Cloning amplification

Abstract

The present invention provides methods of making cloned clusters of polynucleotides on a surface, and also provides surfaces comprising the clusters. These methods and bound clone clusters are particularly useful in various nucleotide sequencing methods, such as sequencing by synthesis.

Description

Technical Field

[0001] The present invention particularly relates to methods for clonal amplification of a target nucleotide sequence (SOI), nucleotide sequencing methods incorporating such methods, and surfaces comprising the clonally amplified nucleotide sequences. Background Art

[0002] In solid-phase sequencing workflows, individual target nucleotide fragments are generally captured by oligonucleotides immobilized on a surface (e.g., a slide, bead, or feature in a microfluidic system). A sequencing reaction is then performed on the tethered molecules. This enables, in particular, the use of extremely small amounts of material, simple control of the necessary fluids, and the ability to arrange many similar reactions in a small space. In recent nucleotide sequencing methods, a sequencing primer is annealed to the tethered sequence, and as the primer is extended, the individual bases that are sequentially incorporated (incorporation signals) are detected, e.g., by fluorescence or by detecting ions generated in the reaction. To enhance the incorporation signals, individual tethered molecules can be amplified to generate a clonal cluster of tethered amplicons derived from a single polynucleotide. This "clonal amplification" (CA) provides many replicated sequencing targets and thus allows multiple incorporation events to occur simultaneously within the cluster, thereby amplifying the signal multiple times. A variety of CA methods are known and have been developed and commercialized, e.g., for use in sequencing workflows. These methods include bridge PCR (US9593328), emulsion PCR (US20100261230A1), and kinetic exclusion amplification (US9169513). Methods for clonal amplification by recombinase polymerase amplification (RPA) have also been reported and are discussed in co-pending application GB2110479.9, which is further discussed below.

[0003] Although CA methods generally provide enhanced signals, in some cases, the level of the signal and / or its level above background can still be challenging. Optimizing a particular CA method can increase the density of tethered amplicons, but the density (and thus the corresponding signal) can still be limited by factors such as the density of the capture oligonucleotides immobilized on the surface and spatial considerations that reduce the opportunity for polymerase to contact locally crowded molecules during clonal amplification. Additionally, methods for increasing the nucleotide or target density within a tethered cluster may also affect cluster spreading and may increase the incidence of contamination due to neighboring amplification events and reduce clonality, impeding read quality, enhancing the background, and having an adverse effect on the signal-to-noise ratio, especially around the boundaries of the clusters. By increasing the density of clonal clusters, it is also possible to reduce the space occupied by individual clusters, thereby providing room for increasing the number of clusters within a given area without attenuating the signal generated by each cluster.

[0004] In some cases, such as when determining polymorphisms within a sequence by sequencing or when determining the presence of a specific nucleotide sequence within a sample, it may be necessary to provide clusters based on a known or partially known sequence. In some cases, such as when sequencing genomic fragments for later assembly or when determining other unknown nucleotide sequences, it may be necessary to provide a clone cluster of an unknown sequence.

[0005] Accordingly, there is a desire to provide improved methods of clonal amplification. There is also a desire that clonal amplification does not have an adverse effect on clonality, cluster spread, or signal-to-noise ratio. There is also a desire to provide a method of clonal amplification that can be readily adapted for applications with known, partially known, or unknown sequences. The present invention addresses one or more of the above problems. Summary of the Invention

[0006] In a first embodiment, the present invention provides a method of preparing a clone cluster of a target nucleotide sequence, comprising: (i) providing a single-stranded polynucleotide comprising the target nucleotide sequence (SOI), wherein the polynucleotide is tethered to a surface by its 5' end; (ii) performing a first clonal amplification of the single-stranded polynucleotide to provide a first polynucleotide cluster comprising multiple single-stranded polynucleotides each tethered to the surface by its 5' end and comprising the target nucleotide sequence; and (iii) extending the tethered single-stranded polynucleotides in the first cluster by further adding one or more copies of the target nucleotide sequence to provide a cluster of tethered polynucleotides, wherein the polynucleotides in the cluster comprise multiple copies of the target nucleotide sequence.

[0007] A second embodiment provides a method of preparing a clone cluster of a single-stranded polynucleotide comprising a target sequence, the method comprising: (i) hybridizing a polynucleotide fragment comprising a complementary copy of the target sequence to a capture oligonucleotide tethered to a surface by its 5′ end; (ii) using a polymerase to extend the 3' end of the capture oligonucleotide to provide a single-stranded polynucleotide comprising the target sequence, the single-stranded polynucleotide being tethered to the surface by its 5' end; (iii) performing a first clonal amplification of the tethered single-stranded polynucleotide to provide a first polynucleotide cluster comprising multiple single-stranded polynucleotides each tethered to the surface by its 5' end and comprising the target nucleotide sequence; and (iii) extending the 3' end of the tethered single-stranded polynucleotides in the first cluster by further adding one or more copies of the target sequence to provide a cluster of tethered polynucleotides, wherein the polynucleotides in the cluster comprise multiple copies of the target nucleotide sequence.

[0008] In one aspect, the polynucleotide hybridizes to the capture oligonucleotide via its 5'-end portion. The polynucleotide may be equipped with a 3'-adapter and optionally with a 5'-adapter, and at least a portion of the 3′-adapter hybridizes to the capture oligonucleotide.

[0009] In a third embodiment, a method for determining the nucleotide sequence of a target sequence is provided, comprising: (i) tethering the target sequence to a surface by its 5'-end; (ii) performing a first cloning amplification step to clone amplify the SOI, thereby providing a first oligonucleotide clone cluster, each oligonucleotide comprising a copy of the SOI; (iii) extending the single-stranded polynucleotides in the first cluster by further adding one or more copies of the SOI, thereby providing a cluster of tethered polynucleotides, wherein the polynucleotides in the cluster comprise multiple copies of the target nucleotide sequence; and (iv) sequencing at least a portion of the polynucleotides in the cluster to determine the nucleotide sequence of the SOI.

[0010] The tethered SOI may be a complementary copy of a polynucleotide obtained through a previous workflow step.

[0011] As used herein, a "target sequence" or SOI may be any nucleotide sequence that a user attempts to clone amplify. The nucleotide sequence of the SOI as used herein is the sequence of the polynucleotide tethered by its 5'-end prior to the initial cloning amplification to provide the first clone cluster. This sequence may be a complementary copy of a polynucleotide generated by a tethering process further described herein in a previous stage of the workflow.

[0012] Typically, the SOI is a polynucleotide sequence for which a user seeks information. The information may be sequence information, such as comprising the sequence or a portion of the sequence of a polynucleotide, or the presence of a particular sequence or polymorphism. Alternatively, the information may be binding information, such as the binding ability of the sequence to a particular binding partner, such as a primer or other polynucleotide, a nucleotide-binding protein, or a drug.

[0013] The SOI can be of any length, depending on the parameters of the workflow and the requirements of the information desired. Typically, the length of the SOI is from 1 base to 100,000 bases. For example, it can be from 1 to 10,000 bases, preferably from 5 to 1000 bases, but typically about 10 to 500 bases or 50 to 250 bases.

[0014] In some cases, the SOI can be a polynucleotide of a known sequence or a polynucleotide of an unknown or partially unknown sequence. The SOI can be DNA or RNA. For example, it can be (but is not limited to) a genomic DNA fragment to be sequenced, a polynucleotide covering a polymorphic region, cDNA generated by reverse transcription from an RNA sequence (such as mRNA, rRNA or tRNA), or a polynucleotide fragment whose sequence can diagnose or indicate a specific disease, disorder or organism (such as an infectious pathogen). Those skilled in the art will understand that the sequence information to be obtained for the forward strand can be obtained from the sequence of the complementary (reverse) strand.

[0015] In some embodiments, the polynucleotide or SOI is equipped with adapters. An adapter can be a single-stranded or double-stranded nucleotide sequence added to the 3' or 5' end of the target sequence (but preferably added to both ends simultaneously). Adapters generally have known sequences and are designed to include separate or overlapping functional sequences configured for certain downstream purposes. Such sequences can hybridize to primers (such as sequencing primers or cloning amplification primers) to capture oligonucleotides, or to complementary sequences such as molecular inversion probes, or they can be configured to facilitate coupling to beads or other surfaces. Additional functional sequences include identification tags, such as nucleic acid barcodes. In the case of separate functional sequences, no nucleotide in the sequence forms part of another functional sequence. In the case of overlapping functional sequences, the nucleotides in one sequence can also be part of the second functional sequence. For example, n 5′ nucleotides in the first functional sequence may form n 3' nucleotides in the second functional sequence. Universal adapters are adapters carried by all polynucleotides in a population.

[0016] The adapters can be provided as part of an upstream workflow (i.e., a preliminary step) or provided separately for cloning amplification. The workflow can include (in non-limiting examples) one or more steps such as isolation and fragmentation of larger polynucleotides (such as genomic DNA), amplification of the fragments (such as by PCR or isothermal amplification methods), addition of adapters to the 5' end and / or 3' end of the fragments, etc. In some embodiments, the adapters can be ligated to the 5' end and / or 3′ end of the double-stranded fragment and then denatured to provide single-stranded polynucleotides. Alternatively, adapters can be incorporated by a transposase cleavage ligation reaction (tagmentation reaction) in which a transposase (such as Tn5) both cuts the DNA and attaches short tags that can include adapter sequences. In other methods, adapters can be incorporated in the step of amplifying or replicating the fragment using a tailing primer.

[0017] Typically, the surface is the surface of a substrate that binds the polynucleotide. In non-limiting examples, the substrate can be an ISFET, a glass or silica substrate, an insoluble particle substrate (such as microspheres or nanospheres), or a part of a microfluidic device adapted to bring the bound polynucleotide into contact with a liquid reagent. The surface can be planar (such as the surface of a glass slide or a semiconductor chip), or can be in the form of pores or other 3D features. The surface / substrate can include a variety of materials, including inorganic materials (such as glass, silica or Ta 2 O 5 ) or organic materials (including various polymers).

[0018] In one embodiment, the surface is the surface of a semiconductor chip that includes an array of field effect transistors (FETs) for sensing chemical and / or biological reactions (including sequencing reactions). Such devices are well known in the art (e.g., US7,686,929 B2, US 8,685,228B2, US 8,986,525 B2, US2010 / 0137143 A1). Preferred embodiments include a semiconductor chip that includes an array of ion-sensitive field effect transistors (ISFETs) that can be used as a sensing device for various reactions (including nucleic acid sequencing reactions). In a particularly preferred embodiment, the chip further includes an array of pores located above and in fluid contact with the ISFET array. In these embodiments, the sequencing reaction typically occurs within the pores, and the release of ions is detected using the ISFET sensors. In a particularly preferred embodiment, the chip includes a flow cell mounted on top of the chip (with or without pores) for delivering fluid to and removing fluid from the chip / ISFET array. The term "surface" also includes a modified surface that provides functional groups to which the polynucleotide can be coupled, and such modification includes, but is not limited to, modifying the surface by directly functionalizing the surface or by coating the surface with a polymer bearing appropriate functional groups.

[0019] A variety of methods can be employed to bind the polynucleotide to the surface. For example, the polynucleotide can be chemically bound (such as by covalent bonding) to the surface, or it can be captured by a capture moiety that is already bound to the surface.

[0020] In some embodiments, the binding can be effected through an affinity tag (such as the interaction between a protein or peptide and its cognate ligand). Typically, the ligand is attached to the polynucleotide, and the protein or peptide is attached to the surface as the capture moiety. Such pairs include, for example, biotin and a biotin-binding partner (such as avidin, NeutrAvidin TM(ThermoFisher) or streptavidin), and many other pairs of substances are also known and well-studied and commercially available. Biotin is particularly useful because biotinylation of nucleic acids is well-known and the interaction between biotin and its binding partner is strong. In addition, for example, biotin-labeled oligonucleotides are available from a variety of sources. In some cases, the surface can be coated to provide suitable functional groups so that a polynucleotide or a capture moiety (such as a capture oligonucleotide) can be coupled thereto.

[0021] A polynucleotide or oligonucleotide can be tethered through its 5' or 3' end. It can be tethered through a functionalized 5' or 3' nucleotide. In the present invention, generally polynucleotides and oligonucleotides are tethered to the surface through their respective 5' ends. The exact chemistry of the attachment of the polynucleotide to the surface depends on the surface involved, and many chemicals are commercially available for this purpose, including many so-called "click chemistry" methods (e.g., Click Chemistry, a Powerful Tool for Pharmaceutical Sciences (2008) Hein, et al.; Pharm Res 25(10):2216 - 2230; and A Hitchhiker’s Guide to Click-Chemistry with Nucleic Acids (2021) Fantoni et al., Chem Rev, 121:7122 - 7154).

[0022] In some embodiments, a tethered polynucleotide is provided by hybridizing the polynucleotide with a capture oligonucleotide and extending the capture oligonucleotide to provide a complementary copy of the polynucleotide that is tethered to the surface through its 5' end. Hybridization can occur between the 3' portion of the capture oligonucleotide and the complementary sequence of the 3' portion of the polynucleotide. The 3′ portion of the polynucleotide can include a linker that includes a sequence complementary to the 3′ “capture” region of the capture oligonucleotide.

[0023] After hybridization, the 3' end of the capture oligonucleotide serves as a primer, and a polymerase is used to extend over the captured polynucleotide to provide a double-stranded polynucleotide. Then the two strands are denatured, leaving a single-stranded polynucleotide that is tethered to the surface through its 5' end. The tethered polynucleotide includes a complementary copy of the originally captured polynucleotide (including any 5' linker and 3' linker), and it is now contiguous with the capture oligonucleotide and thus tethered to the surface through its 5' end.

[0024] In some embodiments, the surface is provided with a single population of capture oligonucleotides having the same 3' capture sequence. In other embodiments, the surface may be provided with a mixed population of two, three, four or more capture oligonucleotides each comprising a different 3′ capture sequence. For example, the surface may be provided with a mixed population of two capture oligonucleotides, a first population comprising a 3' sequence complementary to a 3' adaptor (reverse primer), and a second population comprising a 3' sequence complementary to the 3' end of an extended complementary polynucleotide and serving as a forward primer, as further described herein.

[0025] The capture oligonucleotides may include nucleotide sequences or other features that provide additional functionality (in addition to the 3' capture portion), such as spacer sequences or chemical spacers for distancing the tethering moiety from surface effects, etc., and chemically modified nucleotides or bonds at the 3' end (e.g., phosphorothioate bonds) to protect the oligonucleotide from 3' to 5′ exonuclease activity of the polymerase.

[0026] In some embodiments, a single-stranded polynucleotide may include, in the 5' to 3' direction: a 5' flanking region, a nucleotide sequence comprising or consisting of a target nucleotide sequence, and a 3' flanking region. The 5' flanking region and the 3' flanking region are directly coupled to the 5' end and the 3' end of the target sequence, respectively, such that they are contiguous with the target sequence. Typically, the 5' flanking region and the 3' flanking region are adaptors.

[0027] In a preferred arrangement, the 5' flanking region and the 3' flanking region have known predetermined sequences. Typically they are "universal adaptors", i.e., they are adaptors common to all oligonucleotides applied to the surface. The 5' flanking region or adaptor and the 3' flanking region or adaptor typically have different sequences. Each flanking region may include one or more sequences complementary to primers suitable for various functions. For example, each flanking region or adaptor may include one or more regions complementary to cloning amplification primers, and / or the 3' flanking region may include a region complementary to a sequencing primer. As further described below, they may include different universal regions complementary to the 3′ and / or 5' complementary regions of molecular inversion probes (MIPs). In some cases, they may be separated from other binding regions such that highly specific binding regions directed against the MIP complementary regions can be designed independently.

[0028] For the 3' flanking region, it is advantageous to directly couple the flanking region to the 3' end of the target sequence such that the 5'-most nucleotide of the flanking region binds directly to the 3'-most nucleotide of the target sequence. When the sequencing primer is complementary to the adapter sequence and its 3' end is co-terminal with the 5' end of the adapter, the sequencing primer can initiate sequencing at the 3'-most end of the target sequence. Alternatively, internal sequence calling control can be allowed when there is a short known nucleotide sequence in the flanking region between the 3' end of the sequencing primer and the 5' end of the target sequence. For example, a short sequence of 1, 2, 3, 4, or 5 nucleotides can be employed. Other functional sequences within the flanking region or adapter include barcodes or other identification sequences.

[0029] In some embodiments, the 3' end of the 3' flanking region is located at the 3' end of the tethering polynucleotide. In some embodiments, the 3' end of the 3' flanking region is located at the 3' end of the tethering polynucleotide and is co-terminal therewith.

[0030] In some embodiments, the 3' end of the target sequence is located at the 3' end of the tethering polynucleotide. In some embodiments, the 3' end of the target sequence is located at the 3' end of the tethering polynucleotide and is co-terminal therewith. For example, this may be the case when the target sequence does not have a 3' flanking region.

[0031] In some embodiments, a single species of polynucleotide can be spotted on different regions of a surface. In other methods, the polynucleotide can be applied to the surface by flooding the surface with a dilute solution of a polynucleotide population, which can include different target sequences. The dilution of the polynucleotide is calculated such that individual polynucleotides are captured in a spatially separated manner such that clonal amplification can provide separate clusters. In some embodiments, the surface includes features such as pores that are designed to (statistically) capture individual polynucleotides.

[0032] Once a polynucleotide is tethered to a surface, the polynucleotide can be clonally amplified to provide a first clonal cluster that includes multiple single-stranded polynucleotides that are tethered to the surface by their respective 5' ends and include the target nucleotide sequence. The first clonal amplification can be carried out using a variety of methods known in the art and can be selected as needed. Some non-limiting options are described below. These methods include (but are not limited to) bridge amplification (see US9593328), rolling circle amplification, kinetic exclusion amplification - exAMP (see US9169513), emulsion PCR (particularly suitable for use with microspheres, see US20100261230A1), and template walking methods (e.g., US2012 / 0156728). Methods for clonal amplification by recombinase polymerase amplification (RPA) have also been reported and are discussed in co-pending application GB2110479.9. Any clonal amplification method is suitable as long as it provides a clonal cluster that includes multiple preferably single-stranded polynucleotides that are tethered to the surface by their respective 5' ends. In some embodiments, the selected clonal amplification method provides only the sense copy of the SOI or the antisense copy of the SOI in the first cluster, rather than both simultaneously. In some embodiments, the method provides both the sense copy and the antisense copy of the SOI in the same first cluster. In some embodiments, the polynucleotides in the first cluster include only a single copy of the SOI. In some embodiments, preferably, the tethered polynucleotide includes a free 3' end. In one embodiment, the clonal amplification method provides a clonal cluster that includes multiple polynucleotides that are tethered to the surface by their respective 5' ends and have free 3' ends, preferably including only one copy of the SOI.

[0033] In one method of bridge amplification, the fragment is equipped with a 5' adaptor and a 3' adaptor. A mixed population including both a forward primer and a reverse primer is tethered to the surface. The single-stranded template binds to the reverse primer on the surface through its 3' adaptor, and polymerase causes the primer to extend over the template, thereby generating a tethered complementary copy of the template with that 3' adaptor and 5' adaptor. The duplex is then denatured (usually by exposing the duplex to a denaturing solution or heating to the T of the duplex) mThe above) to release the original template. Then, the 5' adaptor of the bound complementary copy is captured by the bound forward primer, forming a bridge bound to the surface. Extension of the forward primer using the bound bridging complementary strand provides a copy of the original single-stranded fragment coupled to the surface via the second capture oligonucleotide. The double-stranded bridge is then denatured, leaving copies of the forward strand and the reverse strand bound to the surface via their respective 5' ends. After washing, the 3′ ends of these strands are captured by the bound forward and reverse primers, and further extension-denaturation cycles are performed to spread the clonal clusters across the surface until clonal amplification is complete (e.g., see US10370652B2 and US7972820B2).

[0034] Methods of clonal amplification by recombinase polymerase amplification (RPA) utilize two primers, one of which (the reverse primer) is a capture oligonucleotide bound to the surface and the other (the forward primer) is in solution. The polynucleotide fragment is equipped with a 5' adaptor and a 3′ adaptor. The 3′ adaptor hybridizes to the capture oligonucleotide, and then the 3' end of the capture oligonucleotide is extended over the polynucleotide template using a polymerase to provide a complementary copy of the polynucleotide that is bound to the surface via its 5' end but whose 3' end is free. A reaction mixture comprising a recombinase, a single-stranded DNA binding protein, and a strand-displacing polymerase is then provided, and the synergistic action of the recombinase and the single-stranded DNA binding protein causes the 3' end of the duplex to separate. This allows the forward (solution-phase) primer to contact the 3' end of the bound complementary strand and allows the strand-displacing polymerase to extend the forward primer, ultimately displacing the original fragment into solution. In some systems (e.g., T4), a recombination-mediated protein can be provided to mediate the contact of the polymerase with the single-stranded DNA. The released fragment then freely hybridizes to another capture oligonucleotide to repeat the process. By increasing the viscosity of the reaction mixture, local diffusion of the released template can be reduced, enabling reduction of cluster diffusion. Combining Figure 1 This method is further discussed.

[0035] In the template walking method (US2012 / 0156728), the capture oligonucleotide has a low T m (under its reaction conditions) 3' end, for example, it can be a portion having a high proportion of A or T (or U). For example, it can be a sequence having 20 T. The SOI is equipped with adaptors, and the 3' adaptor includes a region complementary to the 3' region of the capture oligonucleotide (e.g., 20 A or 30 A), and the remainder of the SOI has a higher T than the 3' end of the adaptor m . A polynucleotide having a 5' adaptor and a 3' adaptor is hybridized to the low T m end of the capture oligonucleotide, and the 3' end of the capture oligonucleotide is extended using the polynucleotide as a template to provide a complementary copy bound to the surface via its 5' end. The duplex includes Tm Relatively high regions and low T regions located around the capture oligonucleotide. m The temperature is then raised to allow the 3' end of the original polynucleotide to dehybridize from the capture oligonucleotide, but not to dissociate the entire duplex on the SOI. As the temperature is lowered, the low T regions can rehybridize to adjacent capture oligonucleotides, providing a template to again extend the capture oligonucleotide from this template, thereby displacing the original polynucleotide from the originally extended capture oligonucleotide. m

[0036] Kinetic exclusion amplification (exAMP) was developed to address the problem of clonal contamination, particularly in well features, where, in the case of well features, the workflow attempts to capture and amplify a single polynucleotide fragment on the surface of each well, and capture and amplification occur simultaneously. If the capture rate is fast but the amplification rate is slow, there is a high likelihood of capturing a second polynucleotide fragment with a different sequence nearby, resulting in overlapping clusters generated from these two different sequences and reduced clonality. Kinetic exclusion amplification attempts to maintain clonality by making the rate of clonal amplification exceed the rate of capturing new polynucleotide species. This involves reducing the supply of capture oligonucleotides in the local area and hindering new polynucleotide species from accessing the territory of the capture oligonucleotides.

[0037] One way to achieve this is to provide oligonucleotide fragments (in double-stranded form) together with DNA polymerase, single-stranded binding protein (ssBP), and recombinase. The concentration of polynucleotides in solution is controlled such that the capture rate of capture oligonucleotides for single-stranded polynucleotides is much lower than the rate of clonal amplification, thereby depleting the capture oligonucleotides in the vicinity.

[0038] Clonal amplification methods can provide clusters of only a single strand (e.g., RPA) or clusters having both a forward strand and a reverse strand (e.g., bridge amplification). Preferably, the selected CA method produces clusters of linear polynucleotides that include the target sequence and have free 3' ends. In one embodiment, the linear polynucleotide includes a single SOI copy and has a free 3' end. Clonal amplification by RPA is generally the preferred method used in the present invention.

[0039] Once the first clonal amplification is complete, the surface will include clusters of polynucleotides arranged as two-dimensional features (or "lawn-like") on the surface, with each polynucleotide including the target sequence. Typically, at this point each polynucleotide includes only one copy of the SOI. However, by extending at least a portion of the tethered single-stranded polynucleotides in the first cluster (by further adding one or more copies of the SOI), a cluster of tethered polynucleotides can be provided that includes (or at least a portion thereof includes) multiple copies of the original target nucleotide sequence. In this way, the copy number of the target sequence in the cluster can be increased several-fold without tethering more oligonucleotide copies to the surface, while maintaining clonality. This method solves the problem of increasing the number of SOIs per unit area in a manner that does not easily lead to cluster spreading. This is easily achieved by providing an effective three-dimensional cluster having multiple copies of the SOI, and can also provide multiple copies of sequencing adapters and multiple copies of other functional sequences useful in downstream processing of the SOI.

[0040] In a convenient embodiment, the tethered single-stranded polynucleotides in the first cluster can be extended by rolling circle amplification (RCA) (at least of the SOI). RCA can be used to replicate only the target sequence (or at least a portion thereof), or can additionally replicate all or part of the 5' adapter and / or 3' adapter. In this way, when sequencing adapters are present in the original polynucleotide that are arranged to initiate sequencing from each SOI, the method provides copies of the sequencing adapters; similarly, when any other functional sequences are present in the original polynucleotide that are useful in downstream processing of the SOI, the method provides copies of the other functional sequences.

[0041] Extension by RCA can be achieved in a variety of ways and can be applied whether the SOI has a known or partially known sequence or an unknown sequence, making it an effective method for increasing the SOI density in clonal clusters and adaptable to various workflows.

[0042] In one embodiment, rolling circle amplification can be carried out by a method comprising the steps of: (a) providing a single-stranded circular nucleotide probe that includes a nucleotide sequence complementary to the SOI (and optionally, the 5' adapter and / or 3' adapter or a portion thereof) in the first clonal cluster; and (b) using the circular nucleotide probe as a template to extend the 3' end of the tethered single-stranded polynucleotide, preferably using a strand-displacing polymerase to extend, thereby extending the 3' end of the tethered single-stranded polynucleotide (or at least a portion thereof) by further adding one or more copies of the target sequence.

[0043] In some embodiments, a single-stranded circular probe can be provided as a pre-made circular probe that includes a complementary copy of the target sequence. The complementary copy of the SOI is then hybridized to the tethered SOI (and optionally, any 5' adaptor or 3' adaptor or portions thereof), and then the circular probe is replicated complementarily and repeatedly using a strand-displacing polymerase to extend the 3' end of the tethered oligonucleotide. This method is particularly useful when the SOI has a known sequence. Advantageously, the circular probe can be prepared in solution, for example, by joining the free ends of a linear probe that includes a complementary copy of the SOI to form the circular probe.

[0044] In a further refinement of the method, the single-stranded circular nucleotide probe includes a nucleotide sequence complementary to the SOI, as well as complementary copies of a 5' adaptor and / or a 3' adaptor (the sequences of which are not in the tethered polynucleotide) flanking the SOI. Then, RCA of the tethered polynucleotide incorporates the functional adaptors into the extended strand.

[0045] In either case, the circular probe can also include an optional linker region that extends from the 3' end of the sequence complementary to the SOI (and optionally, the 3' adaptor) to the 5' end of the SOI (and optionally, any 5' adaptor). Such single-stranded circular probes can be constructed in a variety of ways that are well known to those skilled in the art and are discussed elsewhere in this document.

[0046] In some embodiments, the circular probe is provided not as a pre-made circular probe, but as a linear probe from which the circular probe can be synthesized in situ (i.e., on a surface), rather than a pre-made probe. In effect, this means that while the circular probe is being formed, at least a portion of the linear probe hybridizes to the polynucleotide, and preferably, the cyclization process occurs while the probe hybridizes to the polynucleotide.

[0047] In one method, the in situ formation of the circular probe can be achieved by:

[0048] (a) providing a linear single-stranded nucleotide probe that includes, in the 5' to 3' direction: a 5' complementary region (5'CR), an optional linker region, and a 3' complementary region (3'CR); wherein the 5'CR and the 3'CR are configured to hybridize to respective independent sequences (hybridization sites) on the tethered single-stranded polynucleotide;

[0049] (b) hybridizing the 5'CR of the probe to the tethered single-stranded polynucleotide in the direction of the 3'CR of the probe; wherein the sequence to which the 5'CR hybridizes is upstream (i.e., closer to the 5' end of the tethered polynucleotide) of the sequence to which the 3'CR hybridizes;

[0050] (c) optionally, extending the 3' end of the linear probe using the sequence of the single-stranded polynucleotide as a template; and

[0051] (d) The probe is circularized by ligating the optionally extended 3'-end of the probe to the 5'-end of the probe. Such linear probes may be referred to as "molecular inversion probes".

[0052] The sequences of the 5'CR of the probe and the 3'CR of the probe are selected such that after optional extension and ligation, a single-stranded circular probe comprising a complementary copy of the target sequence is generated. The sequences of the 5'CR and 3'CR can be selected from a variety of arrangements.

[0053] In non-limiting examples, the 5′CR can hybridize only to the 5'-adapter, or to the 5'-adapter and the 5'-most portion of the SOI, or only to the 5'-most portion of the SOI. Similarly, the 3'CR can hybridize only to the 3'-adapter, or to the 3'-adapter and the 3'-most portion of the SOI, or only to the 3'-most portion of the SOI.

[0054] The 5′CR can hybridize to a sequence that is entirely upstream of the SOI (i.e., closer to the 5'-end of the tethering polynucleotide than the SOI) (e.g., such that the 5'-most nucleotide of the 5′CR is complementary to a nucleotide upstream of the 5'-most end of the SOI), or the 5'CR can hybridize to a sequence that overlaps the 5′-end of the SOI (e.g., such that the 5'-most nucleotide is complementary to a nucleotide within the SOI), or the 5'CR can hybridize to a sequence that is entirely within the SOI (e.g., such that the 3'-most nucleotide of the 5'CR can hybridize to the 5'-most nucleotide of the SOI, or to a nucleotide further towards the 3').

[0055] Similarly, the 3′CR can hybridize to a sequence that is entirely downstream of the SOI (i.e., closer to the 3'-end of the tethering polynucleotide than the SOI) (e.g., such that the 3'-most nucleotide of the 3'CR is complementary to a nucleotide upstream of the 3'-most end of the target sequence), or the 3'CR can hybridize to a sequence that overlaps the 3'-end of the SOI (e.g., such that the 3'-most nucleotide is complementary to a nucleotide within the SOI), or the 3'CR can hybridize to a sequence that is entirely within the SOI (e.g., the 5'-most nucleotide of the 3′CR can hybridize to the 3'-most nucleotide of the SOI).

[0056] In some cases, the 3′CR may hybridize and extend before the 5'CR hybridizes to its target. In these cases, the extended 3'CR may prevent the hybridization of the 5'CR and cause the amplification to fail, which results in a lower yield of the extended polynucleotide and a weaker signal in the sequencing reaction. To prevent this from happening, the 5'CR can be hybridized to the tethering polynucleotide before the 3'CR hybridizes. This ensures that the 3'-end of the probe cannot be extended before the 5'-end of the probe hybridizes (seeFigure 4 A). In one method, the sequences of the 5'CR and 3'CR are selected such that the T of the 5'CR m is higher than the T of the 3'CR m . Then, a protocol including an appropriate temperature profile will ensure that 3' extension and ligation proceed as required. For some nucleotide sequences, it is possible to select sequences with appropriate T m such that the 5'CR and 3'CR of the MIP will hybridize to that sequence in the manner described above. In other cases, it may be necessary to provide 5' and 3' adapters including sequences with appropriate T m . Such adapters can be added to the polynucleotide or target sequence at an appropriate time point in any preparation protocol or workflow using standard methods.

[0057] When an appropriate temperature profile is employed, there should be a sufficient difference between the T of the 5'CR and 3'CR m to ensure that the 5'CR hybridizes before the 3'CR. The profile takes into account production speed, yield, and unwanted by-products. Typically, the difference in their T m should be between 2 °C and 20 °C, for example at least 2 °C, 3 °C, 4 °C, 5 °C, 6 °C, 7 °C, 8 °C, 9 °C, 10 °C, 11 °C, 12 °C, 13 °C, 14 °C, or 15 °C or more, but it has been found that a difference of about 10 °C can give good results.

[0058] Accordingly, in a further embodiment, the present invention provides an improved molecular inversion probe for preparing a clone cluster of tethered polynucleotides, for example, as further described herein, the molecular inversion probe comprising or consisting of, in the 3' to 5' direction: (a) a 3'CR, (b) an optional linker region, and (c) a 5'CR, wherein the sequence of the 3'CR is selected to hybridize to a first portion of the tethered polynucleotide, and the sequence of the 5'CR is selected to hybridize to a second portion of the tethered polynucleotide, the second portion being independent of the first portion; and wherein the T of the 5′CR m is higher than the T of the 3'CR m . The method is shown in Figure 4 B.

[0059] As detailed further above and elsewhere herein, the first portion of the tethered polynucleotide and the second portion of the tethered polynucleotide (i.e., the two hybridization sites for hybridization of the CR of the MIP) can be independent of each other through the target sequence, the complementary sequence of the target sequence, or a portion thereof, depending on the selection of the sequences to which the 5'CR and 3'CR hybridize.

[0060] Accordingly, step (b) in the method for in situ forming a circular probe described above may include the step of: at a temperature higher than the T of the 3'CR mbut equal to or lower than the T of the 5'CR m at a temperature equal to or lower than the T of the 5'CR, hybridize the 5′CR of the probe to the tethered single-stranded polynucleotide; then at a temperature lower than the T of the 5′CR m , particularly at a temperature equal to or lower than the T of the 3'CR m hybridize the 3'CR of the probe to the polynucleotide.

[0061] Exemplary MIPs for such a protocol are given below. Such MIPs were used in the case of Example 6 described further below and can be used in combination with the following temperature profile: 95 °C for 2 minutes, 55 °C for 10 minutes to hybridize the 5′CR; then 45 °C for 30 minutes to hybridize the 3'CR before extension and ligation.

[0062] / 5Phos / ATGAAGCCAAGGC TGGTGGGTCGACAGCAGCTTCAACATTCGTTAGTCGAATCAGTCCTGTCCGAG AAAACGAGACATGCC SEQ ID NO:1

[0063] Another aspect of the invention provides a method for preparing a clonal cluster of tethered polynucleotides, comprising: (i) providing a single-stranded polynucleotide tethered to a surface by its 5' end; (ii) performing a first clonal amplification of the single-stranded polynucleotide to provide a first polynucleotide cluster, wherein the polynucleotides in the cluster are tethered to the surface by their respective 5' ends; and (iii) extending the tethered single-stranded polynucleotides in the first cluster by rolling circle amplification using a MIP as described herein (particularly the improved MIP described above). The tethered polynucleotide can be any polynucleotide further described elsewhere herein. In one method, the method of rolling circle amplification can include: (a) contacting the polynucleotides in the first cluster with a MIP (such as the improved MIP described above); (b) at a temperature higher than the T of the 3'CR m but equal to or lower than the T of the 5'CR m hybridize the 5′CR of the MIP to the tethered single-stranded polynucleotide; then at a temperature equal to or lower than the T of the 3'CR m hybridize the 3'CR of the probe to the polynucleotide; (c) optionally extend the 3' end of the MIP; (c) circularize the probe by ligating the optionally extended 3′ end of the probe to the 5' end of the probe; and (d) contacting the circularized probe with a strand displacement polymerase to extend the single-stranded polynucleotide.

[0064] As described above, the RCA method can be applied to extend a sequence regardless of whether the SOI has a known sequence, a partially known sequence, or a completely unknown sequence. When the 5'CR and 3'CR hybridize only to sequences within the 5′-adapter and 3'-adapter of the SOI, the unknown sequence can be amplified. In other arrangements, when the adapter is to hybridize at least partially to the SOI, the sequence of the SOI or at least a portion thereof is generally required to be known.

[0065] The linear probe may also include a linker region. The linker region (if present) extends from the 3′-end of the 5′CR to the 5'-end of the 3′CR. Similarly, when the probe is provided as a preformed circular probe, it may additionally include a linker region that extends from the 3'-end of the sequence complementary to the SOI to the 5'-end of the sequence complementary to the SOI; or when the probe includes a region complementary to any flanking region present in the tethering polynucleotide, the linker region extends from the 3'-end of the 3' flanking region to the 5'-end of the 5′ flanking region (if present).

[0066] In either case, the linker may include one or more functional sequences that will be replicated complementarily as the linker extends. These functional sequences may include, for example, sequences complementary to sequencing primers or amplification primers, or may include sequences complementary to additional capture oligonucleotides described elsewhere herein.

[0067] In one embodiment, the linker includes a sequence that hybridizes to a second capture oligonucleotide bound to a surface during complementary replication. In some embodiments, this sequence is different from the sequence of the 3'-adapter or 5'-adapter and enables optional use of branched RCA in a second round of cloning amplification, as further described elsewhere herein.

[0068] The length of the linker region need only be sufficient to accommodate any functional sequences required therein and to ensure efficient cyclization of the probe. Thus, the linker can be of any suitable length. For example, the length of the linker can be from 40 nt to 160 nt, preferably from 40 nt to 70 nt. A shorter linker ensures a smaller circular probe is obtained, thereby reducing steric hindrance while enabling efficient RCA that requires fewer nucleotides.

[0069] In some embodiments, once the linear probe hybridizes to the tethered polynucleotide, the 3' and 5' ends of the linear probe can be made independent of each other by one or more nucleotides. Generally, the 3' and 5' ends are made independent of each other by all or a portion of the SOI, depending on the location of the sequences to which the 5'CR and 3'CR hybridize. A polymerase (preferably a polymerase lacking 5' to 3' exonuclease activity) can be used to extend the 3' end of the probe. Exemplary polymerases include T4 polymerase or Taq polymerase. Once the 3' end has been extended, a ligase (such as T4 ligase or Taq ligase) can be used to ligate the extended 3' end to the 5' phosphorylated end to circularize the probe. In some embodiments, the 5'CR and 3'CR of the linear probe together extend to cover the entire SOI, in which case no extension is required and the 3' and 5' ends are simply ligated to circularize the probe.

[0070] Regardless of whether the circular probe is provided prefabricated or formed in situ, once the probe is in place, the circular probe can be used as a template to extend the 3' end of the tethered polynucleotide. One or more copies of the SOI are further added to the 3' end of the tethered polynucleotide, providing a cluster of tethered polynucleotides, wherein the polynucleotides (or at least a portion thereof) in the cluster include multiple copies of the target nucleotide sequence. Extending the tethered single-stranded polynucleotide in the first cluster provides additional copies of the SOI without increasing the density of the capture oligonucleotides or expanding the area occupied by the original cluster.

[0071] In some embodiments, such as when the circular probe does not hybridize to the entire 3' adaptor of the SOI, there may be a short single-stranded 3' overhang, in which case it can be removed using a 3'-5' exonuclease or the 3'-5' exonuclease activity of a polymerase (such as Phi29 polymerase) can be utilized.

[0072] In some cases, the 3' end of the tethered polynucleotide may extend around the probe before the circularization ligation is complete. If this occurs, the 5' end of the probe may become detached from the polynucleotide and the circularization ligation may not occur. Thus, in some embodiments, the extension of the 3' end of the polynucleotide is blocked (or at least delayed) while the gap filling extension and ligation are being completed. In some embodiments, this is achieved by hybridizing a single-stranded circular polynucleotide probe to the tethered polynucleotide leaving a 3' single-stranded overhang. Advantageously, the overhang is not complementary to the probe, thereby preventing the formation of a double-stranded feature suitable for extension by a polymerase. The 3' extended end can then be removed by exonuclease activity before the circular probe is replicated.

[0073] In additional embodiments, the single-stranded circular polynucleotide probe hybridizes to the 3' adaptor, leaving a 3' overhang sufficient to hybridize to a protective oligonucleotide, the 5' end of which is co-terminal with the 3' end of the overhang. The T m of the oligonucleotide duplex is m lower than the T m of the probe, thus preventing strand extension until the temperature is raised above the T

[0074] of the oligonucleotide duplex to remove the oligonucleotide. The overhang can then be removed as described above. Using a polymerase, preferably a strand-displacing polymerase, the 3' end of the tethered polynucleotide is extended around the probe. In this way, as synthesis proceeds, the probe is continuously displaced from the extended amplicon, and multiple copies of the SOI are synthesized. In the extended amplicon, the SOI copies are interspersed with sequences complementary to the remainder of the circular probe. Depending on the sequences to which the 5′CR and 3'CR of the linear probe hybridize, the flanks of the SOI may also be full-length or truncated forms of the adaptor.

[0075] If the CR incorporates complementary copies of various functional sequences in the adaptor, the functional sequences will be replicated in the extended amplicon and the functional sequences will remain associated with the SOI. Thus, in some embodiments, the sequences of the 5′CR of the probe and the 3'CR of the probe are selected such that, after optional extension and ligation, a single-stranded circular probe is generated that includes a complementary copy of the target sequence and copies of the 5' adaptor and / or 3' adaptor; or such that either adaptor is sufficient to include one or more functional sequences, such as any of the functional sequences further described herein. Particularly preferably, when the 3' adaptor includes a region complementary to a sequencing primer, the sequence of the 3'CR is selected to maintain the functional relationship between the sequencing primer and the SOI, as further described herein.

[0076] The combination of MIP hybridization, circularization, and rolling circle amplification may be referred to herein as Linear Cluster Concatemerization or LCC.

[0077] In one embodiment, the second capture oligonucleotide can be provided on a surface as a population mixed with the first capture oligonucleotide. The second capture oligonucleotide hybridizes to a complementary sequence within the circular probe adaptor region, but does not hybridize to the SOI or its 5' or 3' adaptors. As the circular probe is repeatedly replicated, it provides complementary copies of the adaptor interspersed with copies of the SOI and the adaptors. The complementary copies of the adaptor expose multiple sequences that can hybridize to the second capture oligonucleotide, and thus the extended strand is captured by the second capture oligonucleotide at multiple sites. Then, the 3' end of the capture oligonucleotide is extended by the action of a polymerase to form a complementary copy of the SOI and a sense copy of the adaptor. As the new strand is extended, it displaces the next duplex from the next copy of the second capture oligonucleotide, thereby generating multiple tethered polynucleotides that include multiple complementary copies of the SOI alternating with copies of the ligation region. Then, sequencing primers complementary to the appropriate adaptors can be used to sequence the forward and reverse strands of the SOI from the same cluster.

[0078] Once the extended clone cluster is generated, it can be used for various downstream processes as further described herein. In one embodiment, the sequence or partial sequence of the SOI within the 3-D cluster can be determined by nucleotide sequencing methods.

[0079] Sequencing can be performed by any method suitable for polynucleotides immobilized or tethered to a surface, particularly a method known as "sequencing by synthesis (SBS)". In this method, after the clone cluster is prepared, the sequencing primer is annealed to the 3' adaptor, and the nucleotides sequentially incorporated into the extended strand complementary to the SOI are detected. In some methods, the nucleotides are labeled with a fluorescent dye. The dye can act as a chain termination agent. After each dNTP incorporation, the dye is imaged to identify the base, and then the dye is excised to allow the incorporation of the next nucleotide. In other methods, the clonally amplified polynucleotides are tethered to the surface of a semiconductor chip (e.g., an ISFET), and each nucleotide incorporated into the SOI is detected by detecting the protons released during the incorporation of the dNTP into the sequence (one proton is released for each nucleotide incorporated). In this case, the dNTPs do not need to be fluorescently labeled.

[0080] There are various variants of next-generation sequencing methods, including variants that rely on SBS, but the clonal amplification method described herein is suitable for use in conjunction with any sequencing method that can be performed on a population of immobilized polynucleotides.

[0081] In additional embodiments, the present invention also provides a substrate having a plurality of single-stranded polynucleotides coupled to its surface, which single-stranded polynucleotides are arranged in a plurality of clonal clusters, wherein the polynucleotides within each clonal cluster include multiple copies of a first nucleotide sequence and multiple copies of a second nucleotide sequence that alternate, wherein the first nucleotide sequence is common to the single-stranded polynucleotides in each cluster, and the first sequence is not. In additional embodiments, the present invention also provides a clonal cluster of single-stranded polynucleotides as described herein, wherein the polynucleotides in the cluster are tethered to the surface by their respective 5' ends.

[0082] In some embodiments, the first sequence (corresponding to the target sequence discussed further elsewhere herein) may be present in the cluster in the sense or antisense form, but not both simultaneously. In some embodiments, both the sense and antisense forms of the first sequence are present in the cluster. In such cases, the polynucleotides in each cluster include sense and antisense copies of the first sequence and sense and antisense copies of the second sequence, the sense and antisense copies of the second sequence being common to the single-stranded nucleotides in each cluster, and the sense and antisense copies of the first sequence not being common to the single-stranded nucleotides in each cluster.

[0083] Typically, the polynucleotides within each cluster include multiple copies of the first sequence (or its antisense sequence). In preferred embodiments, they include at least 2 copies, preferably at least 3 copies, more preferably at least 4 copies, and even more preferably at least 5 copies of the first sequence or its antisense sequence. Similarly, the polynucleotides within each cluster include multiple copies of the second sequence (or its antisense sequence). In preferred embodiments, they include at least 2 copies, preferably at least 3 copies, more preferably at least 4 copies, and even more preferably at least 5 copies of the second sequence or its antisense sequence.

[0084] Typically, the polynucleotides within each cluster have free 3' ends. Typically, since the surface initially includes 1, 2, 3, 4, 5 or more capture oligonucleotides, in some cases, the regions that do not include the clustered polynucleotides will include unused capture oligonucleotides, and may thus also include 1, 2, 3, 4, 5 or more capture oligonucleotides that generally remain unhybridized to the polynucleotides. However, there are typically few unused capture oligonucleotides within the cluster because they are gradually locally depleted during the first round of clonal amplification. In some embodiments, the surface includes a single type of capture oligonucleotide, and in some embodiments, the surface includes two capture oligonucleotides.

[0085] The number of clusters that include the same first sequence depends on the number of types of SOI present. Thus, for example, if only 2 types of SOI are present, 50% of the clusters will include the same first sequence.

[0086] As used herein, a free 3'-end refers to a terminal 3'-nucleotide having a free 3'-OH group that is capable of being extended by the action of a polymerase (such as a strand displacement polymerase). It is not part of a hairpin structure or other secondary structure.

[0087] As used herein, clonal amplification is the proliferation of a single polynucleotide to provide multiple copies (clones) having the same sequence. The single polynucleotide and its clones are typically tethered to a substrate surface by their respective 5′-terminal nucleotides or 3'-terminal nucleotides (preferably by the 5'-terminal nucleotide). A clonal cluster is a plurality of polynucleotide clones that are clustered together (especially in a tightly packed manner) in discrete regions on the surface. Clonal clusters are typically obtained by clonal amplification of a single starting tethered polynucleotide, but alternatively, they can also be obtained by spotting a composition comprising a single species of polynucleotide onto the surface. In some embodiments, it may be desirable to have clonal clusters that include more than one polynucleotide. For example, they may include copies of a single-stranded polynucleotide and complementary copies of that single-stranded polynucleotide. Clonal clusters may overlap with other clonal clusters, but preferably do not.

[0088] As used herein, two sequences are considered complementary if the nucleotides in one strand undergo Watson Crick base pairing with the nucleotides in the other strand. The two strands are complementary copies of each other.

[0089] As used herein, when two sequences are said to hybridize to each other, they do so under the conditions of the process being discussed, and thus when a primer is said to hybridize to a nucleotide sequence, it does so under the conditions (such as ionic strength, pH, temperature) of primer extension, sequencing, etc.

[0090] As used herein, the term "polynucleotide" refers to a polymer of two or more nucleotides linked by covalent bonds (usually phosphodiester bonds). In some cases, a polynucleotide may include "non-natural" bonds such as phosphorothioate bonds, for example when it is advantageous to reduce or prevent exonuclease activity. The terms "polynucleotide fragment", "oligonucleotide" have the same meaning as polynucleotide, and these terms may be used interchangeably. A polynucleotide can be single-stranded or double-stranded, and can be DNA, RNA, or a DNA / RNA hybrid duplex.

[0091] As used herein, the term "tethered" refers to the polynucleotide being attached to a surface or to any coating covering the surface by a chemical bond (preferably a covalent bond). BRIEF DESCRIPTION OF THE DRAWINGS

[0092] Figure 1A schematic overview of clone amplification using the recombinase polymerase method is provided. A is a double-stranded DNA fragment; B is a fragment with 5' and 3' adapters; C is a melted duplex; D shows the process of clone amplification using the recombinase polymerase amplification method; E is a substrate with a bound cluster of the same sequence.

[0093] Figure 2 A schematic diagram showing a method for rolling circle amplification of a target sequence is provided, which is particularly applicable to the case where the sequence is known.

[0094] Figure 3 A schematic diagram showing another method for rolling circle amplification of a target sequence using molecular inversion probes (MIPs) is provided.

[0095] Figure 4 A shows the effect of 3'CR binding before 5'CR. (i) shows successful cyclization, and (ii) shows unsuccessful cyclization.

[0096] Figure 4 B shows an improved MIP, where the T of 5'CR m is 60 °C, while the T of 3'CR m is 55 °C. Thus, an exemplary cyclization protocol to be used can be as follows: denaturation - 95 °C for 2 minutes, 5' annealing - 60 °C for 5 minutes, 3' annealing, extension, and ligation - 50 °C for 10 minutes.

[0097] Figure 5 A is a composite fluorescence micrograph showing the results of a clone amplification spotting assay on YdfU and ddl templates with 50 μM capture oligonucleotides (optimal for RPA) and 2 μM capture oligonucleotides (optimal for RPA+LCC). The test templates were clone amplified either by RCA alone or by RCA followed by LCC. The templates were bound to the ISFET surface. At this magnification, individual clone clusters are visible only at certain points.

[0098] Figure 5 B shows Figure 5 the scanning data of the points in A.

[0099] Figure 6 Data obtained from sequencing reactions of RPA clone clusters (YdfU) and dual-template RPA+LCC clone clusters (YdfU and ddl) are shown. Figure A provides read length data for RPA clusters and RPA+LCC clusters. Figure B gives the distribution of ARL-e.

[0100] In Figure A, a graph is plotted with each reading as the aligned read length (ARL: total aligned length from the starting position to the ending position) on the x-axis against the aligned read length - number of errors (ARL-e: total aligned length from the starting position to the ending position minus the number of errors) on the y-axis. The histogram portion represents the distribution of the readings on the opposing axis. The top histogram represents the distribution of ARL(bp); the histogram on the right side of the figure represents the distribution of ARL-e(bp). Figure B gives the distribution of ARL-e. Figure C shows the signals generated by sequencing strands (differing from each other by 1 mer in RPA and LCC) during single nucleotide incorporation extension in synthetic sequencing.

[0101] Figure 7 A fluorescence micrograph is shown, which displays the clone clusters generated by a single polynucleotide captured on a submerged-filled ISFET chip. The clusters generated by RPA (micrograph A) appear as faint cloud-like features (indicated by arrows). The white dots are control points. Micrograph B shows the clone clusters (indicated by arrows) generated by subsequent LCC amplification after RPA. RPA was performed on the capture oligonucleotide applied at 25 uM, while RPA + LCC was performed on the oligonucleotide applied at 1 uM. The capture oligonucleotide was extHDA72R and the template was YdfU.

[0102] Figure (c) shows the intensity of each pixel on each of the 5 chip images. A graph is plotted with intensity (X-axis) against the percentage of pixels on each chip that have at least that intensity (Y-axis).

[0103] Figure 8 Shows data similar to Figure 5 but where an improved MIP was used. Figure 8 In the manner of Figure 7 the intensity of each pixel on each of the 6 sample point images is shown. A graph is plotted with intensity (X-axis) against the percentage of pixels on each chip that have at least that intensity (Y-axis).

[0104] Figure 9 : A grayscale image of a single sample point is provided, which is generated by binding the capture oligonucleotide to a glass slide, subsequently hybridizing with an equimolar mixture of the YdfU template and the ddl template, and then performing clone amplification. After the RPA stage and subsequently after the LCC stage, the sample point is probed with the YdfU fluorescent probe and the ddl fluorescent probe. The arrows in the left image point to individual ddl clone clusters. The right image highlights these same clone clusters as black dots, indicating that these clusters were not detected by the YdfU probe even after LCC, thus maintaining clonality.

[0105] Figure 10: Displays 1mer intensity data obtained from sequencing reactions of YdfU clone clusters generated by RPA alone or by RPA+LCC, where loops were generated in solution. Figure A provides read length data for clusters generated by RPA and by RPA+LCC using loops generated in solution. Figure B presents the distribution of ARL-e in the manner of Figure 6 as shown.

[0106] Figure C shows the signals generated by the incorporation of individual nucleotides into the extended sequencing strand.

[0107] Figure 11 Displays a custom flow cell attached to an ISFET chip to assist in reagent delivery and flow onto the surface of the ISFET chip. Detailed Description

[0108] Discussion of the Drawings

[0109] See Figure 1 and the description elsewhere in this document. When performing clone amplification using surface-phase recombinase polymerase amplification (RPA), a single-stranded polynucleotide (3) is captured using a reverse primer (capture oligonucleotide) (1) bound to the surface (2). The process of tethering the capture oligonucleotide is described elsewhere in this document, and the general nature of this process is well known.

[0110] The single-stranded polynucleotide (3) can be derived from exemplary upstream workflows (A, B, C), which can include providing a polynucleotide fragment (4) and providing adaptors (5, 6) at the 5'-end and / or 3'-end. The double-stranded form is separated (if the fragment is double-stranded) to obtain the single-stranded polynucleotide (3).

[0111] The capture oligonucleotide (1) has a sequence complementary to the 5' region of the polynucleotide (e.g., the 5' adaptor (7)) in its 3' region, which helps capture the polynucleotide. The 3′ end of the capture oligonucleotide is extended along the captured polynucleotide by the action of a polymerase to provide a complementary copy of the polynucleotide. This complementary copy (8) is tethered to the substrate by its 5' end, which is now an extension of the original capture oligonucleotide (1). The concerted action of a recombinase and an ssDNA-binding protein enables a solution-phase forward primer (10) complementary to the 3' end of the tethered complementary copy to contact the duplex. Then, a strand-displacing polymerase extends the hybridized forward primer over the complementary strand and displaces the original oligonucleotide while providing a replicated copy of it. Then, the original polynucleotide (3) is freely captured by another local capture oligonucleotide (12). Repeated rounds of primer hybridization and extension provide multiple copies of the original polynucleotide, which are themselves released into the solution and captured by local capture oligonucleotides, thus providing templates for further rounds of amplification. After denaturing the remaining duplex molecules, the tethered oligonucleotides in the clone cluster are cloned copies of the original polynucleotide but in complementary form (14).

[0112] See Figure 2 , in some methods, particularly where the SOI is known, the circular probe can be provided as a preformed circular probe (21) that includes a complementary copy of the target sequence (22). Then, a complementary copy of the SOI can be hybridized to the tethered SOI (23), (and optionally, to any 5' or 3' adaptors (24, 25)), and then the circular probe is replicated complementarily by using a strand-displacing polymerase (P) to extend the 3' end of the tethered oligonucleotide (26). The circular probe can be prepared from a linear probe (27) that includes a complementary copy of the target sequence (22). One or more flanking regions (28, 29) can be included. The 5' and 3' ends of the linear probe are pulled together and ligated (L) by splint oligonucleotides complementary to these two ends. In the method shown, the optional flanking regions are pulled together to form a junction (31). If necessary, the duplex can be separated and the splints digested, leaving the circular probe intact. If the flanking regions include complementary copies of adaptors, they will be incorporated into the extended amplicons even if no adaptors are present on the tethered polynucleotide. In fact, the ligation between the free ends of the loop can occur at any site in the loop, not necessarily the two flanking regions, see Example 8.

[0113] See Figure 3, In one method, the circular probe is provided in the form of a linear single-stranded polynucleotide (40) that includes a 5′CR (41), a linker region (42), and a 3′CR (43) in the 5' to 3' direction. These two CRs hybridize to respective independent sequences on the tethered polynucleotide (44). In this case, they hybridize to complementary sequences within the 5' adaptor and 3' adaptor (45, 46). Using a DNA polymerase, the 3′ end of the linear probe is extended using the tethered polynucleotide as a template, thereby providing a complementary copy (47) of the SOI. The probe is then circularized by ligating the extended 3' end of the probe to the 5' end of the probe. Using a strand displacement polymerase, the 3' end of the tethered polynucleotide template is extended around the probe, and as the amplicon is extended, the strand displacement polymerase will eventually displace the 3' end of the duplex (48).

[0114] Using the RCA method to extend the amplicon provides multiple repeats of the tethered polynucleotide template (49) that are independent of each other through complementary copies of the linker (50). By complementary repeated copying of the circular probe, the 3′ end of the original tethered polynucleotide is extended.

[0115] A and B show methods to prevent detachment of the MIP from the template due to extension of the 3' end of the tethered polynucleotide beyond the extension of the 3' end of the MIP. In A, the 3'CR of the MIP is hybridized to the tethered polynucleotide (44), leaving a 3' overhang (51) that is not complementary to the MIP. This prevents the formation of a duplex feature with a free 3' end suitable for extension by a polymerase. The 3' extended end can then be removed by 3′-5' exonuclease activity before circular probe replication. In B, the 3′ overhang (52) is sufficient to hybridize to a short protective oligonucleotide (53) whose 5' end is co-terminal with the 3' end of the overhang. The T of the short duplex m is lower than the T of the probe m , thereby preventing strand extension until the oligonucleotide is removed by raising the temperature above the T of the short duplex m . The overhang can then be removed as described above.

[0116] See Figure 11 , the circuit board (91) includes an ISFET chip (92) that has a surface (93). A gasket (94) provides a seal between the chip (92) and the flow cell (95), which is fixed above the ISFET chip (92) with screws (96), thereby providing a flow path between the inlet (97) and the outlet (98) above the chip. The inlet and outlet can be sealed with screw caps (99) with "O" - rings (100) to prevent evaporation.

[0117] Other accompanying drawings are further discussed in appropriate embodiments. The present invention is exemplarily illustrated below by non-limiting examples and accompanying drawings. Based on these descriptions, those skilled in the art will be clear about other embodiments of the present invention.

[0118] Example

[0119] Unless otherwise specified, the following buffers and reaction mixtures are used in the examples below:

[0120] Table 1: RPA Buffer Mixture - Supplied as a premix. This mixture contains all the non-enzyme reagents in the RPA final mixture.

[0121] RPA Buffer Mixture

[0122]

[0123] Table 2: RPA Core Mixture - Supplied as a premix. This mixture contains all the enzyme reagents in the RPA final mixture.

[0124] RPA Core Mixture

[0125]

[0126] Table 3: RPA Final Mixture. This mixture is a combination of two RPA premixes and contains all the reagents required for surface-phase RPA.

[0127] RPA Final Mixture

[0128]

[0129] Table 4: Cyclization Mixture. This mixture contains all the reagents required for MIP extension and ligation.

[0130] Cyclization Mixture

[0131]

[0132] Table 5: RCA Mixture. This mixture contains all the reagents required for rolling circle amplification of the surface-conjugated clusters generated by RPA.

[0133] RCA Mixture

[0134]

[0135] Example 1: Coupling of capture oligonucleotides to the surface

[0136] The semiconductor chip used in this example is fabricated using standard CMOS methods and includes an ion-sensitive field-effect transistor (ISFET) sensor array whose voltage output responds to changes in the pH value of the fluid solution residing in the pores above the IC. The pores are of micron-scale dimensions and are made by standard photolithography processes. A custom flow cell device (see Figure 9 ) is mounted on top of the IC and pore assembly to facilitate the conveyance of fluid across the chip surface. The oligonucleotides are conjugated to the surface of the pores by first activating the pore surface with an acrylamide-based polymer coating with free azide groups (MCP-Click TM -Lucident Polymers, Sunnyvale, CA, USA), and subsequently flooding the surface with an appropriate solution of 5'DBCO-captured oligonucleotides at a concentration optimized for the 2-D RPA method (50 uM) or at a concentration optimized for the 3-D (RPA+LCC) method (2 uM). The modified oligonucleotides are covalently conjugated using the standard dibenzocyclooctyl (DBCO) / azide click chemical reaction. The sequence of the extHDA72R capture oligonucleotide is as follows:

[0137] / 5'DBCOTEG / AAAAAAACTCCTCTGGCACCGTGCTGCCTTGGC TTCATTGTG*G*T*C (SEQ ID NO.2)

[0138] DBCOTEG = 5′-dibenzocyclooctyl:triethylene glycol. * = phosphorothioate bond (Integrated DNA Technologies – IDT, Iowa, USA).

[0139] In an alternative method, instead of flooding the chip, the capture oligonucleotides are spotted onto the pre-cleaned chip surface in volumes of 280 picoliters to 300 picoliters. The oligonucleotides are conjugated to the surface in the same manner.

[0140] In some experiments, glass slides are used instead of ISFET chips. When using glass slides as the substrate, prior to conjugating the capture oligonucleotides, the glass slides are first coated with Ta 2 O 5 using electron beam evaporation according to standard methods, and subsequently coated with an acrylamide-based polymer coating with free azide groups as described above.

[0141] Example 2: Hybridizing the test template to the capture oligonucleotide

[0142] Synthetic DNA oligonucleotides representing the D-alanine-D-alanine ligase gene (ddl) from Enterococcus faecalis and the Qin prophage protein YdfU gene (YdfU) from Escherichia coli (purchased from IDT Technologies) were used as test templates. Their sequences are as follows:

[0143] ddl template (SEQ ID NO.3)

[0144] AAAACGAGACATGCCGAGCATCCGC CGCGCTTCAATTCCTTGTTACTGATAGGCTGTTGCTAAAGCATTTTGCAGCTCTTCTCGGTTT GACCACAATGAAGCCAAGGCAGCACGGTGCCAGAGGAGTTTTTTT

[0145] ydfU template (SEQ ID NO.4)

[0146] AAAACGAGACATGCCGAGCATCCGC TGCGGGTATTACTTAGACCTGTTCTGGTGCCTGAGCTTGGGCTGGTGGTCCTTAAGCCGGGCCGTGAATCCATACAGATA GACCACAATGAAGCCAAGGCAGCACGGTGCCAGAGGAGTTT TTTT

[0147] The underlined sequences are the common binding sites for the forward and reverse primers; the bold sequences are the common binding sites for MIP 5′CR and 3′CR.

[0148] An equimolar mixture of YdfU and ddl (2.5e4 copies / ul) - 40ul in 1x annealing buffer (20 mM Tris-HCl pH 7.5, 150 mM sodium chloride, 5 mM magnesium acetate, 0.01% v / v Tween 20 and 5% v / v DMSO) was hybridized to surface-conjugated extHDA72R oligonucleotides (conjugated by spotting or flooding) through the common adaptor region by incubating at 95°C for 2 minutes, at 50°C for 5 minutes, and at 20°C for 10 minutes. After hybridization, the surface was washed twice with 60ul of 1x RPA wash buffer (0.06% SSC pH 7, 0.06% v / v Tween 20).

[0149] Example 3: Clonal amplification of the captured test templates by RPA

[0150] Clonal amplification was performed by surface-phase recombinase polymerase amplification (RPA). The captured test template was incubated with 40 μl of the RPA final mixture (Table 3) at 43 °C for 1 hour, followed by incubation at 75 °C for 10 minutes, and then washed twice with 60 μl of water. After amplification, the duplex was melted by incubating the oligonucleotide duplex with 40 μl of 40 mM NaOH at 20 °C for 10 minutes and washed twice with 1x RPA wash buffer (0.06% SSC, 0.06% v / v Tween 20).

[0151] Example 4: Visualization of Clonal Clusters

[0152] The starting clonal clusters (two-dimensional clusters) amplified in the surface plane were verified by annealing fluorescent oligonucleotides to specific sequences within the surface-bound template.

[0153] The surface-conjugated template with clonal amplification was incubated with an equimolar mixture of 5 μM of YdfU (Cy5) and ddl (Cy3) specific probes in 1x annealing buffer (20 mM Tris-HCl pH 7.5, 150 mM sodium chloride, 5 mM magnesium acetate, 0.01% v / v Tween 20, and 5% v / v DMSO) at 95 °C for 2 minutes, at 50 °C for 5 minutes, and at 20 °C for 10 minutes. After hybridization, the surface was washed twice with 1x RPA wash buffer (0.06% SSC, 0.06% v / v Tween 20). The sequences of these probes are as follows:

[0154] ddl / Cy3: 5’-Cy3-CAACGATTGCTCGAGAATCAT-3’ (SEQ ID NO.5)

[0155] YdfU / Cy5: 5’-Cy5-TGCGGGTATTACTTAGACCTGTTC-3’ (SEQ ID NO.6)

[0156] 5′-Cy3 = 5′-terminal Cy3 fluorophore; 5′-Cy5 = 5′-terminal Cy5 fluorophore

[0157] Use A microarray scanner (Sensovation AG) was used to image and visualize the annealed fluorescent probes, with a red excitation filter for the YdfU Cy5 probe and a green excitation filter for the ddl Cy3 probe, both with an exposure time of 10 ms.

[0158] Example 5: Sequencing

[0159] (a) Preparation of Buffers / Reagents

[0160] Sequencing solution: (7.5 mM MgCl2 , 200 mM NaCl, 0.02% Tergitol NP-9), and this solution was prepared in a glass bottle using deionized water (18 MΩ, Merck Millipore), 1 M magnesium chloride solution, 5 M NaCl, and Tergitol TM NP-9 (pure, Merck). The MgCl 2 stock solution and the NaCl stock solution were added to deionized water to achieve final concentrations of 7.5 mM and 200 mM, respectively. The solution was mixed to homogeneity using a magnetic stirrer plate. Then, to ensure the removal of dissolved carbon dioxide, the solution was purged with nitrogen and maintained under nitrogen. Tergitol NP-9 (250 μl) was added to a final concentration of 0.02%.

[0161] Nucleotides: 10 μM solutions of dGTP, dCTP, dATP, and dTTP each, and this solution was prepared by adding 12.5 μL of the stock solution of 100 mM selected nucleotide (Fisher Scientific, 11843933) to 125 mL of the sequencing solution and adjusting the pH to 8.05 ± 0.01 with 10 mM NaOH. All dNTP solutions were prepared in a nitrogen-controlled environment free of CO 2 .

[0162] Washing solution: This solution was prepared by adjusting the pH of the sequencing solution to 8.05 ± 0.01 with 10 mM NaOH in a nitrogen-controlled environment free of CO 2 .

[0163] Annealing buffer (1x): This buffer was prepared by diluting 20X saline sodium citrate buffer (Life Technologies) to a 1X final concentration of 150 mM NaCl and 15 mM sodium citrate using molecular grade water (Sigma).

[0164] Sequencing primer: A 5 μM working solution of the sequencing primer (using the fluorescent probe in Example 4 as the sequencing primer), and this solution was prepared by adding 1.25 μL of the sequencing primer (100 μM stock solution) to 5 μL of 1X annealing buffer to a final composition of 0.8X annealing buffer containing 5 μM sequencing primer.

[0165] Polymerase: A 25.4 U / μL working stock solution of the sequencing polymerase, and this stock solution was prepared by diluting 1 μL of IsoPol BST+ DNA polymerase (2 kU / μL, ArcticZymes) in 79 μL of the sequencing solution and mixing well.

[0166] (b) General sequencing protocol

[0167] The ISFET chip is equipped with a custom flow cell facility ( Figure 11 ), where the surface of the ISFET is exposed to the solution flowing through the cell. This allows for easy delivery and control of the reagent flow on the surface. The flow cell was rinsed twice with 1x ThermoPol buffer [4.5 mL 10X ThermoPol buffer (New England Biolabs), 27 μL Tween 20 (100% stock solution, Merck Life Science, P9416), 40.5 mL molecular grade water (Sigma)].

[0168] As part of the workflow, a fluorescent probe was applied as a sequencing primer as in Example 4. The sequencing polymerase (25 U / μL) was loaded into the flow cell and incubated for 10 minutes at ambient temperature (about 20 °C to 26 °C). The flow cell was rinsed with 200 μL of 1x ThermoPol buffer.

[0169] A startup step was performed where the wash solution was flowed over the chip at a rate of 5 mL / min. An electrical response test was performed by biasing the reference electrode with increasing voltage steps. The resulting mV output change was measured by the ISFET on the IC to determine the relationship between the reference electrode potential and the corresponding potential displayed on the ISFET, and then this relationship was used to determine the optimal reference electrode potential for the experiment.

[0170] Then sequencing was performed cycle by cycle. During each sequencing cycle, the entire chip was rinsed sequentially with 4 separate dNTP solutions (10 μM each; see preparation details above) (15 seconds per nucleotide @ 5 ml / min), and the nucleotide flows were separated by a wash step. The wash step was carried out in two stages: 1) a "thorough wash" to flush the nucleotide solution out of the fluid channels and the flow cell, and 2) a purge wash where the nucleotide valve device was bypassed via the wash channel to clean the chip while the next nucleotide solution was directed to the waste container via the purge channel. When a nucleotide was incorporated, the accompanying proton release was detected by the integrated circuit as a voltage change.

[0171] Example 6: Comparison of Clonal Amplification by RPA and by RPA Followed by LCC.

[0172] The density of the oligonucleotides captured on the surface is a factor determining optimal capture and amplification. It has previously been found that an optimal density for RPA was obtained using 50 μM of the capture oligonucleotide in the coupling reaction. For RPA followed by LCC, the optimal concentration was 2 μM. Data not shown.

[0173] Prepare glass slides, and arrange the spotting with capture oligonucleotides (extHDA72R) at the optimal density as in Example 1. Then hybridize the YdfU and ddl test templates with the capture oligonucleotides as in Example 2. For all spots, perform clonal amplification by optimized surface-phase RPA as in Example 3. Anneal the fluorescent probes and image the slides as in Example 4. Denature the fluorescent probes with 40 mM NaOH, wash, and then perform LCC as described below.

[0174] (a) Hybridization of Molecular Inversion Probes

[0175] Figure 3 A schematic of the method is given and described in detail above. A molecular inversion probe (MIP) is a single-stranded polynucleotide that has a 20-nucleotide sequence complementary to the 5' universal adapter sequence of the tethered polynucleotide at its 5' end and a 19-nucleotide sequence complementary to the 3′ universal adapter sequence at its 3' end. Between these sequences is a 64-nucleotide linker sequence.

[0176] Hybridize 40 ul of MIP (6.25e11 copies / ul) in 1x annealing buffer (20 mM Tris-HCl pH 7.5, 150 mM sodium chloride, 5 mM magnesium acetate, 0.01% v / v Tween 20, and 5% v / v DMSO) to the universal adapter region of the tethered clonal amplification oligonucleotides in the 2-D cluster by incubating at 95 °C for 2 minutes, stepping down the temperature from 60 °C to 50 °C at 0.2 °C / s, and then incubating at 20 °C for 10 minutes. After hybridization, wash the surface twice with 1x RPA wash buffer (0.06% SSC, 0.06% v / v Tween 20). The MIP sequence is shown below. The 5′ complementary region and 3' complementary region are underlined:

[0177] / 5phos / GACCACAATGAAGCCAAGGC TCGACAGCAGCTTCAACATTCGTTAGTCGAATCAGTCCTGTCCGAGGTATTCTTGCGAGTCTAAT AAAACGAGACATGCCGAGC(SEQ ID NO.7)

[0178] (b) Extension and Circularization of the MIP 3′ End

[0179] Extend the MIP downstream of the 3'-end to incorporate the target sequences of the ddl or ydfU fragments of each surface-conjugated oligonucleotide until reaching the phosphorylated 5'-end of the MIP. Then ligate the MIP to form a loop annealed to the surface-bound oligonucleotide. This process is carried out by incubating the surface-bound oligonucleotide with 40 μl of 1x cyclization mixture (Table 4) at 20 °C for 30 minutes, followed by incubation at 60 °C for 10 minutes. After cyclization, wash the surface twice with 1x RPA wash buffer (0.06% SSC, 0.06% v / v Tween 20).

[0180] (c) Rolling circle amplification of the target sequence

[0181] Replicate the oligonucleotide by incubating the surface-bound oligonucleotide of the first (2-D) clone cluster with 40 μl of 1x RCA mixture (Table 5) at 45 °C for 15 minutes, followed by incubation at 75 °C for 10 minutes. After replication, wash the surface twice with 60 μl of 1x RPA wash buffer (0.06% SSC, 0.06% v / v Tween 20). After amplification, melt the duplex by incubating the oligonucleotide duplex with 40 μl of 40 mM NaOH at 20 °C for 10 minutes and wash twice with 60 μl of 1x RPA wash buffer (0.06% SSC, 0.06% v / v Tween 20).

[0182] Visualize the clone clusters by using a fluorescent probe ( Figure 5 A), and quantify the fluorescence as described in Example 4 ( Figure 5 B). After the RPA clusters are formed into 3-D clusters by rolling circle amplification, the fluorescence intensities of the 50 μM spotted samples show little difference, although there are some regions with increased intensity around the edges of the spots. In contrast, the fluorescence intensity of the 2 μM primer spotted samples increases significantly. Figure 5 B shows the comparison of the spotted fluorescence data. For both YdfU and ddl, RPA + LCC increases the fluorescence intensity by 2 - 3 folds.

[0183] Repeat this example using the improved MIP described above (whose sequence is designed to prevent early binding and extension of 3'CR). The sequence of this MIP is shown below. Hybridize and cyclize the MIP simultaneously by adding the MIP to the cyclization mixture. Use a thermostable polymerase (Titanium Taq) and ligase (HiFi ligase) so that the MIP can hybridize at a higher temperature, with the following heating conditions: 95 °C - 2 minutes, 55 °C - 10 minutes, 45 °C - 30 minutes.

[0184] After cyclization, wash the surface twice with 1x RPA wash buffer (0.06% SSC, 0.06% v / v Tween 20). The results are shown in Figure 8Again, fluorescence was quantified as in Example 4, and a plot was made of the fluorescence distribution of all pixels in the image. The Y-axis is the percentage of pixels with an intensity of at least X value.

[0185] / 5Phos / ATGAAGCCAAGGC TGGTGGGTCGACAGCAGCTTCAACATTCGTTAGTCGAATCAGTCCTGTCCGAG AAAACGAGACATGCCSEQ ID NO:1

[0186] Example 7: Sequencing from cloned clusters.

[0187] As in Example 1, the ISFET chip was coated with ExtHD72R capture oligonucleotides for RPA or RPA+LCC. As in Example 2, the YdfU template was captured on the chip prepared for RPA, and an equimolar mixture of the YdfU template and the dll template was captured on the chip prepared for RPA+LCC. RCA chips were clonally amplified as in Example 3, and RPA+LCC chips were clonally amplified as in Examples 3 and 6. Sequencing was performed from the cloned clusters as in Example 5, and the results are shown in Figure 6 Figure C shows the signals generated by the sequencing strand with single nucleotide incorporation extension during SBS performed as in Example 5. The voltages generated by the ISFET are listed in Table 6.

[0188] Figure 6 A provides the read length data for the RPA (YdfU) clusters and the RPA+LCC (YdfU and ddl) clusters. The read data are also listed in Table 6.

[0189] Table 6

[0190]

[0191] The signals generated by the RPA+LCC clusters are superior to those generated by the RPA clusters alone, which is reflected in the increased read length and read quality.

[0192] Figure 7 Further comparison of RPA clonal amplification and RPA+LCC clonal amplification is shown. RPA was performed on the capture oligonucleotides applied at 25 uM, while RPA+LCC was performed on the oligonucleotides applied at 1 uM. Amplification was performed on the submerged ISFET chip as in Examples 1 to 4 and Example 6. The capture oligonucleotide was extHDA72R, and the template was YdfU. The non-modified MIP (SEQ ID NO:7) was used.

[0193] The fluorescence micrograph shows that: in micrograph A, the RPA clone amplification clusters appear as faint cloud-like features (indicated by the arrows), and the white dots are control points; in micrograph B, the clone clusters generated by subsequent LCC of RPA. The fluorescence of the RPA+LCC clusters (indicated by the arrows) is significantly brighter, indicating a higher density of oligonucleotide clones.

[0194] Figure C shows the fluorescence distribution of all pixels in the chip image. The Y-axis is the percentage of pixels with an intensity of at least X value.

[0195] Example 8: Visualization of Clonality

[0196] As outlined in Example 1, the ExtHD72R capture oligonucleotides were spotted onto the ISFET chip at 10 uM. The template (an equimolar mixture of YdfU and ddl) was applied to the capture oligonucleotides as in Example 2, and RPA clone amplification was performed as in Example 3. At this point, the YdfU clusters and ddl clusters were visualized and imaged using a fluorescent probe as in Example 4. The chip was washed with 40 mM NaOH to remove the fluorescent probe, and LCC was performed as in Example 6. The spots were labeled again with the fluorescent probe and imaged again as in Example 4. Figure 9 Gray-scale images of the clone amplification templates after RPA and after RPA+LCC are shown. The arrows point to individual ddl clone clusters, and the intensity in RPA+LCC is increased compared to RPA alone. The right image shows that these clusters were not detected by the YdfU probe even after LCC.

[0197] Example 9: Generation of YdfU Loops in Solution

[0198] The following reagent mixtures were used in this example:

[0199] Table 7: Linear YdfU MIP / Splint Hybridization Mixture. This mixture contains the linear YdfU MIP and all the reagents required for YdfU MIP splint hybridization.

[0200] YdfU Linear MIP / Splint Hybridization Mixture

[0201]

[0202] Table 8: Linear YdfU MIP / Splint Ligation Mixture. This mixture contains all the reagents required to ligate the linear YdfU MIPs to form YdfU loops including the YdfU template, flanking regions, and MIP linker regions.

[0203] YdfU Linear MIP / Splint Ligation Mixture

[0204]

[0205] (a) Linear MIP / splint hybridization

[0206] According to Table 7, prepare a 50 μl YdfU linear MIP / splint hybridization mixture by mixing 6x10 13 copies of linear YdfU MIP with 1.8x10 14 copies of YdfU MIP splint (1:3) in 1x annealing buffer (20 mM Tris-HCl pH 7.5, 150 mM sodium chloride, 5 mM magnesium acetate, 0.01% v / v Tween 20, and 5% v / v DMSO). Heat the mixture to 95 °C for 3 minutes and then incubate at 60 °C for 1 hour.

[0207] Linear YdfU MIP (SEQ ID NO.8)

[0208] / 5Phos /

[0209] ATCCGCTGCGGGTATTACTTAGACCTGTTCTGGTGCCTGAGCTTGGGCTGGTGGTCCTTAAGCCGGGCCGTGAATCCATACAGATAGACCACAATGAAGCCAAGGCtcgacagcagcttcaacattcgttagtcgaatcagtcctgtccgaggtattcttgcgagtctaatAAAACGAGACATGCCGAGC

[0210] The bold sequences are the universal binding sites for the MIP 5′ complementary region and 3′ complementary region, the lowercase sequences are the linker regions. The uppercase sequences are the YdfU template sequences.

[0211] YdfU MIP splint (SEQ ID NO.9)

[0212] AAGTAATACCCGCAGCGGATGCTCGGCATGTCTCGTTTTA

[0213] (b) Ligation of YdfU loop

[0214] Prepare a 125 μl YdfU linear MIP / splint ligation mixture by adding T4 DNA ligase to the hybridization mixture (Table 7) in 1x T4 DNA ligase buffer. Then incubate the mixture at 20 °C for 1 hour and then perform a heat kill at 75 °C for 15 minutes.

[0215] (c) Extension of the bound polynucleotide

[0216] Prepare the RPA amplified YdfU clusters on the ISFET chip according to Examples 1 to 3. Hybridize the circular probe with the tethered polynucleotide according to Example 6(a) and extend the polynucleotide according to Example 6(c). Then perform sequencing according to Example 5. The results are shown in Figure 10 . When the loop used in LCC is generated in solution (rather than on the surface) using MIP, the signal generated by the RPA+LCC clusters is also superior to that generated by RPA alone, which is reflected in the improved read length and read quality.

Claims

1. A method for preparing a cloned cluster of a target nucleotide sequence, comprising: (i) providing a single-stranded polynucleotide comprising the target nucleotide sequence, wherein the polynucleotide is tethered to a surface by its 5' end; (ii) performing a first cloning amplification on the single-stranded polynucleotide to provide a first polynucleotide cluster, the first polynucleotide cluster comprising multiple single-stranded polynucleotides that are tethered to the surface by their respective 5' ends and comprise the target nucleotide sequence; and (iii) extending the tethered single-stranded polynucleotides in the first cluster by further adding one or more copies of the target nucleotide sequence to provide a cluster of tethered polynucleotides, wherein the polynucleotides in the cluster comprise multiple copies of the target nucleotide sequence.

2. The method according to claim 1, wherein the single-stranded polynucleotide comprises a 5′ adaptor and / or a 3' adaptor.

3. The method according to claim 2, wherein the 5' adaptor comprises a nucleotide sequence configured to hybridize with a sequencing primer.

4. The method according to claim 2 or 3, wherein the 3' adaptor of the template polynucleotide comprises a nucleotide sequence configured to hybridize with a cloning amplification primer.

5. The method according to any one of claims 1 to 4, wherein the 3' adaptor and / or the target sequence is located at the 3' end of the tethered polynucleotide, preferably co-terminal with the 3' end of the tethered polynucleotide.

6. The method according to any one of claims 1 to 5, wherein the tethered single-stranded polynucleotides in the first cluster are extended by rolling circle amplification of the target sequence.

7. The method according to claim 6, wherein the rolling circle amplification is carried out by a method comprising the steps of: (a) providing a single-stranded circular polynucleotide probe comprising a nucleotide sequence complementary to the target sequence in the first cloning cluster; and (b) using the circular nucleotide probe as a template and using a strand displacement polymerase to extend the 3′ end of the tethered single-stranded polynucleotides in the first cloning cluster, thereby extending the 3′ end of the tethered single-stranded polynucleotides by further adding one or more copies of the target sequence.

8. The method according to claim 7, wherein the single-stranded circular polynucleotide probe is synthesized in solution from a linear polynucleotide comprising a complementary copy of the target sequence.

9. The method according to claim 7, wherein the single-stranded circular polynucleotide probe is synthesized in situ; preferably synthesized from a molecular inversion probe whose 5' complementary region and 3' complementary region hybridize with respective independent nucleotide sequences on the tethered polynucleotide.

10. The method according to claim 9, wherein the single-stranded circular nucleotide probe is formed by: (a) providing a linear single-stranded nucleotide probe that comprises: a 5' complementary region, an optional linker region, and a 3' complementary region; wherein the 5' complementary region and the 3' complementary region are configured to hybridize with respective independent sequences on the tethered single-stranded polynucleotide; (b) hybridize the 5' complementary region and the 3' complementary region of the probe to the tethered single-stranded polynucleotide; wherein the 5' complementary region hybridizes to a sequence upstream of the sequence to which the 3' complementary region hybridizes; (c) optionally, extend the 3' end of the probe using the sequence of the single-stranded polynucleotide as a template; and (d) circularize the probe by ligating the optionally extended 3' end of the probe to the 5′ end of the probe; wherein the sequences of the 5' complementary region and the 3′ complementary region of the probe are selected such that optional extension and ligation provide a single-stranded circular probe comprising a complementary copy of the target sequence.

11. The method according to claim 10, wherein the sequence of the 5' complementary region is selected to hybridize only to the 5' adaptor, to the 5' adaptor and the 5' most distal portion of the SOI, or only to the 5' most distal portion of the SOI.

12. The method according to claim 10 or 11, wherein the sequence of the 3' complementary region is selected to hybridize only to the 3' adaptor, to the 3' adaptor and the 3′ most distal portion of the SOI, or only to the 3' most distal portion of the SOI.

13. The method according to claim 10, wherein the 5' complementary region is selected to hybridize only to a sequence in the 5' adaptor, and the 3' complementary region is selected to hybridize only to a sequence in the 3′ adaptor.

14. The method according to any one of claims 9 to 13, wherein the 3' end of the probe is extended using a polymerase lacking 5′ to 3' exonuclease activity.

15. The method according to any one of claims 7 to 13, wherein the single-stranded circular polynucleotide probe binds to the tethered polynucleotide, leaving a 3' single-stranded overhang.

16. The method according to claim 15, wherein a protective oligonucleotide hybridizes to the 3′ overhang.

17. The method according to claim 15, wherein the 3' single-stranded overhang is removed by 3′ to 5' exonuclease activity, and if a protective oligonucleotide is present, the protective oligonucleotide is removed.

18. The method according to any one of claims 10 to 17, wherein a ligation region is present.

19. The method according to claim 18, wherein the ligation region comprises one or more functional sequences; preferably, the functional sequences are selected such that upon complementary replication, it hybridizes to a sequencing primer, or other primer, or a capture oligonucleotide.

20. A method of preparing a clone cluster of single-stranded polynucleotides comprising a target sequence, the method comprising: (i) hybridize a polynucleotide fragment comprising a complementary copy of the target sequence to a capture oligonucleotide, the capture oligonucleotide being tethered to a surface by its 5' end; (ii) extend the 3' end of the capture oligonucleotide using a polymerase to provide a single-stranded polynucleotide comprising the target sequence, the single-stranded polynucleotide being tethered to the surface by its 5' end; (iii) Cloning and amplifying the target sequence using the method according to any one of claims 1 to 19 to provide a cluster of tethered polynucleotides, wherein the polynucleotides in the cluster include multiple copies of the target nucleotide sequence.

21. A method for determining the nucleotide sequence of a single-stranded nucleotide fragment, comprising: (i) tethering the single-stranded fragment to a surface to provide a single-stranded polynucleotide including a target nucleotide sequence that is tethered to the surface through its 5'-end; (ii) cloning and amplifying the target sequence using the method according to any one of claims 1 to 19 to provide a cluster of tethered polynucleotides, wherein the polynucleotides in the cluster include multiple copies of the target nucleotide sequence, (ii) sequencing at least a portion of the SOI in the cluster to determine the nucleotide sequence of the SOI.

22. A substrate having multiple single-stranded polynucleotides coupled to its surface, the single-stranded polynucleotides being arranged in multiple cloning clusters, wherein the polynucleotides within each cluster include copies of an alternating first nucleotide sequence and a second nucleotide sequence, wherein the second nucleotide sequence is common to the single-stranded nucleotides in each cluster, and the first sequence is not common to the single-stranded nucleotides in each cluster.

23. The substrate according to claim 22, wherein the first sequence exists in a sense or antisense form within the cluster, but not both simultaneously.

24. The substrate according to claim 22 or 23, wherein the polynucleotides within each cluster include at least 2 copies, preferably at least 3 copies, more preferably at least 4 copies, and even more preferably at least 5 copies of the first sequence.

25. The substrate according to claims 22 to 24, wherein the polynucleotides within each cluster have free 3'-ends.

26. The substrate according to claims 22 to 25, having a single type of capture oligonucleotide that is tethered to the surface of the substrate through its 5'-end.

27. The substrate according to claims 22 to 26, wherein the polynucleotides within each cluster are covalently coupled to the surface through their 5'-ends.

28. The substrate according to any one of claims 22 to 27, which is an ISFET, a glass or silica substrate, an insoluble particle substrate, or a part of a microfluidic device suitable for bringing the tethered polynucleotides into contact with liquid reagents.

29. A molecular inversion probe for preparing a cloning cluster of tethered polynucleotides, the molecular inversion probe in the 3' to 5' direction comprising: (a) 3'CR; (b) an optional linker region; and (c) 5'CR, Wherein, a sequence of the 3'CR is selected to hybridize with a first portion of a tethering polynucleotide, and a sequence of the 5'CR is selected to hybridize with a second portion of the tethering polynucleotide, the second portion of the tethering polynucleotide being independent of the first portion; and wherein the T of the 5'CR m is higher than the T of the 3'CR m .

30. The molecular inversion probe according to claim 29, wherein the first portion of the tethered polynucleotide and the second portion of the tethered polynucleotide are each independent through the target sequence, or a complementary sequence of the target sequence, or a portion thereof.

31. A method for preparing a cloning cluster of tethered polynucleotides, comprising: (i) providing a single-stranded polynucleotide tethered to a surface through its 5'-end; (ii) Perform a first cloning amplification on the single-stranded polynucleotide to provide a first cluster of polynucleotides tethered to the surface by their 5′ ends; and (iii) Extend the tethered single-stranded polynucleotides in the first cluster using a molecular inversion probe by rolling circle amplification; preferably, using the molecular inversion probe according to any one of claims 29 or 30.

32. The method according to claim 10, wherein the rolling circle amplification comprises: (a) Contacting the polynucleotides of the first cluster with the molecular inversion probe; (b) at a temperature higher than the T of the 3' CR m but equal to or lower than the T of the 5' CR m hybridize the 5' CR of the molecular inversion probe with the bound single-stranded polynucleotide, and then at a temperature equal to or lower than the T of the 3' CR m hybridize the 3′ CR of the probe with the polynucleotide; (c) Optionally, extending the 3′ end of the molecular inversion probe; (c) Circularizing the molecular inversion probe by ligating the optionally extended 3′ end of the probe to the 5′ end of the probe; and (d) Contacting the circularized molecular inversion probe with a strand displacement polymerase to extend the single-stranded polynucleotide.

Images