SiRNA for inhibiting amyloid precursor protein (APP) gene expression, medicine and application thereof
Patent Information
- Application Number
- CN202480002336.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-03-28
- Filing Date
- 2024-09-26
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art is difficult to effectively inhibit the expression of amyloid precursor protein (APP) genes, especially in the central nervous system, making it difficult to control the progression of diseases such as Alzheimer's.
A non-viral permeable blood-brain barrier-targeting siRNA composition was developed to enable siRNA delivery using ligands of low-density lipoprotein receptor-associated protein (LRP1) interaction with the receptor.
This method can effectively inhibit APP gene expression, reduce amyloid β deposition, inflammation and behavioral defects, and has potential applications in the treatment of Alzheimer's disease and other neurodegenerative diseases.
Abstract
Description
siRNA, drugs and their applications for inhibiting amyloid precursor protein (APP) gene expression
[0001] The present invention claims priority to Chinese patent application No. 2023112749104 filed on September 28, 2023 and Chinese patent application No. 2024103688731 filed on March 28, 2024, both of which are incorporated herein by reference. Technical Field
[0002] The present invention belongs to the field of biomedicine, and in particular relates to siRNA, drugs and applications thereof for inhibiting the expression of amyloid precursor protein (APP) genes. Background Art
[0003] Alzheimer's disease (AD) is one of the most common neurodegenerative diseases worldwide and a major cause of disability in the elderly. It is characterized by a gradual decline in cognitive ability. In 2019, AD affected more than 50 million people worldwide and is expected to reach 152 million by 2050, resulting in a huge socioeconomic burden (Guzman-Martinez L et al., Curr Alzheimer Res. 2019; 16(6): 518-528.). Current clinical treatments for AD include the use of acetylcholinesterase inhibitors or N-methyl-D-aspartate receptor antagonists. However, these drugs can only mildly improve cognition and behavior in patients with AD and cannot slow disease progression (Versijpt J et al., 2014; 42 Suppl 3: S19-S25.). The reason is that the etiology and pathogenesis of AD are not yet fully understood. Currently, it is generally accepted that plaques composed of aggregated amyloid β protein (Aβ), neurofibrillary tangles containing hyperphosphorylated tau protein, and neuroinflammation are the pathological characteristics of AD (Li R et al., Proc Natl Acad Sci US A. 2004; 101(10): 3632-3637.). Among them, Aβ peptides containing a large number of hydrophobic amino acids are prone to form self-aggregates associated with synaptotoxicity and neurodegeneration. Abnormal accumulation of Aβ peptides is considered to be a key pathogenic event of AD.
[0004] Aβ peptides are derived from protease cleavage of amyloid precursor protein (APP), an integral membrane protein expressed in neurons and glia. Aβ peptides are generated by sequential cleavage by malic lipase β (BACE1) and γ-secretase (Shankar GM et al,. Nat Med. 2008; 14(8): 837-842.). Given the large number of substrates for γ-secretase and the harmful consequences of its pharmacological inhibition, BACE1 is considered a more suitable target for regulating the Aβ peptide pathway. The strategy of reducing Aβ levels by inhibiting BACE1 activity is considered a potential treatment for AD (Vassar R et al,. 2014; 130(1): 4-28.). Currently, a skin patch for BACE1 inhibitor treatment has entered Phase III clinical trials (Doody RS et al,. N Engl J Med. 2013; 369(4): 341-350.). However, due to target toxicity and safety reasons, several BACE1 small molecule inhibitors have failed to enter the clinic. APP, as a precursor protein that directly produces Aβ peptide, is considered to be a potential target for the treatment of AD or other neurodegenerative diseases.
[0005] Compared to traditional small molecule drugs, small interfering RNA (siRNA) drugs utilize endogenous cellular systems to specifically degrade targeted target genes, offering promising clinical therapeutic prospects. Mechanistically, exogenously introduced double-stranded siRNAs are recognized by the cellular endoribonuclease Dicer and cleaved into a single-stranded guide strand and its complementary strand by the RNA-induced silencing complex (RISC). The guide stranded siRNA then binds to the Argonate 2 protein (AGO2) and directs it to the target RNA, where AGO2 mediates its degradation. In addition to degrading RNAs in the cytoplasm, siRNAs can also promote chromosome remodeling and histone modification in the nucleus, leading to transcriptional silencing (Matzke et al. Nature reviews. Genetics vol. 6, 1 (2005): 24-35.). The delivery of siRNA drugs is an important guarantee for RNAi therapy. The most mature siRNA intrahepatic delivery system currently uses N-oligosaccharide acetylgalactosamine (GalNAc) to specifically bind to the asialoglycoprotein receptor (ASGPR) specifically expressed by hepatocytes, thereby achieving active delivery to liver cells. It is an important breakthrough in the field of RNA therapy (Zhang L et al,. Front Pharmacol. 2022; 13: 1090237.). In addition to liver tissue, researchers have found that adenovirus targeting mouse brain containing BACE1 siRNA shows the potential to improve AD pathology (Zhou Y et al,. Sci Adv. 2020; 6(41): eabc7031.). However, effective, safe and comprehensive siRNA extrahepatic delivery systems still face huge challenges, especially in brain tissue where the blood-brain barrier exists.
[0006] Regarding the development of RNAi therapeutic drugs targeting the central nervous system, researchers have established a system of chemically modified siRNAs linked to fatty alcohol 2'-O-hexadecyl (C16) (Nat Biotechnol. 2022 Oct; 40(10): 1500-1508.). Intraventricular injection of C16-siRNA targeting APP into Alzheimer's mice reduced amyloid β deposition, inflammation, and behavioral deficits. Similarly, after administration of C16-siRNA into the central nervous system of non-human primates, extensive siRNA distribution and RNAi activity were achieved, with target gene silencing greater than 75% for at least 3 months. This provides an important technical platform for extrahepatic targeted therapy of RNAi drugs (Brown KM et al,. Nat Biotechnol. 2022; 40(10): 1500-1508.). In addition, utilizing target cell surface receptor proteins to achieve transcellular transport of drugs across the blood-brain barrier is also an important approach for drug delivery to the central nervous system. Among them, low-density lipoprotein receptor-related protein (LRP1) is widely expressed in neurons and brain endothelial cells. It is a multifunctional endocytic receptor that participates in many biological processes, including the transport of metabolites (Aβ peptides) across the blood-brain barrier. Therefore, it is a very attractive target for drug delivery to the central nervous system (Ulery PG et al,. J Biol Chem. 2000; 275(10): 7410-7415.). LRP1 has multiple ligands, reflecting its multiple physiological functions. In recent years, researchers have developed a transport peptide called Angiopep-2 (ANG2), which can be used to transport drugs coupled to ANG2 to brain tissue by utilizing its interaction with the LRP1 receptor. Among them, ANG2-mediated paclitaxel delivery is the first example, and clinical trials have been conducted (Régina A et al,. Br J Pharmacol. 2008; 155(2): 185-197.).
[0007] The present invention will develop an effective non-viral siRNA composition targeting APP that can penetrate the blood-brain barrier, and develop a delivery method for the siRNA composition by utilizing the principle of interaction between LRP1 ligand and receptor.
[0008] Summary of the Invention
[0009] Based on this, the purpose of the present invention is to provide a siRNA or a pharmaceutically acceptable salt thereof, a conjugate (drug) and its use for inhibiting the expression of the amyloid precursor protein (APP) gene. The siRNA and its conjugate have the advantages of good in vitro and in vivo test effects and weak toxicity.
[0010] In the first aspect of the present invention, an siRNA or a pharmaceutically acceptable salt thereof for inhibiting APP gene expression is provided, which comprises a sense chain and an antisense chain, wherein the base composition of the siRNA is each corresponding group of sense chains and corresponding antisense chains in Table 1, or a sequence that differs from any of the sense chains and corresponding antisense chains shown in Table 1 by no more than 1 nucleotide.
[0011] Preferably, the siRNA targeting the APP gene is composed of any of the following sequences in Table 2, or a sequence that differs from its sense chain or antisense chain by no more than 1 nucleotide: 12006.1-1, 12006.2-4, 12037.1-1, 12037.2-4, 12075.1-1, 12075.2-4, 12076.1-1, 12076.2-4.
[0012] The second aspect of the present invention provides a conjugate for inhibiting APP gene expression, wherein the conjugate comprises any of the siRNAs or pharmaceutically acceptable salts thereof, and a targeted delivery ligand connected to the siRNA, or a targeted delivery carrier encapsulating the siRNA.
[0013] The third aspect of the present invention provides the use of any of the above-mentioned siRNAs or pharmaceutically acceptable salts thereof, or any of the above-mentioned conjugates in the preparation of a biological preparation or a pharmaceutical preparation for inhibiting APP expression.
[0014] A fourth aspect of the present invention is to provide a method for inhibiting APP gene expression, the method comprising:
[0015] (a) contacting a cell with any one of the above-mentioned siRNAs or a pharmaceutically acceptable salt thereof, or any one of the above-mentioned conjugates; and
[0016] (b) maintaining the cells produced in step (a) for a time sufficient to obtain degradation of the mRNA transcripts expressed by APP, thereby simultaneously inhibiting the expression of APP in the cells.
[0017] The fifth aspect of the present invention is to provide use of any of the aforementioned siRNAs or any of the aforementioned conjugates in the preparation of drugs for preventing or treating diseases mediated by the APP gene.
[0018] The sixth aspect of the present invention is to provide a method for preventing or treating diseases mediated by the APP gene, wherein a suitable dose of any of the above-mentioned siRNAs for inhibiting the expression of the amyloid precursor protein (APP) gene or its pharmaceutically acceptable salt or its pharmaceutically acceptable salt, or any of the above-mentioned conjugates is administered to the subject.
[0019] The present invention studies siRNA sequences that inhibit APP gene expression and screens multiple siRNAs that can effectively inhibit APP expression. On this basis, the siRNA sequences are appropriately modified to enhance the silencing ability of the target and reduce non-target activity.
[0020] Another aspect of the present invention is that a novel and unique delivery system is employed to enable the siRNA to be delivered to the brain of the patient to exert its active effect. Therefore, the siRNA of the present invention is expected to be clinically applied to prevent and treat diseases related to the APP target, such as cerebral amyloid angiopathy (CAA), early-onset familial Alzheimer's disease (EOFAD), or Alzheimer's disease (AD). DETAILED DESCRIPTION
[0021] To facilitate understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the present disclosure more thorough and comprehensive.
[0022] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to manufacturer recommendations. All commonly used chemical reagents used in the examples were commercially available.
[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which this invention pertains. The terms used in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items. The abbreviations and structures of nucleotide monomers used in nucleic acid sequence representations are as follows:
[0024] The specific structure is as follows:
[0025] One aspect of the present invention relates to an siRNA or a pharmaceutically acceptable salt thereof for inhibiting the expression of the APP gene in human cells, wherein the siRNA comprises a sense chain and an antisense chain, wherein the sense chain comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides, which differs from any of the sense chain sequences shown in Table 1 by no more than 3 nucleotides; and wherein the antisense chain comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides, which differs from any of the antisense chain nucleotide sequences shown in Table 1 by no more than 3 nucleotides.
[0026] The base composition of the siRNA of the present invention is each corresponding sense strand and corresponding antisense strand in Table 1, or differs from any sense strand and corresponding antisense strand nucleotide sequence shown in Table 1 by no more than 1 nucleotide.
[0027] Preferably, the siRNA targeting the APP gene is composed of any one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide:
[0028] A) 12006: the sense strand thereof is shown in SEQ ID NO: 11, and the antisense strand thereof is shown in SEQ ID NO: 12;
[0029] B) 12037: the sense strand thereof is shown in SEQ ID NO: 75, and the antisense strand thereof is shown in SEQ ID NO: 76;
[0030] C) 12075: the sense strand thereof is shown in SEQ ID NO: 151, and the antisense strand thereof is shown in SEQ ID NO: 152;
[0031] D) 12076: The sense strand thereof is shown in SEQ ID NO: 153, and the antisense strand thereof is shown in SEQ ID NO: 154.
[0032] The present invention also provides a method for modifying the above-mentioned multi-stranded siRNA, which is used to improve the stability and activity of siRNA in vivo and in vitro and to reduce non-target activity. The nucleotides of the sense strand and the antisense strand are modified, the sense strand includes no more than 3, 2, 1 or 0 unmodified nucleotides, the modified nucleotides in the sense strand include 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2'-fluoro modified nucleotides, reverse abasic residues, and the 5'-end and 3'-end of the sense strand contain 0, or 1, or 2, or 3 phosphorothioate bonds; and the antisense strand includes no more than 3, 2, 1 or 0 unmodified Nucleotides, the modified nucleotides in the antisense chain include 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2'-fluorine modified nucleotides, VPU (2'-O-methyluridine-5'-(E)-vinyl phosphate-3'-phosphate), VPU-S (2'-S-methyluridine-5'-(E)-vinyl phosphate-3'-phosphate) or other VPU derivatives, and the 5'-end and 3'-end of the antisense chain each contain 1-3 phosphorothioate bonds.
[0033] In some embodiments, the modified double-stranded siRNA is selected from any double-stranded siRNA in Table 2, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide; preferably, the siRNA is selected from any of the following in Table 2: 12006.1-1, 12006.2-4, 12037.1-1, 12037.2-4, 12075.1-1, 12075.2-4, 12076.1-1, 12076.2-4.
[0034] A modified siRNA having better biological activity of inhibiting APP gene expression, which is selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide:
[0035] a) 12006.2-4: its 5'-3' sense strand is mC*mA*mCmAmAmGmUmUfCfUfUfUmGfAmGmCmAmGmAmUmA, and its 5'-3' antisense strand is VPU-S*fA*mUmCmUmGmCmUmCmAmAdAmGfAmAfCmUmUmG*mU*mG;
[0036] b) 12037.2-4: its 5'-3' sense strand is mG*mC*mUmGmUmCmCmAfAfGfAfUmGfCmAmGmCmAmGmAmA, and its 5'-3' antisense strand is VPU-S*fU*mCmUmGmCmUmGmCmAmUdCmUfUmGfGmAmCmA*mG*mC;
[0037] c) 12075.2-4: its 5'-3' sense strand is mC*mA*mAmGmUmCmUmAfCfCfCfUmGfAmAmCmUmGmCmAmA, and its 5'-3' antisense strand is VPU-S*fU*mGmCmAmGmUmUmCmAmGdGmGfUmAfGmAmCmU*mU*mG;
[0038] d) 12076.2-4: Its 5'-3' sense strand is mG*mG*mUmCmUmAfCfCfCfUmGfAmAmCmUmGmCmAmA, and its 5'-3' antisense strand is VPU-S*fU*mGmCmAmGmUmUmCmAmGdGmGfUmAfGmAmCmC*mU*mC.
[0039] Among them, VPU-S is 2'-S-methyluridine-5'-(E)-vinylphosphonate-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, and fA is 2'-fluoroadenosine-3'-phosphate , fU is 2'-fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, and * is a phosphorothioate bond.
[0040] The second aspect of the present invention provides a conjugate for inhibiting APP gene expression, wherein the conjugate comprises any of the above-mentioned siRNAs or pharmaceutically acceptable salts thereof, and a targeted delivery ligand connected to the siRNA, or a targeted delivery carrier encapsulating the siRNA.
[0041] The targeted delivery carrier encapsulating the siRNA may be a lipid nanoparticle, such as LNP (Lipid Nanoparticle).
[0042] In some embodiments, the targeted delivery ligand includes at least one polypeptide targeting low-density lipoprotein receptor-related protein 1 (LRP1) or transferrin receptor (TfR), and a compound (linker) connecting the polypeptide and any of the siRNAs.
[0043] One end of the linker can be connected to the polypeptide via a chemical bond, such as a covalent bond, and the other end can also be connected to the siRNA via a chemical bond, such as a covalent bond.
[0044] In some of these embodiments, siRNA is delivered to the CNS via a polypeptide targeting LRP1 or TfR.
[0045] In some embodiments, the LRP1-targeting polypeptide is at least one ANG2 polypeptide. In some preferred embodiments, the amino acid sequence of the ANG2 polypeptide from N-terminus to C-terminus is as follows: TFFYGGSRGKRNNFKTEEY (SEQ ID NO: 185). The at least one ANG2 polypeptide can be one, two, three, or four ANG2 polypeptides. In some embodiments, the targeted delivery ligand contains two ANG2 polypeptides, which has a better effect on maintaining siRNA activity.
[0046] When there are two ANG2 polypeptides, they are connected in parallel to the groups at both ends of the linker, that is, the two ANG2 polypeptides are connected in parallel to the two terminal groups of the linker.
[0047] Those skilled in the art can also select other suitable compositions of polypeptides targeting LRP1 as needed, such as TFFYGGCRGKRNNFKTEEY (SEQ ID NO: 186).
[0048] In some embodiments, the linker is linked to the ANG2 polypeptide at the N-terminus or the lysine side chain amino group of each polypeptide, preferably, the compound is linked to the 10th lysine of each ANG2 polypeptide.
[0049] In some embodiments, the linker is connected to the 3' end or 5' end of the sense strand of the siRNA via a chemical bond, preferably, the chemical bond is a phosphate bond or a phosphorothioate bond, respectively.
[0050] In some embodiments, the structure of the linker connecting the polypeptide and the siRNA is selected from any one of the following:
[0051] Wherein X and Y are O or CH2; R is O or S; p and q are integers of 0-4, and k is 1, 2, 4 or 8.
[0052] In some preferred embodiments, the structure of the linker connecting the polypeptide and the siRNA is selected from any one of the following:
[0053] In some embodiments, the targeted delivery ligand structure after the ANG2 polypeptide and siRNA are connected via a linker is any one of the following:
[0054] Wherein X and Y are O or CH2; R is O or S; p and q are integers of 0-4, and k is 1, 2, 4 or 8.
[0055] In some preferred embodiments, the targeted delivery ligand structure after the ANG2 polypeptide and the siRNA are connected via a linker has a better delivery effect, and is any one of the following:
[0056] Some embodiments of the present invention relate to the use of the above-mentioned siRNA or a pharmaceutically acceptable salt thereof, or the above-mentioned conjugate in the preparation of a biological preparation or a pharmaceutical preparation for inhibiting the expression of the APP gene.
[0057] In some embodiments of the present invention, a method for inhibiting APP gene expression in a cell is provided, comprising:
[0058] (a) contacting a cell with any siRNA of the present invention or a pharmaceutically acceptable salt thereof or any of the above conjugates; and
[0059] (b) maintaining the cells produced in step (a) for a time sufficient to obtain degradation of the mRNA transcripts expressed by the APP gene, thereby simultaneously inhibiting the expression of the APP gene in the cells.
[0060] As is generally understood in the art, contacting can be performed directly or indirectly. For example, the siRNA or siRNA conjugate can be brought into physical contact with the cell by the individual performing the method, or the siRNA or conjugate can be placed in a situation that allows or results in its subsequent contact with the cell.
[0061] In some embodiments, the cell is in a subject, or the cell is ex vivo from a subject.
[0062] In some embodiments, the subject is a mammal, including a primate (eg, a human, a non-human primate, such as a monkey and a chimpanzee), or a non-primate. Preferably, the mammal is a human, a rat, or a mouse.
[0063] In some embodiments, APP expression is inhibited by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.
[0064] Some embodiments of the present invention relate to the use of the siRNA or any of the above-mentioned conjugates in the preparation of drugs for preventing or treating diseases mediated by the APP gene.
[0065] In some embodiments, the disease mediated by the APP gene includes but is not limited to cerebral amyloid angiopathy (CAA), early-onset familial Alzheimer's disease (EOFAD) or Alzheimer's disease (AD).
[0066] The sixth aspect of the present invention is to provide a method for preventing or treating diseases mediated by the APP gene, wherein a suitable dose of any of the above-mentioned siRNAs for inhibiting APP gene expression or its pharmaceutically acceptable salt or its pharmaceutically acceptable salt, or any of the above-mentioned conjugates is administered to the subject.
[0067] A suitable dose, also referred to herein as a "therapeutically effective amount," when administered to an individual suffering from an APP-related disorder is sufficient to achieve treatment of the disease (e.g., by reducing, ameliorating, or maintaining an existing disease or one or more symptoms of the disease). A "therapeutically effective amount" can vary depending on the siRNA or conjugate, the mode of administration, the disease and its severity and medical history, age, weight, family history, genetic makeup, type of previous or concomitant treatment (if any), and other individual characteristics of the subject to be treated.
[0068] As used herein, a "prophylactically effective amount" is intended to include an amount of siRNA or conjugate that, when administered to an individual suffering from an APP-related disorder, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease, including slowing the progression of the disease or reducing the severity of the disease that later develops. A "prophylactically effective amount" may vary depending on the siRNA or conjugate, the mode of administration, the degree of disease risk, and medical history, age, weight, family history, genetic makeup, type of previous or concomitant treatment, and any other individual characteristics of the patient to be treated.
[0069] "Therapeutically effective amount" or "prophylactically effective amount" also includes the amount of siRNA or a drug consisting of a conjugate that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The siRNA or drug consisting of a conjugate used in the methods of the present application can be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.
[0070] According to existing technologies, those skilled in the art know that the pharmaceutically acceptable salt of the siRNA may be a sodium salt or a potassium salt. For example, a sodium salt of the siRNA is produced during purification.
[0071] Human APP mRNA NCBI Reference Sequence: NM_000484.4.
[0072] Mouse APP mRNA NCBI Reference Sequence: NM_001198823.
[0073] Rat APP mRNA NCBI Reference Sequence: NM_019288.
[0074] The present invention is further described in detail below with reference to specific embodiments.
[0075] Example 1 Synthesis of siRNA
[0076] Oligonucleotides were synthesized in 0.2–1 μmol batches using a solid-phase oligonucleotide synthesis protocol on a 12-channel nucleic acid synthesizer at Beijing Qingke Biotechnology Co., Ltd. An aminolysis reagent was added to the synthesized oligonucleotides and incubated at 45–80°C to separate the oligonucleotides from the solid support and free them. The crude oligonucleotides were then precipitated with ethanol, and the supernatant was discarded by high-speed centrifugation twice to obtain the crude oligonucleotides. The precipitate was then resuspended in DEPC-treated water. The crude oligonucleotides were purified by ion-pairing HPLC, and the collected product was dried to a powder in a vacuum centrifuge. The purified product was dissolved in DEPC-treated water and analyzed by time-of-flight liquid chromatography-mass spectrometry (TOF-LC-MS). The oligonucleotide concentration was determined, and the required volumes of equimolar amounts of the sense and antisense strands were calculated. The equimolar amounts of the sense and antisense strands were mixed and then annealed to form a double-stranded double-stranded double strand by heating at 95°C for 5 minutes and then cooling to room temperature.
[0077] Table 1: Sequences of the sense and antisense strands of unmodified siRNA targeting the APP gene
[0078] Next, we modified the siRNA to improve its stability in vitro and in vivo, enhance its activity against the target, and reduce its activity against non-target sites.
[0079] Duplex AD-454973 is the sequence with the best activity in patent number US11034957B2. The modified sequence of the sense chain is mG*mG*mCmUmAmCmGmAdAmAdAmUmCmCmAmAmCmCmU*mA*mA, and the modified sequence of the antisense chain is VPU*fU*mAmGmGmUGNA-TmGmGmAmUdTmUfUmCdGmUmAmGmCmC*mG*mU, which is used as a positive reference.
[0080] Table 2: Modified siRNA sequences targeting the APP gene
[0081] Among them, VPU-S is 2'-S-methyluridine-5'-(E)-vinylphosphonate-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, and fA is 2'-fluoroadenosine-3'-phosphate. Ester, fU is 2'-fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, * is a phosphorothioate bond
[0082] Example 2 In vitro screening of siRNA using liposome transfection in Hep3B and U87-MG cells
[0083] Cell culture and 96-well plate transfection: In vitro experiments were performed in Hep3B and U87-MG cells using MEM + 10% FBS + 1X penicillin-streptomycin + 1X non-essential amino acids. When the cell confluence area reached 80%, the cells were trypsinized and the cell density was determined using a Scepter automated cell counter (Millipore, #PHCC00000). siRNA, Opti-MEM, and INTERFERin (Polyplus) were mixed in a 96-well plate and incubated at room temperature for 10 minutes. Complete medium containing the cells was then added to each well, and the 96-well plate was incubated in a 37°C, 5% CO2 incubator for 24 hours.
[0084] 96-well plate RNA extraction and reverse transcription: Oligo d(T)25 Magnetic Beads reagent (NEB) was used to extract mRNA from cells in a 96-well plate. The medium in the 96-well plate was aspirated, and the plate was washed once with DPBS. 100 μl of cell lysis buffer was added to each well, followed by 20 μl of beads. The plate was shaken on a shaker. The 96-well plate was placed on a magnetic separation rack, and the lysate was aspirated. 100 μl of wash buffer A was added to each well, and the plate was placed on a magnetic separation rack. Wash buffer A was aspirated, and the beads were then aspirated with 100 μl of wash buffer B. The beads were then transferred to a new 96-well plate, placed on a magnetic separation rack, and wash buffer B was aspirated. The beads were then aspirated with 100 μl of low-salt buffer and transferred to a 96-well PCR plate. The 96-well PCR plate was placed on a magnetic separation rack, and the low-salt buffer was aspirated. 10 μL of elution buffer was added to each well, and the beads were aspirated. The plate was incubated at 50°C for 2 minutes to elute the mRNA from the beads. Prepare the reverse transcription system using StarScript Pro Genstar One-Tube Genome-Free Reverse Transcription Master Mix (genstar). Aliquot 5 μL per well of a 96-well PCR plate. Add 5 μL of the mRNA solution from the previous step and mix thoroughly. Centrifuge briefly and seal the plate with a film sealer. Incubate on a PCR instrument at 37°C for 3 minutes, 50°C for 50 minutes, and then at 85°C for 2 minutes. Cool to 4°C to complete reverse transcription.
[0085] Real-time fluorescence quantitative PCR: After reverse transcription, place the 96-well plate on a magnetic separation rack until the beads are adsorbed to the bottom. Aspirate the reverse transcription reagent, add the prepared QPCR system to the 96-well PCR plate, seal the plate with a film, and perform PCR on a StepOnePlus Real-Time PCR System (Applied Biosystems). Data are analyzed using the ΔΔCt method and normalized using cells transfected with a negative control sequence at the same concentration.
[0086] The sequence of the negative control AD-1955 is as follows:
[0087] Sense strand: CUUACGCUGAGUACUUCGAdTdT (SEQ ID NO: 177)
[0088] Antisense strand: UCGAAGUACUCAGCGUAAGdTdT (SEQ ID NO: 178).
[0089] The primers for detecting APP are as follows:
[0090] Forward primer: CCTTCCCGTGAATGGAGAGTT (SEQ ID NO: 179)
[0091] Reverse primer: CTGGTCGAGTGGTCAGTCC (SEQ ID NO: 180)
[0092] Probe: CCTGGACGATCTCCAGCCGTGG (SEQ ID NO: 181) (reporter gene 5' FAM, quencher group 3' BHQ1)
[0093] The primers for detecting GAPDH are as follows:
[0094] Forward primer: GACAGTCAGCCGCATCTTC (SEQ ID NO: 182)
[0095] Reverse primer: ACTCCGACCTTCACCTTCC (SEQ ID NO: 183)
[0096] Probe: CGCCAGCCGAGCCACATCGC (SEQ ID NO: 184) (reporter gene 5'VIC, quencher 3'MGB).
[0097] Table 3: Experimental results of lipofectamine transfection of 10nM and 1nM modified siRNA in Hep3B cells
[0098] Table 4: Experimental results of 10 nM modified siRNA transfection in U87-MG cells by liposome
[0099] Table 5: Experimental results of lipofectamine transfection of 10 nM and 1 nM modified siRNA in U87-MG cells
[0100] Table 6: Experimental results of lipofectamine transfection of 10 nM and 1 nM modified siRNA in rat primary hepatocytes
[0101] Table 7: Experimental results of 10 nM modified siRNA transfection in primary mouse hepatocytes by liposome
[0102] Based on the above in vitro results, multiple sequences such as 12006.1-1 showed good activity in human, rat and mouse cells. Subsequently, the sequences with good activity were linked to polypeptides to form polypeptide oligonucleotide conjugates for in vivo activity verification experiments.
[0103] Example 3 Stability detection of different siRNA sequences targeting APP
[0104] The experimental method for siRNA stability study is as follows:
[0105] 1. Accurately dilute the test compound sequence with DEPC water to a working concentration of 10 μM.
[0106] 2. Preparation of liver homogenate: Weigh 200 mg of mouse liver, add 1 mL of potassium phosphate buffer and 5 magnetic beads, and homogenize three times in a grinder at 60 Hz, 30 s / time to obtain 200 mg / mL liver homogenate.
[0107] 3. Preparation of 72h samples: Take 17μL of 10μM test compound / positive compound working solution, add 153μL of liver homogenate, mix, vortex for 30s, take 75μL of the compound and liver homogenate mixed solution into an EP tube, the number of parallel samples is 2, and place it in a 37℃ incubator for 72h. After incubation, remove 50μL.
[0108] 4. Preparation of 0h samples: Take 75μL of liver homogenate in an EP tube, with 2 replicates, and incubate at 37°C for 72h. After incubation, take out 45μL of liver homogenate, add 5μL of 10μM test compound / positive compound, and mix well.
[0109] 5. After incubation, add 5 μL of 50 μg / ml internal standard to each tube of sample, mix well, add 100 μL of lysis buffer to each tube, vortex for 30 seconds, and let it stand for 20 minutes.
[0110] 6. After all samples were treated with appropriate pretreatment methods, the supernatant was taken for instrumental analysis. The relative residual rate (%) was then calculated as (72h compound content / 0h compound content) × 100%.
[0111] Table 8: Liver homogenate stability test results of different siRNA sequences targeting APP
[0112] As can be seen from Table 8, different sequences have different stabilities in liver homogenate, among which sequences 12006.1-1, 12075.1-3, and 12076.1-3 are much more stable than the positive reference AD-454913.
[0113] Example 4. Synthesis of polypeptide
[0114] Peptide synthesis at a 0.2 mmol scale was performed on a PurePep Chorus 4-channel peptide synthesizer according to conventional solid-phase peptide synthesis protocols, such as those described in Adam G et al., Standard practices for Fmoc-based solid-phase peptide synthesis in the Nowick laboratory. The conditions of the main process are as follows: (1) Resin swelling: Fmoc-Tyr-Wang Resin and Rink-Amide-MBHA-Resin were placed in DMF and swelled at room temperature for 30 minutes; (2) Deprotection: The resin was treated with a DMF solution containing 20% piperidine at 50°C for 2 minutes; (3) Amino acid condensation: 5eq (1eq of resin) Fmoc amino acid, HCTU as a condensing agent (5eq), DIPEA (5eq) as a base, and the reaction was carried out at 50°C for 10 minutes; (4) N-terminal acetyl: 5% N-acetylimidazole, the reaction was carried out at room temperature for 1 hour; (5) TFA cleavage: After the synthesis was completed, the resin was treated with a cleavage reagent containing TFA (TFA / Tips / H2O=95:2.5:2.5; TFA / Tips / EDT / H2O=92.5:2.5:2.5:2.5) for more than 2 hours, the resin was filtered and discarded, and the filtrate was collected. (6) Precipitation and purification: Add pre-cooled anhydrous ether to the filtrate and centrifuge to obtain a white precipitate. Wash the precipitate three times with anhydrous ether and dry under reduced pressure at room temperature to obtain a crude polypeptide product as an off-white powder. Dissolve the crude polypeptide in acetonitrile / water and purify it by high performance liquid chromatography.
[0115] For peptides with 6-azido modifications on the lysine side chain, the synthesis process and conditions are essentially the same as those described above, with the following differences: (1) Fmoc-Lys(Mtt)-OH is used instead of the conventional Fmoc-Lys(Boc)-OH amino acid raw material; (2) after solid-phase synthesis, the Mtt protecting group on the lysine side chain amino group is selectively removed using a DCM solution containing 2% TFA, and the peptide is then cleaved after reacting with 6-azidohexanoic acid under the conventional condensation conditions described above.
[0116] According to the above method, the theoretical and measured molecular weights of the polypeptides synthesized in the present invention are shown in Table 9 below.
[0117] Table 9: Theoretical and measured molecular weights of synthetic peptides
[0118] Example 5 Synthesis of Ang2(K10N3)
[0119] Ang2(K10Mtt)-Wang Resin was synthesized on a 0.2 mmol scale on a PurePep Chorus 4-channel peptide synthesizer according to the conditions described in Example 4. 20 mL of DCM and 0.4 mL of TFA were added to Ang2(K10Mtt)-Wang Resin, and the mixture was shaken at room temperature for 15 min. The resin was then washed three times with DCM to obtain Ang2(K10NH2)-Wang Resin. Ang2(K10NH2)-Wang Resin was placed in 15 mL of DMF, and 6-azidohexanoic acid (157 mg, 1 mmol), HCTU (414 mg, 1 mmol), and DIEA (129 mg, 1 mmol) were added sequentially. The mixture was shaken at room temperature for 1 hour, washed with DMF and DCM, and cleaved with TFA at room temperature for 2 h. The mixture was precipitated with diethyl ether and purified by high-performance liquid chromatography to obtain the target peptide Ang2(K10N3) (150 mg,
[0120] White powdery solid) (theoretical molecular weight: 2482.70, measured molecular weight: 1242.30 [M+2H] 2+ ).
[0121] Example 6 Synthesis of Peptide Ang2-Ang2-AZK
[0122] Ang2-Wang resin was synthesized on a PurePep Chorus 4-channel peptide synthesizer at a 0.2 mmol scale according to the conditions described in Example 4. Ang2-Wang resin was mixed with 1.5 equivalents of 3-maleimidopropionic acid hydroxysuccinimide ester (BMPS) and reacted for 1 h to obtain maleimido-Ang2-Wang resin. Maleimido-Ang2 was then cleaved with TFA (TFA / Tips / H₂O = 95:2.5:2.5), precipitated with ether, and purified by HPLC. 1 eq of maleimido-Ang2 and 1.1 eq of AZK-Ang-Cys were dissolved in a DMF / H₂O (1:1) mixture and reacted at room temperature for 2 h. After completion of the reaction, monitored by LC-MS, the product was evaporated under reduced pressure. The residue was dissolved in acetonitrile / water and purified by HPLC to yield 25 mg of the target peptide, Ang2-Ang2-AZK (theoretical molecular weight: 5010.46, measured: 1002.8 [M+5H]). 5+ ).
[0123] Example 7 Synthesis of Compound B08
[0124] 1. Synthesis of Compound B08-1
[0125] Compound [2-[2-(Fmoc-amino)ethoxy]ethoxy]acetic acid (10 g, 26.0 mmol), DIEA (6.7 g, 52.0 mmol), and HBTU (10.8 g, 28.6 mmol) were dissolved in DMF (100 mL) and stirred at room temperature for 5 min. Compound 17 (11.4 g, 27.3 mmol) was then dissolved in DMF (20 mL) and added to the reaction solution. The reaction system was stirred at room temperature for 2 h. The reaction mixture was added to saturated NaHCO₃ and extracted with DCM. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and separated by column chromatography (DCM / MeOH = 100:1, 2% TEA) to obtain 17.4 g of a colorless oil with a yield of 85.2%. LCMS: 786.9, found: 808.9 [M+Na] + .
[0126] 2. Synthesis of Compound B08-2
[0127] B08-1 (8.0 g, 10.2 mmol) was dissolved in EA (76 mL), and diethylamine (12.6 g) was added. The reaction system was stirred at room temperature overnight. The reaction solution was concentrated under reduced pressure and separated by column chromatography (DCM / MeOH = 20:1, 0.5% TEA → 10:1, 0.1% TEA) to obtain 3.8 g of the product as a white foamy solid, with a yield of 66.2%. LCMS: 564.7, found: 565.8 [M+H] + .
[0128] 3. Synthesis of Compound B08-3
[0129] B08-2 (2.0 g, 3.5 mmol) was dissolved in ACN (35 ml), and ethyl trifluoroacetate (1.3 g, 8.8 mmol) was added. The reaction system was stirred at room temperature overnight. The reaction solution was concentrated and separated by column chromatography (DCM / MeOH = 30:1, 0.1% TEA) to obtain 1.87 g of the product as a white foamy solid, with a yield of 79.9%. LCMS: 660.7, found: 682.7 [M+Na] + .
[0130] 4. Synthesis of Compound B08
[0131] B08-3 (1.5 g, 2.3 mmol) and DIPEA (0.9 g, 6.8 mmol) were dissolved in anhydrous DCM (10 mL). Cyanoethyl-N,N-diisopropylchlorophosphoramidite (0.6 g, 2.7 mmol) was added, and the reaction system was stirred at room temperature for 1 h. The reaction mixture was concentrated at 30°C and separated by column chromatography (PE, 2% TEA → PE / EA = 4:1, 2% TEA) to give 0.8 g of the product as an off-white foamy solid in a 38.8% yield. LCMS: 860.9, found: 861.9 [M+H] + .
[0132] Example 8 Synthesis of Compound B12
[0133] 1. Synthesis of Compound B12-1
[0134] Compound 6-heptynoic acid (0.35 g, 2.77 mmol), DIEA (0.90 g, 6.94 mmol), and HATU (1.16 g, 3.05 mmol) were dissolved in DMF (15 mL) and stirred at room temperature for 5 min. Compound B08-2 (1.64 g, 2.91 mmol) was then dissolved in DMF (15 mL) and added to the reaction solution. The reaction system was stirred at room temperature for 2 h. The reaction mixture was added to saturated NaHCO₃ and extracted with DCM. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and separated by column chromatography (DCM / MeOH = 100:1, 2% TEA) to obtain 0.5 g of a colorless oil, with a yield of 26.8%. LCMS: 672.8 found: 695.0 [M+Na] + .
[0135] 2. Synthesis of Compound B12
[0136] Compound B12-1 (0.5 g, 0.74 mmol) and DIEA (0.3 g, 2.25 mmol) were dissolved in anhydrous DCM (10 mL). Cyanoethyl-N,N-diisopropylchlorophosphoramidite (0.21 g, 0.89 mmol) was added, and the reaction system was stirred at room temperature for 1 h. The reaction mixture was concentrated at 30°C and separated by column chromatography (PE, 2% TEA → PE / EA = 4:1, 2% TEA) to give 0.39 g of the product as an off-white foamy solid in a 60.1% yield. LCMS: 873.0, found: 874 [M+H] + .
[0137] Example 9 Synthesis of dipeptide linker BPL-1
[0138] Step 1. Preparation of N6-(tert-Butoxycarbonyl)-N2-(6-((tert-Butoxycarbonyl)amino)hexanoyl)-L-lysine methyl ester (Compound A3): A mixture of N6-(tert-Butoxycarbonyl)-L-lysine methyl ester (5.0 g, 19.2 mmol, 1.0 eq), tert-Butoxycarbonyl 6-aminohexanoic acid (4.89 g, 21.1 mmol, 1.1 eq), and N,N-diisopropylethylamine (5.46 g, 42.3 mmol, 2.2 eq) in dichloromethane was stirred at room temperature. 1-Hydroxybenzotriazole (5.71 g, 42.3 mmol, 2.2 eq) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (8.08 g, 42.3 mmol, 2.2 eq) were then added and the mixture was allowed to react for 1 hour. Spot plate (DCM:MeOH=30:1, R f =0.3) and LCMS monitoring, the reaction was complete, and dichloromethane was added to dilute the reaction solution for extraction. The organic layer was washed twice with saturated sodium bicarbonate and then twice with saturated ammonium chloride, and dried over anhydrous sodium sulfate. The filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: dichloromethane:methanol) to obtain the product N6-(tert-butoxycarbonyl)-N2-(6-((tert-butoxycarbonyl)amino)hexanoyl)-L-lysine methyl ester (8.5 g, yield: 93.8%). MS (ES) + ):m / z=474(M+H) + .
[0139] Step 2. Preparation of (6-aminohexanoyl)-L-lysine methyl ester (Compound A4): N6-(tert-butoxycarbonyl)-N2-(6-((tert-butoxycarbonyl)amino)hexanoyl)-L-lysine methyl ester (1.0 g, 2.11 mmol, 1.0 equiv) and a solution of hydrogen chloride in dioxane (10 mL, 2 mol / L) were mixed and reacted for 1.5 hours at room temperature. The reaction was complete as monitored by LCMS. The reaction solution was concentrated under reduced pressure, water (30 mL) was added, and sodium hydroxide solution was added to adjust the pH to approximately 7-8. The aqueous phase was concentrated under reduced pressure using an oil pump. The resulting solid was washed with a solution of dichloromethane / methanol (10 / 1) with stirring. The filtrate was filtered and concentrated under reduced pressure to afford (6-aminohexanoyl)-L-lysine methyl ester (450 mg, yield: 77.9%) as a pale yellow oil. MS (ES) + ):m / z=274(M+H) + .
[0140] Step 3. Preparation of N6-((((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)-N2-(6-(1R,8S,9r)-bicyclo[6.1.0]non-4-en-9-ylmethoxy)carbonyl)amino)hexanoyl)-L-lysine methyl ester (Compound A5): Under nitrogen protection, (6-aminohexanoyl)-L-lysine methyl ester (450 mg) was added. , 1.65 mmol, 1.0 equiv), ((1R,8S,9S)-bicyclo[6.1.0]non-4-yn-9-yl)methyl(2,5-dioxopyrrolidin-1-yl)carbonate (960 mg, 3.29 mmol, 2.0 equiv) and N,N-diisopropylethylamine (468 mg, 3.63 mmol, 2.2 equiv) in N,N-dimethylformamide (5 ml) were stirred at room temperature for 1 hour. Spot plate (DCM:MeOH=10:1, R f =0.4) and LCMS monitoring, the reaction was complete, and after cooling to room temperature, the solvent was evaporated under reduced pressure. The residue was diluted with water (20 ml) and extracted with dichloromethane / methanol = 10 / 1 (30 ml). The organic layer was washed with brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was purified by column chromatography (eluent: dichloromethane / methanol = 30 / 1) to obtain a white solid N6-((((1R, 8S, 9s)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)-N2-(6-(1R, 8S, 9r)-bicyclo[6.1.0]non-4-en-9-ylmethoxy)carbonyl)amino)hexanoyl)-L-lysine methyl ester (280 mg, yield: 27.1%). MS (ES + ):m / z=626(M+H) + .
[0141] Step 4. Preparation of N6-((((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)-N2-(6-(1R,8S,9r)-bicyclo[6.1.0]non-4-en-9-ylmethoxy)carbonyl)amino)hexanoyl)-L-lysine (Compound A6): To a mixture of tetrahydrofuran, methanol, and water (6 ml) was added (280 mg, 0.448 mmol, 1.0 equiv) of (1R, 8S, 9r)-bicyclo[6.1.0]non-4-en-9-ylmethoxy)carbonyl)amino)hexanoyl)-L-lysine methyl ester (280 mg, 0.448 mmol, 1.0 equiv). A lithium hydroxide (13 mg, 0.538 mmol, 1.2 equiv) aqueous solution (1 ml) was then added, and the mixture was stirred at room temperature for 1 hour. Following completion of the reaction as monitored by LCMS, the reaction solution was concentrated under reduced pressure, water (30 ml) was added, and the pH was adjusted to approximately 3-4 by adding 1 mol / L dilute hydrochloric acid. The mixture was diluted with water (20 ml), and extracted with dichloromethane (30 ml). The organic layer was washed with brine and dried over anhydrous sodium sulfate, and the organic phase was concentrated under reduced pressure to give N6-((((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)-N2-(6-(1R,8S,9r)-bicyclo[6.1.0]non-4-en-9-ylmethoxy)carbonyl)amino)hexanoyl)-L-lysine (220 mg, yield: 80.2%) as a white solid. MS (ES) + ):m / z=612(M+H) + .
[0142] Step 5. Preparation of 2,5-dioxopyrrolidin-1-yl N6-((1R,8S,9s)-bicyclo[6.1.0]non-4-yl-9-yl)methoxy)carbonyl)-N2-(6-(1R,8S,9r)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)amino)hexanoyl)-L-lysine salt (BPL-1): N6-(((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)-N2- (6-(1R,8S,9r)-bicyclo[6.1.0]non-4-en-9-ylmethoxy)carbonyl)amino)hexanoyl)-L-lysine (220 mg, 0.36 mmol, 1.0 eq), N-hydroxysuccinimide (49.7 mg, 0.43 mmol, 1.2 eq), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (82.5 mg, 0.432 mmol, 2.2 eq) were added to dichloromethane, and the mixture was stirred at room temperature for 1.5 hours. LCMS monitoring confirmed the completion of the reaction, and the reaction solution was diluted with dichloromethane and extracted. The organic layer was washed twice with saturated sodium bicarbonate and then twice with saturated ammonium chloride, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. A white solid 2,5-dioxopyrrolidin-1-yl (N6-((1R,8S,9s)-bicyclo[6.1.0]non-4-yl-9-yl)methoxy)carbonyl)-N2-(6-(1R,8S,9r)-bicyclo[6.1.0]non-4-yn-9-yl)methoxy)carbonyl)amino)hexanoyl)-L-lysine salt (200 mg, yield: 78.7%) was obtained and used directly in the next reaction without purification. MS (ES) + ):m / z=709(M+H) + .
[0143] Example 10 Synthesis of dipeptide linker BPL-2
[0144] Step 1. Preparation of (S)-22-(2,2-dimethyl-4,13-dioxo-3,8-11-trioxa-5,14-diazaoctadec-18-yl)-2,2-dimethyl-4,3,20-trioxa-3,8,11-trioxa-5,14,21-triazatricosan-23-oic acid methyl ester (Compound B1): (6-aminohexanoyl)-L-lysine methyl ester (3.0 g, 10.9 mmol, 1.0 eq), 2,2-dimethyl-4-oxo-3,8-11-trioxa-5,14-diazaoctadec-18-yl)-2,2-dimethyl-4,3,20-trioxa-3,8,11-trioxa-5,14,21-triazatricosan-23-oic acid methyl ester were added at room temperature. A mixture of 3,8,11-trioxo-5-azatridecane-13-oic acid (6.35 g, 24.2 mmol, 2.2 eq.) and N,N-diisopropylethylamine (5.7 ml, 32.9 mmol, 3.0 eq.) in dichloromethane was stirred uniformly, and then 1-hydroxybenzotriazole (3.7 g, 27.5 mmol, 2.5 eq.) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (5.24 g, 27.5 mmol, 2.5 eq.) were added and reacted for 1 hour. The plate was stirred (DCM:MeOH=20:1, R f =0.3) and LCMS monitoring, the reaction was complete, and dichloromethane was added to dilute the reaction solution and extract. The organic layer was washed twice with saturated sodium bicarbonate and then washed twice with saturated ammonium chloride, dried over anhydrous sodium sulfate, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane:methanol) to obtain the product (S) 22-(2,2-dimethyl-4,13-dioxo-3,8-11-trioxa-5,14-diazaoctadecane-18-yl)-2,2-dimethyl-4,3,20-trioxa-3,8,11-trioxa-5,14,21-triazatricosane-23-oic acid methyl ester (3.9 g, yield: 46.8%), MS (ES) + ):m / z=764(M+H) + .
[0145] Step 2. Preparation of methyl-N2-(6-(2-(2-(2-(2-aminoethoxy)ethoxy)acetylamino)hexanoyl)-N6-(2-(2-(2-aminoethoxy)ethoxy)acetyl)-L-lysine ester (Compound B2): Methyl-22-(2,2-dimethyl-4,13-dioxo-3,8-11-trioxa-5,14-diazaoctadec-18-yl)-2,2-dimethyl-4,3,20-trioxa-3,8,11-trioxa-5,14,21-triazatricosan-23-oate (3.9 g, 5.11 mmol, 1.0 eq) and hydrogen chloride were added at room temperature. The mixture was stirred with a dioxane solution (40 mL, 2 mol / L) for 1.5 hours. The reaction was complete under LCMS monitoring. The reaction solution was concentrated under reduced pressure, and water (30 mL) was added. Sodium hydroxide solution was added to adjust the pH to approximately 7-8. The aqueous phase was concentrated under reduced pressure using an oil pump. The resulting solid was washed with a solution of dichloromethane / methanol = 10 / 1, stirred, and filtered. The filtrate was concentrated under reduced pressure to afford methyl N2-(6-(2-(2-(2-(2-aminoethoxy)ethoxy)acetylamino)hexanoyl)-N6-(2-(2-(2-aminoethoxy)ethoxy)acetyl)-L-lysine ester (2.9 g, yield: 85.8%) as a pale yellow oil. MS (ES) + ):m / z=564(M+H) + .
[0146] Step 3. Preparation of (S)-2-(6,15-dioxo-8,11-dioxo-5,14-diazaicos-20-yn-1-yl)-4,11,20-trioxo-13,16-dioxo-3,10,19-triazahexadec-25-ynoic acid methyl ester (Compound B3): Methyl N2-(6-(2-(2-(2-(2-(2-aminoethoxy)ethoxy)acetylamino)hexanoyl)-N6-(2-(2-(2-aminoethoxy)ethoxy)acetyl)-L-lysine ester (440 mg, A mixture of dichloromethane (0.691 mmol, 1.0 equivalent), 6-heptynoic acid (178 mg, 1.41 mmol, 2.04 equivalent), N,N-diisopropylethylamine (263 μl, 1.52 mmol, 2.2 equivalent) was stirred evenly, and then 1-hydroxybenzotriazole (205 mg, 1.52 mmol, 2.2 equivalent) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (290 mg, 1.52 mmol, 2.2 equivalent) were added and reacted for 1 hour. Spot plate (DCM:MeOH=20:1, R f=0.2) and LCMS monitoring, the reaction was complete, and dichloromethane was added to dilute the reaction solution and extract. The organic layer was washed twice with saturated sodium bicarbonate and then washed twice with saturated ammonium chloride, dried over anhydrous sodium sulfate, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane:methanol) to obtain the product (S)-2-(6,15-dioxo-8,11-dioxo-5,14-diazaicos-20-yn-1-yl)-4,11,20-trioxo-13,16-dioxo-3,10,19-triazahexadec-25-ynoic acid methyl ester (310 mg, yield: 57.6%), MS (ES) + ):m / z=780(M+H) + .
[0147] Step 4. Preparation of (S)-2-(6,15-dioxo-8,11-dioxo-5,14-diazaicos-20-yn-1-yl)-4,11,20-trioxo-13,16-dioxo-3,10,19-triazahexadec-25ynoic acid (Compound B4): Methyl (8,11-dioxo-5,14-diazaicos-20-yn-1-yl)-4,11,20-trioxo-13,16-dioxo-3,10,19-triazahexadec-25-ynoate) (310 mg, 0.398 mmol, 1.0 equiv) was added to a mixture of tetrahydrofuran, methanol, and water (6 mL). A solution of lithium hydroxide (20.1 mg, 0.478 mmol, 1.2 equiv) in water (1 mL) was then added and stirred at room temperature for 1 hour. The reaction was complete as monitored by LCMS. The reaction mixture was concentrated under reduced pressure, water (25 mL) was added, and the pH was adjusted to approximately 3-4 with 1 mol / L dilute hydrochloric acid. The mixture was diluted with water (20 mL) and extracted with dichloromethane (25 mL). The organic layer was washed with brine, dried over anhydrous sodium sulfate, and the organic phase was concentrated under reduced pressure to give a white solid (S) 2-(6,15-dioxo-8,11-dioxo-5,14-diazaicos-20-yn-1-yl)-4,11,20-trioxo-13,16-dioxo-3,10,19-triazahexadec-25-ynoic acid (290 mg, yield: 95.4%). 1H NMR (500MHz, CDCl3) δ6.90 (s, 2H), 6.83 (d, J = 8.3Hz, 1H), 6.55 (s, 2H), 4.15–4.10 (m,1H),3.69–3.62(m,4H),3.55(s,8H),3.50(t,J=4.8Hz,10H),3.41–3.35(m,10H ),2.45–2.36(m,4H),2.32(t,J=6.8Hz,2H),2.24(t,J=6.9Hz,2H),2.15(dt,J=7. 1,6.2Hz,7H),1.89(dd,J=15.2,8.1Hz,4H),1.72–1.64(m,4H),1.52–1.46(m,4H). MS(ES + ):m / z=766(M+H) + .
[0148] Step 5. Preparation of BPL-2: Compound B4 (290 mg, 0.38 mmol) was dissolved in 4 mL of dichloromethane, and N-hydroxysuccinimide (52 mg, 0.46 mmol, 1.2 eq.) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (88 mg, 0.46 mmol, 1.2 eq.) were added in sequence. The mixture was stirred at room temperature for 1.5 hours. The reaction was completed under LCMS monitoring. Dichloromethane was added to dilute the reaction solution and extracted. The organic layer was washed twice with saturated sodium bicarbonate and then washed twice with saturated ammonium chloride, dried over anhydrous sodium sulfate, and the organic phase was concentrated under reduced pressure. BPL-2 (310 mg, yield: 94.5%) was obtained as a white viscous solid and used directly in the next step without purification. MS (ES) + ):m / z=864(M+H) + .
[0149] Example 11 Synthesis of dipeptide linker BPL-3
[0150] Step 1. Preparation of (S)-1-((1R, 8S, 9s)-bicyclo[6.1.0]non-4-yl-9-yl)-21-(1-(1R, 8S, 9s)-bicyclo[6.1.0]hept-4-yl)-3,12-dioxo-2,7,10-trioxa-4,13-diazaheptadecan-17-yl)-3,12,19-trioxy-2,7,10-trioxa-4,13,20-triazadocosa-22-oic acid methyl ester (Compound C1): Under nitrogen protection, methyl N2-(6-(2-(2-(2-(2-aminoethoxy)ethoxy)acetamido) A solution of ((1R,8S,9S)-bicyclo[6.1.0]non-4-yn-9-yl)methyl(2,5-dioxopyrrolidin-1-yl)carbonate (928 mg, 3.19 mmol, 2.0 equiv) and N,N-diisopropylethylamine (450 mg, 3.49 mmol, 2.2 equiv) in N,N-dimethylformamide (10 ml) was stirred at room temperature for 1 hour. A plate (DCM:MeOH=10:1, R f =0.3) and LCMS monitoring showed that the reaction was complete. After cooling to room temperature, the solvent was evaporated under reduced pressure. The residue was diluted with water (30 ml) and extracted with dichloromethane / methanol = 10 / 1 (30 ml). The organic layer was washed with brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The crude product was purified by column chromatography (eluent: dichloromethane / methanol = 30 / 1) to give (S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-yl-9-yl)-21-(1-(1R,8S,9s)-bicyclo[6.1.0]hept-4-yl)-3,12-dioxo-2,7,10-trioxa-4,13-diazaheptadecan-17-yl)-3,12,19-trioxy-2,7,110-trioxa-4,13,20-triazadocosan-22-oic acid methyl ester (580 mg, yield: 39.8%) as a white solid. MS (ES) + ):m / z=916(M+H) + .
[0151] Step 2. Preparation of (S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-butan-9-yl)-21-(1-(1R,8S,9)-bicyclo[1.1.0]non-4-butan-9-yl)-3,12-dioxo-2,7,10-trioxa-4,13-diazaheptadecan-17-yl)-3,12,19-trioxa-2,7,110-trioxa-4,13,20-triazadocosan-22-oic acid (Compound C2): (S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-yl-9-yl)-21-(1-(1R,8S,9s)-bicyclo[6.1.0]hept-4- Methyl (3,12-dioxo-2,7,10-trioxa-4,13-diazaheptadecan-17-yl)-3,12,19-trioxy-2,7,110-trioxa-4,13,20-triazadocosan-22-oate (300 mg, 0.327 mmol, 1.0 eq) was added to a mixture of tetrahydrofuran, methanol, and water (7.5 mL). Aqueous lithium hydroxide (9.5 mg, 0.40 mmol, 1.2 eq) (0.5 mL) was then added and stirred at room temperature for 1 hour. The reaction was complete as monitored by LCMS. The reaction mixture was concentrated under reduced pressure, water (25 mL) was added, and the pH was adjusted to approximately 3-4 with 1 mol / L dilute hydrochloric acid. The mixture was diluted with water (25 mL) and extracted with dichloromethane (30 mL). The organic layer was washed with brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give a white solid (S)-1-((1R, 8S, 9s)-bicyclo[6.1.0]non-4-butan-9-yl)-21-(1-(1R, 8S, 9)-bicyclo[1.1.0]non-4-butan-9-yl)-3,12-dioxo-2,7,10-trioxa-4,13-diazaheptadecan-17-yl)-3,12,19-trioxa-2,7,110-trioxa-4,13,20-triazadocosan-22-oic acid (260 mg, yield: 88.4%). MS (ES) + ):m / z=902(M+H) + .
[0152] Step 3. Preparation of 2,5-dioxopyrrolidin-1-yl-(S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)-21-(1-((1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)-3,12-dioxo-2,7,10-trioxo-4,13-diazaheptadecan-17-yl)-3,12,19-trioxo-2,7,10-trioxo-4,13,20-triazadocosan-22-oate (BPL-3): (S)-1-((1R,8S,9s)-bicyclo[6.1.0]non-4-butan-9-yl)-21-(1-(1R,8S,9s)-bicyclo[6.1.0]non-4-yn-9-yl)-3,12-dioxo-2,7,10-trioxo-4,13-diazaheptadecan-17-yl)-3,12,19-trioxo-2,7,10-trioxo-4,13,20-triazadocosan-22-oate 8S,9-(8S,9-bicyclo[1.1.0]non-4-but-9-yl)-3,12-dioxo-2,7,10-trioxa-4,13-diazaheptadecan-17-yl)-3,12,19-trioxa-2,7,110-trioxa-4,13,20-triazadocosan-22-oic acid (260 mg, 0.288 mmol, 1.0 eq.), N-hydroxysuccinimide (40 mg, 0.35 mmol, 1.2 eq.), and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (121 mg, 0.634 mmol, 2.2 eq.) were dissolved in dichloromethane, and the mixture was stirred at room temperature for 1.5 hours. The reaction was complete as monitored by LCMS, and the reaction solution was diluted with dichloromethane and extracted. The organic layer was washed twice with saturated sodium bicarbonate and then twice with saturated ammonium chloride, dried over anhydrous sodium sulfate, and the organic phase was concentrated under reduced pressure. A white solid 2,5-dioxopyrrolidin-1-yl-(S)-1-((1R, 8S, 9s)-bicyclo[6.1.0]non-4-yn-9-yl)-21-(1-((1R, 8S, 9s)-bicyclo[6.1.0]non-4-yn-9-yl)-3,12-dioxo-2,7,10-trioxo-4,13-diazaheptadecan-17-yl)-3,12,19-trioxo-2,7,10-trioxo-4,13,20-triazadocosan-22-oate (200 mg, yield: 69.7%) was obtained and used directly in the next step without purification. MS (ES) + ):m / z=999(M+H) + .
[0153] Example 12 Synthesis of solid phase carrier Q22-CPG
[0154] Step 1. A mixture of B4 (5.0 g, 6.53 mmol, 1.0 eq.), D1 (2.26 g, 6.86 mmol, 1.05 eq.), DIEA (1.68 g, 13.06 mmol, 2.0 eq.), and HATU (3.72 g, 9.8 mmol, 1.5 eq.) in DMF (10 mL) was stirred at room temperature for 2 hours. The reaction system was diluted with ethyl acetate and washed twice with saturated water, saturated Na2CO3, and NH4Cl solutions. The organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated to give 6.14 g of crude D2. MS (ES) + ):m / z=1079.46(M+H) +
[0155] Step 2. Dissolve 6.14 g of crude D2 in 5 mL of dichloromethane, add 5 mL of trifluoroacetic acid with stirring, and stir at room temperature for 1 hour. The solvent is concentrated under reduced pressure, and the residue is diluted with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, and concentrated to give 5.53 g of crude D3. MS (ES) + ):m / z=1023.25(M+H) +
[0156] Step 3. A mixture of 5.53 g of crude D3, B08-2 (3.2 g, 5.67 mmol), DIEA (1.4 g, 10.8 mmol), and HATU (3.07 g, 8.1 mmol) in DMF (10 mL) was stirred at room temperature for 2 hours. The reaction was diluted with ethyl acetate and washed twice with water and then with saturated NaCO solution. The organic phase was washed with brine, dried over anhydrous sodium sulfate, and concentrated. Purification by RP-HPLC afforded the desired product D4 (5.1 g, 49.7% yield for the three-step reaction) as a white product. 1H NMR (500MHz, DMSO-d6) δ7.90–7.77(m,5H),7.61(t,J=5.9Hz,2H),7.35–7.26(m ,4H),7.21–7.17(m,4H),6.91–6.84(m,4H),4.97(s,1H),4.42–4.36(m,1H),4. 27(d,J=14.0Hz,1H),4.19(td,J=8.6,5.1Hz,2H),4.11(t,J=13.4Hz,2H),4.06 (s,1H),3.85(d,J=1.7Hz,4H),3.73(s,7H),3.62–3.46(m,17H),3.46–3.35(m,9 H),3.19(p,J=7.5,6.6Hz,9H),3.10–3.01(m,5H),2.90(d,J=12.7Hz,1H),2.72 (d,J=2.6Hz,2H),2.54(s,1H),2.43–2.30(m,1H),2.18–2.04(m,11H),2.01(dd, J=12.5,5.9Hz,1H),1.84(ddd,J=12.9,8.3,4.4Hz,1H),1.64(s,2H),1.56(p,J =7.5Hz, 5H), 1.43 (ddq, J = 24.8, 17.3, 10.1, 8.8Hz, 14H), 1.22 (q, J = 7.5Hz, 4H). MS(ES + ):m / z=1267.30[(M-303)+H] + .
[0157] Step 4. Dissolve D4 (5.1 g, 3.25 mmol, 1 eq.) in dichloromethane (20 mL). Add succinic anhydride (1.95 g, 19.5 mmol, 6.0 eq.), triethylamine (3.94 g, 39 mmol, 12.0 eq.), and 4-dimethylaminopyridine (39 mg, 0.33 mmol, 0.1 eq.) in sequence with stirring. The system is allowed to react overnight at room temperature. Dilute the reaction system with dichloromethane, wash three times with 10% sodium bicarbonate solution, and once with saturated sodium chloride solution. The organic phase is dried over anhydrous sodium sulfate and concentrated to obtain a brown oil. MS (ES) + ):m / z=1367.35[(M-303)+H] + .
[0158] The above oil (5.26g) was dissolved in DMF, and DIEA (1.63g, 12.6mmol), HATU (1.44g, 3.78mmol) and HOBt (510mg, 3.78mmol) were added with stirring. The mixture was stirred at room temperature for 5 minutes, and 5.3g of controlled pore glass support (CPG, substitution rate 1.2mmol / g) was added to the reaction mixture. The system was stirred at room temperature overnight, filtered, and the filter cake was washed with dichloromethane, acetonitrile and dichloromethane in sequence, and dried under vacuum for 1 hour. The above dried solid phase support was placed in pyridine / acetic anhydride (20mL / 7mL), shaken at room temperature for 3 hours, filtered, and the filter cake was washed with dichloromethane, acetonitrile and dichloromethane in sequence, and dried under vacuum for 1 hour to obtain a light yellow solid phase support Q22-CPG (10.2g).
[0159] Other similar compounds can be obtained by referring to the above preparation method.
[0160] Example 13 Synthesis and Annealing of siRNA
[0161] Oligonucleotides were synthesized in batches of 10–40 μmol using a solid-phase oligonucleotide synthesis protocol on an Edgex MerMade 12-channel nucleic acid synthesizer. Aminolysis reagents were added to the synthesized oligonucleotides and incubated at 45–80°C to separate the oligonucleotides from the solid support and free them. The crude oligonucleotides were then precipitated with ethanol, and the supernatant was discarded by high-speed centrifugation twice to obtain the crude oligonucleotides. The precipitate was then resuspended in DEPC water. The crude oligonucleotides were purified by ion-pairing HPLC, and the collected product was dried to a powder in a vacuum centrifuge. The purified product was dissolved in DEPC water and analyzed by time-of-flight liquid chromatography-mass spectrometry (TOF-LC-MS).
[0162] After obtaining the purified peptide-sense strand conjugate, the nucleotide concentration was determined by dissolving it in DEPC-treated water. The volumes required for equimolar amounts of the sense and antisense strands were calculated. The equimolar amounts of the peptide, sense, and antisense strands were then mixed and heated at 75°C for 5 minutes, followed by annealing with natural cooling to room temperature to produce peptide-siRNA duplexes. After cooling to room temperature, the annealed product was diluted with 10 volumes of DEPC-treated water and transferred to a Millipore 15mL ultrafiltration centrifuge tube (molecular cutoff 3 kDa) for ultrafiltration. This step removes residual chemicals (such as n-hexylamine) from the peptide and nucleic acid preparation process. The ultrafiltration tube was centrifuged at 4000 RPM for approximately 40 minutes. Once the product volume remained at approximately 1 mL, the product was collected and washed with 3 mL of DEPC-treated water. The ultrafiltration product was sterilized by filtration through a 0.22 μm filter membrane and then dried to a powder in a vacuum centrifuge. After dissolution with the appropriate solvent, it could be used for subsequent in vitro and in vivo experiments.
[0163] Example 14 Synthesis of polypeptide oligonucleotide conjugate Ang2(K10N3)-12006a.1-1
[0164] 1. Using conventional nucleotide monomers and the special monomer B04, a standard solid-phase oligonucleotide procedure was performed according to the method of Example 13 to synthesize and purify the oligonucleotide sense strand 12006aSM1-B04 (33 mg, 4.56 μmol) with a B04 modification at the 3' end (molecular weight: 7230.8, measured: 7230.8).
[0165] 2. Synthesis of siRNA-BCN: 12006aSM1-B04 (33 mg, 4.56 μmol) was dissolved in 30 mL of phosphate buffer (0.1 M, pH 7.4), and BCN-NHS (93 mg, 320 μmol) was dissolved in 15 mL of DMF. The BCN-NHS solution in DMF and the 12006aSM1-B04 solution in phosphate buffer were mixed and shaken at 40°C for 30 min. After the reaction was complete as monitored by LC-MS, 4.5 mL of 3 M NaCl solution and 150 mL of pre-cooled ethanol were added to the reaction solution. The mixture was thoroughly shaken and centrifuged for 3 min (4°C, 15,000 rpm). The supernatant was discarded, and approximately 3 mL of DEPC water was added to dissolve the precipitate. The precipitate was purified by HPLC and freeze-dried to obtain a white powder solid 12006aSM1-B04-BCN (23.4 mg, 3.16 μmol, yield: 69.3%) (molecular weight: 7407.02, measured: 7408.14).
[0166] 3. 12006aSM1-B04-BCN (5 mg, 0.85 μmol) was dissolved in 2.5 mL of phosphate buffer (0.1 M, pH 7.4), and Ang2(K10N3) (2.5 mg, 1.0 μmol) was dissolved in 1 mL of DMF. The phosphate buffer of 12006aSM1-B04-BCN and the DMF solution of Ang2(K10N3) were mixed and shaken under N2 protection for 2 hours. After the reaction was complete as monitored by LC-MS, 0.3 mL of 3 M NaCl solution and 10 mL of pre-cooled ethanol were added to the reaction solution. After thorough shaking, the solution was centrifuged for 3 min (4 ° C, 15000 rpm), the supernatant was discarded, and about 2 mL of The precipitate was dissolved in DEPC water, purified by HPLC, and freeze-dried to obtain a white powder solid Ang2(K10N3)-B04-12006aSM1 (3.5 mg, 0.35 μmol, yield: 41%) (molecular weight: 9889.73, measured: 9890.58).
[0167] 4. Mix Ang2(K10N3)-B04-12006aSM1 and 12006aAM1, and anneal according to the method in Example 13 to obtain Ang2(K10N3)-12006a.1-1.
[0168] Example 15 Synthesis of polypeptide oligonucleotide conjugate Ang2(K10N3)-12006.1-1
[0169] 1. Using conventional nucleotide monomers and the special monomer B12, a standard solid-phase oligonucleotide procedure was performed according to the method in Example 13 to synthesize and purify the oligonucleotide sense strand 12006SM1-B12 (molecular weight: 7388.78, measured: 7387.59) containing a terminal alkyne group at the 3' end.
[0170] 2. 12006SM1-B12 (10 mg, 1.35 μmol) was dissolved in 2.5 mL of phosphate buffer (0.1 M, pH 7.4), and Ang2(K10N3) (5 mg, 2.0 μmol) was dissolved in 1 mL of DMF. The phosphate buffer of 12006SM1-B12 and the DMF solution of Ang2(K10N3) were mixed. Under N2 protection, CuSO4 pentahydrate (6.8 mg, 27 μmol), tris-(3-hydroxypropyltriazolylmethyl)amine (THPTA, 5.9 mg, 13.5 μmol), and L-ascorbic acid sodium salt (NaVc, 10.3 mg, 54 μmol) were added. The mixture was reacted at 40°C for 1 hour. After the reaction was completed by LC-MS monitoring, 0.3 mL of 3 M NaCl solution, 10 mL of pre-cooled ethanol, shake thoroughly and then centrifuge for 3 minutes (4°C, 15000 rpm), discard the supernatant, add about 2 mL of DEPC water to dissolve the precipitate, purify by HPLC, and lyophilize to obtain a white powder solid Ang2(K10N3)-B12-12006SM1 (4.6 mg, 0.47 μmol, yield: 35%) (molecular weight: 9868.88, measured: 9869.42).
[0171] 3. Mix Ang2(K10N3)-B12-12006SM1 and 12006AM1, and anneal according to the method in Example 13 to obtain Ang2(K10N3)-12006.1-1.
[0172] Example 16 Synthesis of polypeptide oligonucleotide conjugate BiAng2(K10N3)-12006.1-1
[0173] 1. Using conventional nucleotide monomers and the special monomer B08, a standard solid-phase oligonucleotide procedure was performed according to the method in Example 13 to synthesize and purify the oligonucleotide sense strand 12006SM1-B08 (molecular weight: 7279.63, measured: 7279.64) containing an amino group at the 3' end.
[0174] 2. 12006SM1-B08 (160 mg, 22 μmol) was dissolved in 20 mL of phosphate buffer (0.1 M, pH 7.4), and BPL-2 (569 mg, 660 μmol) was dissolved in 10 mL of DMF. The BPL-2 DMF solution and the 12006SM1-B08 phosphate buffer solution were mixed and shaken at 40°C for 60 min. After completion of the reaction as monitored by LC-MS, 3 mL of 3 M NaCl solution and 90 mL of pre-chilled ethanol were added to the reaction solution. The mixture was shaken thoroughly and centrifuged for 3 min (4°C, 15,000 rpm). The supernatant was discarded, and the precipitate was dissolved in approximately 5 mL of DEPC water. The precipitate was purified by HPLC and lyophilized to obtain 12006SM1-B08-BPL-2 (120 mg, 14.9 μmol, yield: 68%) as a white powder (molecular weight: 8028.56, measured: 8027.78).
[0175] 3. 12006SM1-B08-BPL-2 (20 mg, 2.5 μmol) was dissolved in 10 mL of phosphate buffer (0.1 M, pH 7.4), and Ang2(K10N3) (30 mg, 12 μmol) was dissolved in 10 mL of DMF. The DMF solution of Ang2(K10N3) and the phosphate buffer of 12006SM1-B08-BPL-2 were mixed. Under N2 protection, CuSO4 pentahydrate (12.5 mg, 50 μmol), tris-(3-hydroxypropyltriazolylmethyl)amine (THPTA, 10.9 mg, 25 μmol), and L-ascorbic acid sodium salt (NaVc, 19.1 mg, 100 μmol) were added. The mixture was reacted at 40°C for 2 h. After the reaction was completed by LC-MS monitoring, 0.3 mL of 3 M NaCl solution, 90 mL of pre-cooled ethanol, shake thoroughly and then centrifuge for 3 min (4°C, 15000 rpm), discard the supernatant, add about 2 mL of DEPC water to dissolve the precipitate, purify by HPLC, and lyophilize to obtain a white powder solid BiAng2(K10N3)-B08-12006SM1 (9.4 mg, 0.72 μmol, yield: 29%) (molecular weight: 12993.98, measured: 12992.92).
[0176] 4. Mix BiAng2(K10N3)-B08-12006SM1 and 12006AM1, and anneal according to the method in Example 13 to obtain BiAng2(K10N3)-12006.1-1.
[0177] Example 17 Synthesis of BiAng2-12006a.1-1
[0178] 1. 12006aSM1-B04 (9 mg, 1.24 μmol) was dissolved in 4 mL of 0.1 M phosphate buffer (pH 7.4), and BPL-3 (61 mg, 70 μmol) was dissolved in 4 mL of DMF. The DMF solution of BPL-3 and the phosphate buffer of 12006aSM1-B04 were mixed and shaken at room temperature for 60 min. After completion of the reaction as monitored by LC-MS, 0.8 mL of 3 M NaCl solution and 30 mL of pre-chilled ethanol were added to the reaction mixture. The mixture was shaken thoroughly and centrifuged for 3 min (4°C, 15,000 rpm). The supernatant was discarded and purified by HPLC to yield 12006aSM1-B04-BPL-3 (3.9 mg, 0.48 μmol, yield: 38.7%) (molecular weight: 8115.89, measured: 8115.57).
[0179] 2. 12006aSM1-B04-BPL-3 (3.9 mg, 0.48 μmol) was dissolved in 2.5 mL of phosphate buffer (0.1 M, pH 7.4), and Ang2-AZK (4.7 mg, 1.91 μmol) was dissolved in 1.5 mL of DMF. The phosphate buffer of 12006aSM1-B04-BPL-3 and the DMF solution of Ang2-AZK were mixed and shaken under N2 protection for 2 hours. After the reaction was complete as monitored by LC-MS, 0.7 mL of 3 M NaCl solution and 20 mL of pre-cooled ethanol were added to the reaction solution. After thorough shaking, the solution was centrifuged for 3 minutes (4°C, 15000 rpm). The supernatant was discarded and about 2 mL of 4% ethanol was added. The precipitate was dissolved in DEPC water, purified by HPLC, and freeze-dried to obtain a white powder solid BiAng2-B04-12006aSM1 (3.1 mg, 0.24 μmol, yield: 47.9%) (molecular weight: 13027.26, measured: 13027.09).
[0180] 3. Mix BiAng2-B04-12006aSM1 and 12006aAM1, and anneal according to the method in Example 13 to obtain BiAng2-12006a.1-1.
[0181] Example 18 Synthesis of BiAng2-2-12006a.1-1
[0182] 1. Synthesis of siRNA-BCN: 12006aSM1-B04 (9 mg, 1.24 μmol) was dissolved in 5 mL of 0.1 M phosphate buffer (pH 7.4), and BPL-1 (61 mg, 70 μmol) was dissolved in 5 mL of DMF. The DMF solution of BPL-1 and the phosphate buffer solution of 12006aSM1-B04 were mixed and shaken at room temperature for 60 min. After the reaction was complete as monitored by LC-MS, 1 mL of 3 M NaCl solution and 30 mL of pre-cooled ethanol were added to the reaction solution. The mixture was thoroughly shaken and centrifuged for 3 min (4°C, 15,000 rpm). The supernatant was discarded, and approximately 3 mL of DEPC water was added to dissolve the precipitate. The precipitate was purified by HPLC and lyophilized to obtain a white powder solid 12006aSM1-B04-BPL-1 (6.8 mg, 0.87 μmol, yield: 70.2%) (molecular weight: 7826.58, measured: 7826.49).
[0183] 2. Click chemistry reaction without Cu(I) catalysis: 12006aSM1-B04-BPL-1 (6.8 mg, 0.87 μmol) was dissolved in 3.5 mL of phosphate buffer (0.1 M, pH 7.4), and Ang2-AZK (8.5 mg, 3.5 μmol) was dissolved in 2 mL of DMF. The phosphate buffer of 12006aSM1-B04-BPL-1 and the DMF solution of Ang2-AZK were mixed and reacted at room temperature under N2 protection for 2 hours. After the reaction was completed as monitored by LC-MS, 0.5 mL of 3 M NaCl solution and 15 mL of pre-cooled ethanol were added to the reaction solution. After thorough shaking, the solution was centrifuged for 3 minutes (4°C, 15000 rpm). The supernatant was discarded and about 2 mL of ethanol was added. The precipitate was dissolved in DEPC water, purified by HPLC, and freeze-dried to obtain a white powder solid BiAng2-2-B04-12006aSM1 (3.8 mg, 0.31 μmol, yield: 35.6%) (molecular weight: 12735.94, measured: 12736.97).
[0184] 3. Mix BiAng2-2-B04-12006aSM1 and 12006aAM1, and anneal according to the method in Example 13 to obtain BiAng2-2-12006a.1-1.
[0185] Example 19 Synthesis of BiAng2(K10N3)-12006.2-4
[0186] 1. Synthesis of 12006SM4-Q22: Using the solid support Q22-CPG, a standard solid-phase oligonucleotide procedure was performed according to the method of Example 13 to obtain the 3'-terminus modified sense oligonucleotide 12006SM4-Q22 (molecular weight: 8276.07, measured: 8275.66).
[0187] 2. Synthesis of BiAng2(K10N3)-Q22-12006SM4: 12006SM4-Q22 (25.5 mg, 3.08 μM) was dissolved in 3 mL of phosphate buffer (0.1 M, pH 7.4), and Ang2(K10N3) (30.6 mg, 12.3 μmol) was dissolved in 3 mL of DMF. The phosphate buffer of 12006SM4-Q22 and the DMF solution of Ang2(K10N3) were mixed. Under N2 protection, CuSO4 pentahydrate (23.1 mg, 92.4 μmol), tris-(3-hydroxypropyltriazolylmethyl)amine (THPTA, 20.1 mg, 46.2 μmol), and L-ascorbic acid sodium salt (NaVc, 35.3 mg, 184.8 μmol) were added. The reaction was carried out at 40°C for 1 hour. After the reaction was completed as monitored by LC-MS, 0.6 mL of 4% HCl was added to the reaction solution. 3 M NaCl solution, 20 mL of pre-cooled ethanol, thoroughly shaken and centrifuged for 3 min (4°C, 15000 rpm), the supernatant discarded, and about 2 mL of DEPC water was added to dissolve the precipitate. Purification was performed by HPLC and lyophilization to obtain a white powder solid BiAng2(K10N3)-Q22-12006SM4 (18.3 mg, 1.38 μmol, yield: 44.8%) (molecular weight: 13241.48, measured: 13241.31).
[0188] 4. Mix BiAng2(K10N3)-12006SM4 and 12006AM2, and anneal according to the method in Example 13 to obtain BiAng2(K10N3)-12006.2-4.
[0189] The structures of the polypeptide oligonucleotide conjugates and C16 modified nucleotides synthesized by the above method are shown in Table 10 below.
[0190] Table 10: Structure and sequence of polypeptide oligonucleotide conjugates targeting APP
[0191] The specific structure of the polypeptide oligonucleotide conjugate is as follows:
[0192] The molecular weight and purity of the positive chain of the polypeptide oligonucleotide conjugates and C16-modified nucleotides synthesized by the present invention are shown in Table 11 below.
[0193] Table 11: Molecular weight and purity of the positive chain of polypeptide oligonucleotide conjugates and C16 modified nucleotides
[0194] Example 20 Testing the in vivo activity of APP-targeting polypeptide oligonucleotide conjugates by intrathecal injection in wild-type mice
[0195] 1. Drug Preparation
[0196] After freeze-drying to obtain APP-targeting polypeptide-siRNA double-stranded powder (polypeptide oligonucleotide conjugate), artificial cerebrospinal fluid (CSF) was used as a solvent in a sterile environment to prepare a polypeptide-siRNA drug with a stock concentration of 20 mg / mL.
[0197] 2. Experimental Grouping and Medication
[0198] Four-week-old female C57 wild-type mice of similar weight were randomly divided into groups of six. After anesthesia, the mice were injected intrathecally with the peptide-siRNA at a dose of 10 mg / kg. On the day of injection, the mice were observed after recovery from anesthesia, and their weights were recorded daily.
[0199] 3. Sample collection and testing
[0200] On the 10th day of administration, the mice were killed and samples were collected from the cerebral cortex, brainstem, hypothalamus, hippocampus and cervical spinal cord. The samples were stored in RNALater to avoid RNA degradation, and then the RNA in each brain tissue was extracted by TRI REAGENT (MRC, Catalog No.: TR118), and the extracted RNA was reverse transcribed into cDNA using PrimeScript RT regent Kit (Takara, Catalog No.: RR047A). The prepared QPCR system was added to a 96-well PCR plate, sealed with a plate film, and QPCR was performed on the StepOnePlus real-time PCR system (applied biosystems) to detect the expression level of APP. The content of the antisense chain targeting APP in brain tissue was detected by liquid chromatography-mass spectrometry.
[0201] On the 10th day after administration, mice were sacrificed and samples were collected for APP expression. The results are shown in Table 4. When administered at a dose of 10 mg / kg, the in vivo activity of APP siRNA delivered by different peptides varied. C16(7-U)-12006a.1-1 (with a hexadecyl fatty chain modification at the 7th nucleotide residue of the sense strand) served as a positive control for the delivery system, while 12006a.1-1 was a naked strand sequence without peptide or C16 conjugation. Multiple peptide-siRNA sequences demonstrated significant degradation of the target gene in mice. The results are shown in Table 12.
[0202] Table 12: Activity test results of different polypeptide oligonucleotide conjugates delivered by single peptide in various brain tissues of mice
[0203] The results in Table 12 indicate that the siRNA targeting APP linked to the single peptide Ang2(K10N3) is active in all brain tissues of mice, among which Ang2(K10N3)-12006a.1-1 and Ang2(K10N3)-12076.1-3
[0204] The activity was the highest, even surpassing the positive reference C16(7-U)-12006a.1-1. The naked chain 12006a.1-1 exhibited significant activity only in the cervical spinal cord. This suggests that the Ang2 peptide can deliver siRNA targeting APP to mouse brain tissue cells, achieving therapeutic efficacy, and its delivery efficiency is superior to that of C16. Furthermore, based on the results in Table 8, 12006.1-1 also exhibited the highest stability in liver homogenate. Subsequently, 12006.1-1 was selected for the conjugation of various peptides to identify the most efficient peptide delivery platform.
[0205] Example 21 Exploring the Effect of Linking Single or Double Peptides on the In Vivo Activity of Peptide-siRNA by Intrathecal Injection in Wild-Type Mice
[0206] This example explored the effects of Ang2 attachment modes (attachment site and valency), tandem dipeptides, and parallel dipeptides on the in vivo activity of peptide-siRNA. Four-week-old female C57 wild-type mice were administered intrathecally according to the method of Example 16. The mice were sacrificed on day 11, and APP expression levels were measured in various brain tissues. The results are shown in Table 13.
[0207] Table 13: Activity test results of different APP-targeted polypeptide oligonucleotide conjugates in various mouse brain tissues
[0208] The results in Table 13 show that Ang2-12006a.1-1 (Ang2 peptide N-terminus linked to siRNA) exhibited strong activity in various brain tissues, particularly in the cerebral cortex and brainstem. Further exploration of Ang2 conjugation methods revealed that peptide-siRNA conjugated to APP siRNA at position 10 of Ang2 (Ang2(K10AZK)-12006a.1-1) exhibited the best activity; however, APP siRNA conjugated to the C-terminus of Ang2 (Reverse-Ang2-12006a.1-1) exhibited poor delivery. These results demonstrate that conjugation to position 10 of Ang2 can effectively deliver APP siRNA to mouse brain tissue cells, enabling the APP-targeting siRNA to exert its therapeutic efficacy.
[0209] Table 14: Effects of different forms of single and double peptides on the activity of APP-targeted polypeptide oligonucleotide conjugates in mice
[0210] The results in Table 14 show that each peptide oligonucleotide conjugate exhibited good activity in the brainstem and cervical spinal cord. In the cerebral cortex, compared with APP siRNA linked to the N-terminus of Ang2 and APP siRNA linked to the C-terminus of L57, linking APP siRNA, tandem dipeptides (Ang2-Ang2), or parallel dipeptides (BiAng2) to lysine 10 of Ang2 (Ang2(K10N3)) significantly improved the activity of the peptide-siRNA, with the BiAng2-12006a.1-1 group showing the best activity. This indicates that linking a dipeptide to siRNA can improve its delivery efficiency, and further demonstrates that the site of attachment to the peptide has a significant effect on the activity of the peptide-siRNA. It was also found that BiAng2-2-12006a.1-1 had poor activity, indicating that the structure of the linker portion also has a significant effect on the activity of the peptide-siRNA.
[0211] Example 22: Exploring the Effect of Different Dipeptides on the In Vivo Activity of Polypeptide-Oligodeoxynucleotide Conjugates by Injection into the Cistern of Wild-Type Mice
[0212] This example explores the effects of different dipeptide linkages on the activity of polypeptide-oligonucleotide conjugates. In this example, except for the different administration methods, the other experimental methods were the same as in Example 15. In this example, the drug was administered by cisterna magna injection, with an injection dose of 0.25 mg per mouse. After the drug was injected into the mice, the mice were sacrificed on the 17th day and different brain tissues were taken to detect APP expression. The results are shown in Table 15.
[0213] Table 15: Effects of different dipeptides on the activity of APP-targeted polypeptide-oligonucleotide conjugates in mice
[0214] The results in Table 15 show that the parallel Ang2 exhibited good drug delivery effects in various brain tissues, among which siRNA linked to the 10th lysine of Ang2 (BiAng2(K10N3)-12006.1-1) had higher activity than siRNA linked from the N-terminus.
[0215] Example 23: Exploring the Effect of Linking Single or Double Peptides on the In Vivo Activity of Polypeptide-Oligodeoxynucleotide Conjugates by Injection into the Cistern of Wild-Type Rats
[0216] This example tested the in vivo activity of the polypeptide-oligonucleotide conjugates of the present invention in rats. Aside from the different administration methods, the experimental procedures were the same as in Example 16. In this example, the drug was injected into the rats via the cisterna magna injection, with each rat receiving a 1 mg dose. The rats were sacrificed on days 21 and 42, respectively, and different brain tissues were collected to measure APP expression. The results are shown in Tables 16 and 17.
[0217] Table 16: Effects of different forms of single or double peptides on the 21-day activity of APP-targeted polypeptide oligonucleotide conjugates in rats
[0218] The results in Table 16 indicate that at 21 days, the activity of the single-peptide Ang2(K10N3)-12006.1-1 was significantly improved compared to the dual-peptide BiAng2-12006.1-1 linked to the N-terminus of Ang2, further demonstrating that siRNA linked to lysine 10 of Ang2 has higher activity. Furthermore, the dual-Ang2(K10N3) polypeptide-oligonucleotide conjugate (BiAng2(K10N3)-12006.1-1) exhibited further enhanced activity compared to the single-Ang2(K10N3) polypeptide-oligonucleotide conjugate (Ang2(K10N3)-12006.1-1), further demonstrating that linking a dual-peptide to siRNA can enhance its delivery efficiency.
[0219] Table 17: Effects of different connection modes of dipeptides on the 42-day activity of APP-targeted polypeptide oligonucleotide conjugates in rats
[0220] The results in Table 17 indicate that the bi-Ang2(K10N3) peptide-siRNA (BiAng2(K10N3)-12006.1-1) maintained superior activity at 42 days compared to the bi-peptide BiAng2-12006.1-1. Furthermore, BiAng2(K10N3)-12006.1-1 maintained high target inhibitory activity at 42 days, demonstrating that using the BiAng2(K10N3) structure to deliver siRNA can achieve very long-lasting efficacy.
[0221] This example also explored the effects of different dipeptide forms on the 26-day activity of the polypeptide-oligonucleotide conjugate in rats. Optimization of the original dipeptide structure was performed by optimizing the symmetrical peptide and introducing polyethylene glycol (PGE2) into the symmetrical peptide. The results are shown in Table 18.
[0222] Table 18: Effects of different dipeptides on the 26-day activity of APP-targeted polypeptide-oligonucleotide conjugates in rats
[0223] The results in Table 18 indicate that at 26 days, the bi-Ang2(K10N3) polypeptide oligonucleotide conjugate (BiAng2(K10N3)-12006.1-1) with an asymmetric linker and the bi-Ang2(K10N3) polypeptide oligonucleotide conjugate (Bi-sym-Ang2(K10N3)-12006.1-1) with a symmetric linker maintained better activity than Bi-sym-Ang2(K10Peg2N3)-12006.1-1. This indicates that the BiAng2(K10N3) structure is the most efficient delivery structure for siRNA delivery in the current examples.
[0224] Example 24: Injection of low doses of polypeptide oligonucleotide conjugates into the cisterna magna to explore their in vivo activity in wild-type rats
[0225] This example compares the in vivo activity of the polypeptide oligonucleotide conjugate of the present invention (BiAng2(K10N3)-12006.1-1) and the hexadecyl chain-modified oligonucleotide C16(6-G)-12006.1-1 in rats (C16(6-G)-12006.1-1 has a hexadecyl fatty chain modification on the 6th nucleotide residue of the sense chain. Hexadecyl modification of the 6th nucleotide residue is an effective strategy to improve the efficiency of nucleic acid delivery). Naked-chain siRNA not coupled to a polypeptide or C16 was used as a control. In this example, the drug was also injected into rats by cisterna magna injection. The injection dose for each rat was reduced to 0.3 mg. The rats were sacrificed on the 14th day and different brain tissues were taken to detect the expression of APP. The results are shown in Table 19.
[0226] Table 19: Comparison of the 14-day activity of low-dose APP-targeted peptide oligonucleotide conjugates and C16-siRNA in rats
[0227] The results in Table 19 indicate that under low-dose conditions, the activity of BiAng2(K10N3)-12006.1-1 in the form of a dipeptide was significantly improved at 14 days compared to C16(6-G)-12006.1-1 delivered by C16. This indicates that siRNA delivered by polypeptides has more significant specificity and efficiency than that delivered by C16, and low-dose injection can also reduce toxic side effects. Therefore, polypeptides are an ideal platform for delivering siRNA to the central nervous system.
[0228] Example 25 Sequence optimization of siRNA targeting APP
[0229] The results of the previous examples suggest that BiAng2(K10N3) is a highly effective peptide platform for delivering APP siRNA to the brains of mice and rats. Next, we will modify and optimize the sequence of APP-targeting siRNA. Based on the data from Example 2, we selected 12006, 12037, 12075, and 12076 for optimization. The in vitro results are shown in Tables 20, 21, and 22.
[0230] Table 20: Experimental results of lipofectamine transfection of 10 nM and 1 nM modified siRNA in U87-MG cells
[0231] Table 21: Experimental results of 0.1 nM and 1 nM modified siRNA transfection in U87-MG cells by liposome
[0232] Table 22: Experimental results of 0.1 nM and 1 nM modified siRNA transfection in Hep3B cells by liposome
[0233] Table 23: Experimental results of lipofectamine transfection of 10 nM and 1 nM modified siRNA in primary mouse hepatocytes
[0234] Table 24: Brain homogenate stability results of sequence-optimized siRNA targeting APP
[0235] These results suggest that multiple sequences are more stable than those in Yangshen. This modification will be used for subsequent in vivo screening.
[0236] Example 26 Verification of Activity of Sequence-Optimized APP Polypeptide Oligonucleotide Conjugates in Mice
[0237] In this example, administration was via spinal injection, with each mouse receiving a dose of 0.25 mg. The sequence-optimized APP polypeptide oligonucleotide conjugate was injected into the mice. The mice were then sacrificed on day 7, and different brain tissues were harvested to measure mAPP expression. The results are shown in Table 25.
[0238] Table 25: Activity test results of different polypeptide oligonucleotide conjugates delivered by BiAng2 (K10N3) in various brain tissues of mice
[0239] The results in Table 25 show that the different polypeptide oligonucleotide conjugates delivered by BiAng2 (K10N3) have high activity in various brain tissues of mice. At the same time, we found that the activity of siRNA delivered by BiAng2 (K10N3) is higher than that delivered by C16. The safety test of this polypeptide oligonucleotide conjugate will be carried out in the future.
[0240] Example 27 Safety Testing of APP-Targeting Polypeptide Oligonucleotide Conjugates
[0241] In this example, we injected 0.7 mg of BiAng2(K10N3)-12006.2-4 polypeptide oligonucleotide conjugate into the brains of wild-type C57 / Bl6 mice via cisterna magna injection. Six mice were included in each group, and mice receiving CSF injection served as negative controls. Twenty-four and 48 hours after cisterna magna injection, the safety of the polypeptide-APP oligonucleotide conjugate was assessed by evaluating the functional observational score (FOB) of the mice based on seven different criteria. The FOB criteria were: (1) the mouse was intelligent, alert, and responsive; (2) the mouse stood or arched its back without stimulation; (3) the mouse showed any movement without stimulation; (4) the mouse showed forward movement after being lifted; (5) the mouse showed any movement after being lifted; (6) the mouse responded to tail pinch; and (7) the mouse breathed evenly. For each of the seven criteria, if the mouse met the criteria, the mouse was given a subscore of 0; if it did not meet the criteria, the subscore was 1. After evaluating all 7 criteria, the scores for each mouse were summed and averaged within each treatment group. The results are presented in Table 26.
[0242] Table 26: FOB scores of mice after injection of polypeptide oligonucleotide conjugates
[0243] The results in Table 26 show that after a high dose of the polypeptide-oligonucleotide conjugate was injected into the mouse brain via the cisterna magna, the mouse FOB score was 0.3 24 hours later, indicating that the polypeptide-oligonucleotide conjugate was well tolerated in mice.
[0244] Table 27: Blood biochemical test results of mice after injection of polypeptide oligonucleotide conjugates
[0245] The results in Table 27 show that 15 days after drug injection, the blood of the mice was collected for biochemical testing to detect liver damage indicators (ALT, AST, ALP) and kidney damage indicators (CREA and UREA). The results showed that BiAng2(K10N3)-12006.2-4 did not cause liver and kidney damage, indicating that the polypeptide oligonucleotide conjugate is safe.
[0246] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.
Claims
1. An siRNA or a pharmaceutically acceptable salt thereof for inhibiting the expression of an amyloid precursor protein (APP) gene, wherein the siRNA comprises a sense strand and a corresponding antisense strand, wherein: The siRNA is selected from any of the following pairs of sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide: A) 12006: the sense strand thereof is shown in SEQ ID NO: 11, and the antisense strand thereof is shown in SEQ ID NO: 12; B) 12037: the sense strand thereof is shown in SEQ ID NO: 75, and the antisense strand thereof is shown in SEQ ID NO: 76; C) 12075: the sense strand thereof is shown in SEQ ID NO: 151, and the antisense strand thereof is shown in SEQ ID NO: 152; D) 12076: Its sense strand is shown in SEQ ID NO: 153, and its antisense strand is shown in SEQ ID NO:
154.
2. The siRNA or a pharmaceutically acceptable salt thereof according to claim 1, wherein The nucleotides of the sense strand and the antisense strand of the siRNA are modified, the sense strand includes no more than 3, 2, 1 or 0 unmodified nucleotides, the modified nucleotides in the sense strand include 2'-O-methyl modified nucleotides, 2'-deoxy nucleotides, 2'-fluorine modified nucleotides, inverted abasic residues, and the 5'-end and 3'-end of the sense strand contain 0, or 1, or 2, or 3 phosphorothioate bonds; and the antisense strand includes no more than 3, 2, 1 or 0 unmodified The modified nucleotides in the antisense chain include 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2'-fluorine modified nucleotides, VPU (2'-O-methyluridine-5'-(E)-vinyl phosphoric acid-3'-phosphate), VPU-S (2'-S-methyluridine-5'-(E)-vinyl phosphoric acid-3'-phosphate) or other VPU derivatives, and the 5'-end and 3'-end of the antisense chain each contain 1-3 phosphorothioate bonds.
3. The siRNA or a pharmaceutically acceptable salt thereof according to claim 2, wherein: The siRNA is selected from any one of the following in Table 2: 12006.1-1, 12006.2-4, 12037.1-1, 12037.2-4, 12075.1-1, 12075.2-4, 12076.1-1, 12076.2-4.
4. The siRNA or a pharmaceutically acceptable salt thereof according to claim 3, wherein: The siRNA is selected from one of the following sequences, or a sequence that differs from its sense strand or antisense strand by no more than 1 nucleotide: a) 12006.2-4: its 5'-3' sense strand is mC*mA*mCmAmAmGmUmUfCfUfUfUmGfAmGmCmAmGmAmUmA, and its 5'-3' antisense strand is VPU-S*fA*mUmCmUmGmCmUmCmAmAdAmGfAmAfCmUmUmG*mU*mG; b) 12037.2-4: its 5'-3' sense strand is mG*mC*mUmGmUmCmCmAfAfGfAfUmGfCmAmGmCmAmGmAmA, and its 5'-3' antisense strand is VPU-S*fU*mCmUmGmCmUmGmCmAmUdCmUfUmGfGmAmCmA*mG*mC; c) 12075.2-4: its 5'-3' sense strand is mC*mA*mAmGmUmCmUmAfCfCfCfUmGfAmAmCmUmGmCmAmA, and its 5'-3' antisense strand is VPU-S*fU*mGmCmAmGmUmUmCmAmGdGmGfUmAfGmAmCmU*mU*mG; d) 12076.2-4: its 5'-3' sense strand is mG*mG*mUmCmUmAfCfCfCfUmGfAmAmCmUmGmCmAmA, and its 5'-3' antisense strand is VPU-S*fU*mGmCmAmGmUmUmCmAmGdGmGfUmAfGmAmCmC*mU*mC; Among them, VPU-S is 2'-S-methyluridine-5'-(E)-vinylphospho-3'-phosphate, mA is 2'-O-methyladenosine-3'-phosphate, mU is 2'-O-methyluridine-3'-phosphate, mC is 2'-O-methylcytidine-3'-phosphate, mG is 2'-O-methylguanosine-3'-phosphate, and fA is 2'-fluoroadenosine-3'-phosphate , fU is 2'-fluorouridine-3'-phosphate, fC is 2'-fluorocytidine-3'-phosphate, fG is 2'-fluoroguanosine-3'-phosphate, dA is 2'-deoxyadenosine-3'-phosphate, dT is 2'-deoxythymidine-3'-phosphate, dC is 2'-deoxycytidine-3'-phosphate, dG is 2'-deoxyguanosine-3'-phosphate, and * is a phosphorothioate bond.
5. The siRNA or a pharmaceutically acceptable salt thereof according to claim 1, wherein: The pharmaceutically acceptable salt is a sodium salt or a potassium salt.
6. A conjugate for inhibiting APP gene expression, wherein: The invention comprises the siRNA or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 5, and a targeted delivery ligand connected to the siRNA, or a targeted delivery carrier encapsulating the siRNA.
7. The conjugate according to claim 6, wherein The targeted delivery ligand comprises at least one polypeptide targeting low-density lipoprotein receptor-related protein 1 (LRP1) or transferrin receptor (TfR), and a linker connecting the polypeptide and the siRNA.
8. The conjugate according to claim 7, wherein The targeted delivery ligand comprises at least one polypeptide targeting low-density lipoprotein receptor-related protein 1 (LRP1), which is an Angiopep-2 (ANG2) polypeptide.
9. The conjugate according to claim 8, wherein The amino acid sequence from N-terminus to C-terminus of the ANG2 polypeptide is TFFYGGSRGKRNNFKTEEY; And / or the targeted delivery ligand comprises two ANG2 polypeptides.
10. The conjugate according to claim 9, wherein The linker is connected to the N-terminus or the lysine side chain amino group of each ANG2 polypeptide.
11. The conjugate according to claim 10, wherein The linker is linked to the lysine 10 of each ANG2 polypeptide.
12. The conjugate according to any one of claims 7 to 11, wherein The structure of the linker connecting the polypeptide (Peptide) and the siRNA is selected from any one of the following: Wherein X, Y are O or CH2; R is O or S; p, q are integers of 0-4, and k is 1, 2, 4 or 8.
13. The conjugate according to claim 12, wherein The structure after the ANG2 polypeptide and the siRNA are connected via a linker is selected from any one of the following: Wherein X, Y are O or CH2; R is O or S; p, q are integers of 0-4, and k is 1, 2, 4 or 8.
14. The conjugate according to claim 13, wherein The structure of the targeted delivery ligand after the ANG2 polypeptide and the siRNA are connected via a linker is one of the following: BiAng2(K10N3)-B08-siRNA Bi-Sym-Ang2(K10N3)-siRNA BiAng2(K10N3)-B08-siRNA-2 Bi-Sym-Ang2(K10N3)-siRNA-2 BiAng2(K10N3)-Q22-siRNA BiAng2(K10N3)-Q22-siRNA-2.
15. Use of the siRNA or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 5 or the conjugate according to any one of claims 6 to 14 in the preparation of a drug for preventing or treating a disease mediated by the APP gene.
16. The use according to claim 15, wherein: The disease mediated by the APP gene is cerebral amyloid angiopathy (CAA), early-onset familial Alzheimer's disease (EOFAD) or Alzheimer's disease (AD).
17. A method for preventing or treating a disease mediated by the APP gene, wherein: A suitable dose of the siRNA or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 5 or the conjugate according to any one of claims 6 to 14 is administered to the subject.
18. The method according to claim 17, wherein: The subject is a mammal, preferably a primate.
19. A method for inhibiting APP gene expression, wherein the method comprises the following steps: (a) contacting an in vivo or in vitro cell with the siRNA or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 5 or the conjugate according to any one of claims 6 to 14; and (b) maintaining the cells produced in step (a) for a time sufficient to obtain degradation of the mRNA transcripts expressed by the APP gene, thereby simultaneously inhibiting the expression of APP in the cells.
Citation Information
Cited By
shRNAs targeting APP, expression vectors, and their application in Alzheimer's disease treatment drugs
CN122563962A