoting pTM cell proliferation. Example 3

[0030] In this example, menRNA and control were transfected into pTM cells to detect the overexpression efficiency of menRNA in pTM cells at different time points.

[0031] (1)Experimental method: One day before transfection, 5×10 5pTM cells were seeded in 6-well plate culture dishes, and 2 mL of MEM-α basic medium containing 10% serum was added to each dish. The dishes were placed in an incubator at 37°C and 5% CO 2 for culturing until the cell density at the time of transfection reached 70%. The cell supernatant was aspirated; 3.75 μL of Lipofectamine TM 3000 transfection reagent (shaken well before use) was added to 125 μL of Opti-MEM™ medium for dilution, and gently mixed and incubated at room temperature for 5 min; 2.5 μL of RNA (100 μmol / mL) was taken and diluted with 125 μL of Opti-MEM™ medium, and gently mixed evenly; the diluted Lipofectamine TM 3000 transfection reagent was gently mixed with the diluted RNA after 5 min of incubation, and left standing at room temperature for 15 min to form an RNA-lipid complex; the RNA-lipid complex was added to the culture dish, and 2.25 mL of MEM-α basic medium was supplemented to each dish, and the culture dish was gently shaken to mix evenly, and then cultured in an incubator at 37°C and 5% CO 2 for 6 h, then the medium was changed to fresh MEM-α basic medium containing 10% serum for continued culture; the mRNA expression level of menRNA was detected by RT-PCR at 12 h, 24 h, 36 h, and 48 h after transfection. Among them, the RNA used in the experimental group was menRNA, and the control group did not contain RNA, only Lipofectamine TM 3000 transfection reagent was used as the control.

[0032] The sequence of menRNA is shown in SEQ ID NO. 1: GGCGCUGGUGGUGGCACGUCCAGCACGGCUGGGCCGGGGUUCGAGUCCCCGCAGUGUUG.

[0033] (2) Experimental results: The expression levels of menRNA mRNA in pTM cells treated with menRNA and control are as Figure 3 shown. The RT-PCR results showed that compared with the control group of control, after treatment with menRNA for 12 h, 24 h, and 36 h, the expression level of menRNA mRNA in pTM cells was upregulated by hundreds of times. However, after treatment with menRNA for 48 h, due to the intracellular degradation mechanism of menRNA, compared with treatment with menRNA for 12 h, the expression level of menRNA mRNA was significantly decreased. Example 4

[0034] This example explored the effects of menRNA overexpression on the assembly of paraspeckles in the nucleus and the proliferation ability of pTM cells.

[0035] (1) Experimental method: One day before transfection, 1×10 4 pTM cells were seeded on 14 mm cell culture slides, and 100 μL of MEM-α basic medium containing 10% serum was added to each cell culture slide. The cells were incubated in an incubator at 37°C and 5% CO 2 for 24 h to ensure that the cell density at the time of transfection reached 70%. The cell supernatant was aspirated; 0.375 μL of Lipofectamine TM 3000 transfection reagent (shaken well before use) was added and diluted with 12.5 μL of Opti-MEM™ medium. After gentle mixing, it was incubated at room temperature for 5 min; 0.25 μL of RNA (100 μmol / mL) was taken and diluted with 12.5 μL of Opti-MEM™ medium, and gently mixed evenly; after the diluted Lipofectamine TM 3000 transfection reagent was incubated for 5 min, it was gently mixed with the diluted RNA and left standing at room temperature for 15 min to form an RNA-lipid complex; the RNA-lipid complex was added to the culture dish, and 225 μL of MEM-α basic medium was added to each slide. The culture dish was gently shaken to mix evenly, and then incubated in an incubator at 37°C and 5% CO 2 for culture. After 6 h, the medium was replaced with fresh MEM-α basic medium containing 10% serum for continued culture; immunofluorescence detection was performed 12 h and 48 h after transfection. Among them, the RNA used in the experimental group was menRNA, and the control group did not contain RNA, only an equal amount of Lipofectamine TM 3000 transfection reagent was used as the control.

[0036] (2) Experimental results: The immunofluorescence results and paraspeckle quantification results of NONO protein in pTM cells treated with menRNA and control are as Figure 4 shown. The results show that compared with the control group, the number of paraspeckles in pTM cells increased significantly after 12 h and 48 h of menRNA treatment, indicating that menRNA promoted the assembly of paraspeckles in pTM cells.

[0037] The immunofluorescence results and pTM cell quantification results of pTM cells after 48 h of treatment with menRNA and control are as Figure 5 shown. The results show that after 48 h of menRNA overexpression, the proliferation ability of pTM cells was also enhanced. Example 5

[0038] This example explored the effects of menRNA overexpression on the expression levels of stem cell markers, proliferation markers, and neural crest cell markers in pTM cells and the changes in cell morphology.

[0039] (1)Experimental method: The specific experimental methods and steps were the same as those in Example 3, except that: stem cell markers, proliferation markers, and neural crest cell markers were detected 12h, 24h, 36h, and 48h after transfection of menRNA and Control.

[0040] (2)Experimental results: The expression levels of menRNA mRNA in pTM cells treated with menRNA and control were as Figure 6 、 Figure 7 shown. RT-PCR results showed that compared with the control group, after treatment with menRNA for 12h, 24h, 36h, and 48h, the expression levels of stem cell markers (ZFP42, TBX3, TFAP2C, CER1, DUSP6, NANOG, SOX2), proliferation marker (Ki-67), and neural crest markers (FOXC1, PITX2, SOX10, NES) were up-regulated to varying degrees at different time points, and the cell morphology changed ( Figure 8 ), with long cell processes appearing, indicating that menRNA overexpression can not only promote the proliferation of pTM cells, but also stimulate the high expression of stem cell and neural crest cell markers in pTM cells, promote the rejuvenation of pTM cells, and play a key role in remodeling the trabecular meshwork tissue.

[0041] Finally, it should be noted that the above is only used to illustrate the technical solution of the present invention and not to limit it. Although the present invention has been described in detail with reference to the preferred arrangement, those of ordinary skill in the art should understand that the technical solution of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. Use of a reagent for detecting the expression of menRNA in screening drugs for remodeling trabecular meshwork tissue, characterized in that: The sequence of the menRNA is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: Methods for screening drugs that remodel the trabecular meshwork include: 1) Treating a system expressing and / or containing menRNA with a candidate substance; setting up a parallel control without treatment with the candidate substance; 2) After completing step 1, detecting the expression level of menRNA in the system; if the expression level of menRNA in the system treated with the candidate substance is significantly increased compared with the parallel control, the candidate substance can be used as a candidate drug for reshaping trabecular meshwork tissue.

3. Use of a biomaterial overexpressing menRNA in the preparation of a drug for treating trabecular meshwork tissue damage, characterized in that: The sequence of the menRNA is shown in SEQ ID NO.

1.

4. The use according to claim 3, characterized in that: The expression level of menRNA in the biomaterial is detected. When menRNA is overexpressed, it is determined that the biomaterial can be used to prepare a drug for reshaping trabecular meshwork tissue.

5. Use of menRNA in the preparation of a drug for treating trabecular meshwork tissue damage, characterized in that: The sequence of the menRNA is shown in SEQ ID NO.

1.

6. The use according to claim 5, characterized in that: The drug is one or more of the following: (1) The drug can promote the high expression of menRNA in trabecular meshwork tissue cells; (2) The drug can promote paranuclear plaque assembly, thereby promoting trabecular meshwork tissue cell proliferation and cell reprogramming.

7. A drug for remodeling trabecular meshwork tissue, characterized in that: The drug can promote the expression of menRNA in trabecular meshwork tissue cells.

8. The drug according to claim 7, characterized in that The drugs include menRNA and transcription agents thereof.

9. The drug according to claim 8, characterized in that The transcription agent includes Lipofectamine TM 3000-menRNA.

Images