Targeted methylation library building system and method based on multiple PCR (Polymerase Chain Reaction) and application of targeted methylation library building system
Patent Information
- Application Number
- CN202280100895.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-13
- Publication Date
- 2025-05-30
AI Technical Summary
Existing multiplex PCR technology has problems with primer dimers and non-specific amplification in targeted methylation sequencing, resulting in low detection efficiency and poor accuracy. Especially in DNA samples treated with bisulfite, primer dimers occur. Serious body formation affects the amplification effect.
The semi-nested multiplex amplification method using universal sequence introduction reduces the formation of primer dimers by introducing universal sequences in the first round of amplification, and uses semi-nested specific primers and universal sequences in the second round of amplification. Primers to improve amplification specificity and achieve efficient capture of target methylation sites.
It effectively reduces the ratio of primer dimers and improves amplification specificity. It can simultaneously capture multiple target methylated sites and unmethylated sites in one tube, improving the accuracy of genome methylation site detection. sex and efficiency.
Smart Images

Figure 00000015_0000 
Figure 00000019_0000 
Figure 00000019_0001
Abstract
Description
A targeted methylation library construction system based on multiplex PCR, method and application thereof
[0001] Priority information
[0002] none. Technical Field
[0003] The present invention relates to the field of biotechnology, and in particular to a multiplex PCR-based targeted methylation library construction system, method and application thereof. Background Art
[0004] DNA methylation is an epigenetic modification that regulates protein synthesis without altering the base sequence. For humans, DNA methylation is a remarkable chemical modification. The care of loved ones, aging, smoking, alcoholism, and even obesity are all faithfully recorded in the genome through methylation. The genome is like a diary, with methylation serving as the written record of our experiences. DNA methylation is a crucial epigenetic marker. Obtaining genome-wide methylation data for all C sites is crucial for studying epigenetic temporal and spatial specificity. Genome-wide DNA methylation mapping based on next-generation high-throughput sequencing platforms and the analysis of species-specific methylation patterns with high precision will mark a milestone in epigenomic research and lay the foundation for understanding fundamental mechanisms of cell differentiation and tissue development, as well as for research into animal and plant breeding, human health, and disease.
[0005] Whole Genome Bisulfite Sequencing (WGBS) is the most commonly used method for studying biological methylation. It can cover all methylation sites and obtain a more comprehensive methylation map. However, it encounters many challenges in high-throughput sequencing: (1) Bisulfite treatment will cause single-stranded DNA and cause severe damage; (2) After bisulfite treatment, unmethylated C bases will be converted to U bases, causing extreme changes in the GC content of the entire genome, resulting in a large bias in subsequent amplification; (3) Library construction requires microgram-level starting DNA, and it is difficult to find an effective library construction method for trace amounts of DNA. For clinical testing and certain specific research, whole genome methylation sequencing is complex and too expensive. The use of targeted methylation sequencing technology can effectively solve these problems.
[0006] Targeted methylation sequencing technology can be divided into probe capture and multiplex PCR-based sequencing technologies. For probe capture, the required starting amount is high, and it is difficult to capture some trace samples such as plasma free DNA. In addition, the design and operation process of the probe capture probe is too complicated, the detection cycle is long, and the cost is high.
[0007] Multiplex PCR based on bisulfite-treated DNA requires low input, is simple to operate, and offers high sensitivity, but it also requires high technical requirements. Efficient ultra-multiplexed target amplification remains a major bottleneck. Even sequencing tens of thousands of genomic amplicons is a significant challenge, let alone multiplexed methylation PCR targeting bisulfite-converted sequences, primarily due to the significant formation of primer dimers during the PCR process. Previous reports have demonstrated that single-molecule BS-PCR using droplet technology can simultaneously detect approximately 9,000 targets, but this requires a relatively high input amount of 2 μg of DNA. In 2015, researchers such as Lu Wen developed PCR-based MCTA-seq, which cleverly exploited the characteristic sequences of CpG islands as primer binding sites. This method is extremely sensitive, capable of detecting methylation signals in large numbers of CpG island regions, even from as little as 7.5 pg of gDNA. However, MCTA-seq is more like a fixed CGI panel, making it somewhat less flexible as a targeted sequencing platform. Therefore, developing a targeted methylation technology with low input requirements and high flexibility is a future direction for targeted methylation research.
[0008] The biggest challenges currently faced by bisulfite-based multiplex PCR are primer-dimer formation and primer amplification specificity. In conventional bisulfite-treated multiplex PCR, unmethylated cytosines in DNA are converted to uracil after bisulfite treatment. The majority (99%) of cytosines in the genome are unmethylated, resulting in a base composition of A / T / G in most sequences, rather than the traditional four-base A / T / C / G. In conventional PCR, one primer is designed for the positive strand and one for the complementary strand. Consequently, one strand used for PCR contains an ATG-rich sequence, while the other contains an ATC-rich sequence. This three-base complementary primer sequence is prone to primer-dimer formation. As the number of primer pairs increases, primer-dimer formation increases dramatically. During the multiplex PCR process, excess primers can be depleted by primer-dimer formation, leading to failure. Therefore, addressing the issues surrounding bisulfite-based multiplex PCR requires addressing the vulnerability of primers to primer-dimer formation. Secondly, after DNA is treated with bisulfite, the complexity of the genome is reduced and the base sequence on the genome becomes simple, resulting in a decrease in the specificity of primer binding on the genome, leading to the presence of non-specific products and affecting the amplification effect.
[0009] Therefore, further development of effective methods for detecting methylation sites is still needed.
[0010] Summary of the Invention
[0011] The purpose of the present invention is to solve at least one of the above-mentioned technical deficiencies, in particular the problems of non-specific primer amplification and primer dimers in the prior art multiplex PCR targeted detection of methylation sites.
[0012] To address the issues of primer dimers and specificity, the inventors developed a semi-nested multiplex amplification method that incorporates universal sequences. By incorporating universal sequences, enrichment of target methylated regions was integrated into a two-step semi-nested PCR, reducing primer dimers and improving primer amplification specificity, enabling amplification of tens of thousands of target methylated sites in a single tube. This method is compatible with capturing multiple target methylated sites in a single tube, or multiple target methylated sites and unmethylated sites simultaneously in a single tube, enabling the detection of DNA methylation or the simultaneous detection of DNA and DNA methylation, improving the accuracy and efficiency of genomic methylation site detection.
[0013] Therefore, in a first aspect of the present invention, the present invention provides a multiplex PCR method. According to an embodiment of the present invention, the method includes: a first round of amplification reaction 1, wherein the system of the first round of amplification reaction 1 includes: transforming DNA and one or more transforming DNA primer pairs, wherein each transforming DNA primer pair includes a forward primer and a reverse primer, and the 5' end of the forward primer or the reverse primer in each transforming DNA primer pair has a universal sequence 1; a second round of amplification reaction 1, wherein the system of the second round of amplification reaction 1 includes: the product of the first round of amplification reaction 1 and one or more primer sets, wherein each primer set includes: 1) a semi-nested primer 1 having a 3' end that binds to one or more target regions of the product of the first round of amplification reaction 1 and a 5' end having a universal sequence 2, wherein the semi-nested primer 1 is arranged near the target region of the forward primer or reverse primer that does not have the universal sequence 1 in the system of the first round of amplification reaction 1, and 2) a universal primer 1 having a 3' end identical to the universal sequence 1 and / or a universal primer 2 having a 3' end identical to the universal sequence 2. According to the method of an embodiment of the present invention, during the amplification reaction, since the 3' ends of the forward and reverse primers are rich in ATG and ATC and easily form dimers, the inventors reduced the proportion of dimers by introducing a round of semi-nested amplification. During this round of semi-nested PCR, one semi-nested specific primer and one or two universal primers are included. After the introduction of the semi-nested amplification reaction, 1) since all semi-nested specific PCR primers are rich in ATG bases or rich in ATC bases, all specific ATG-ATG or ATC-ATC are difficult to form dimers with each other, and 2) the semi-nested specific primers (ATG or ATC) and the universal primer (ATCG) are also difficult to form dimers. Therefore, after two rounds of amplification, the proportion of dimers in the amplification can be effectively reduced.
[0014] According to an embodiment of the present invention, the above method further includes at least one of the following additional technical features:
[0015] According to an embodiment of the present invention, the converted DNA is DNA that has been subjected to cytosine methylation conversion treatment. The method according to a specific embodiment of the present invention can effectively detect methylation sites in a target region of a genome.
[0016] According to an embodiment of the present invention, the methylation conversion treated DNA is obtained by subjecting the DNA to a bisulfite or enzyme-assisted treatment.
[0017] According to an embodiment of the present invention, the enzyme includes at least one of the following: TET methylcytosine dioxygenase 2 (TET2).
[0018] According to an embodiment of the present invention, the universal sequence 1 and the universal sequence 2 are the same or different.
[0019] According to an embodiment of the present invention, the T base content in the conversion DNA primer pair is 10%-70%.
[0020] According to an embodiment of the present invention, at least one of the universal sequence 1, the universal sequence 2, the universal primer 1 and the universal primer 2 includes a sequencing adapter sequence, a sample tag sequence or a molecular tag sequence.
[0021] Preferably, when designing the conversion DNA primer pair, CG sites and SNP sites should be avoided as much as possible, and continuous polyT structures should be avoided. The primer length is 15-50 bp, and the TM value is 50-65.
[0022] Those skilled in the art will appreciate that in the system of the first round amplification reaction 1, the molar ratio of the primer pairs of the converted DNA can be adjusted according to the target fragment to be detected and the primer requirements.
[0023] In addition, those skilled in the art can adjust the conditions of the first round PCR amplification reaction 1 and the second round PCR amplification reaction 1 according to different transformed DNAs to be tested and corresponding primers used.
[0024] According to some specific embodiments of the present invention, the conditions of the first round of amplification reaction 1 are: 90°C-97°C, 0.5-5 min, 1 cycle; 90°C-97°C, 25-35 s, 55-65°C, 1.5-2.5 min, 65°C-78°C, 25-35 s, 10-30 cycles; 65°C-78°C, 4 min-6 min, 1 cycle.
[0025] According to some specific embodiments of the present invention, the conditions of the second round of amplification reaction 1 are 90°C-97°C, 0.5-5 min, 1 cycle; 90°C-97°C, 25-35 s, 55-65°C, 1.5-2.5 min, 65°C-78°C, 25-35 s, 10-30 cycles; 65°C-78°C, 4 min-6 min, 1 cycle.
[0026] In a second aspect, the present invention provides a multiplex PCR method. According to an embodiment of the present invention, the method comprises the following steps: a first-round amplification reaction 2, wherein the system of the first-round amplification reaction 2 comprises: original DNA, converted DNA, one or more original DNA primer pairs, and one or more converted DNA primer pairs, wherein each of the original DNA primer pairs and the converted DNA primer pairs comprises a forward primer and a reverse primer, and the 5' end of the forward primer or the reverse primer in each of the original DNA primer pairs and the converted DNA primer pairs comprises a universal sequence 3;
[0027] A second round of amplification reaction 2, wherein the system of the second round of amplification reaction 2 includes: the product of the first round of amplification reaction 2 and a second round of amplification primer set, wherein the second round of amplification primer set includes: i) a semi-nested primer 2 having a 3' end that binds to one or more target regions in the product of the first round of amplification reaction 2 and a 5' end having a universal sequence 4, wherein the semi-nested primer 2 is arranged downstream of a forward primer or a reverse primer that does not have a universal sequence 3 in the first round of amplification system 2, and ii) a universal primer 3 having a 3' end that is identical to the universal sequence 3 and / or a universal primer 4 having a 3' end that is identical to the universal sequence 4. According to the multiplex PCR method of an embodiment of the present invention, multiple target methylation sites and unmethylated sites can be effectively captured simultaneously in a single tube, thereby achieving simultaneous detection of untreated original DNA and methylated converted DNA, thereby improving the accuracy and efficiency of genomic methylation site detection.
[0028] According to an embodiment of the present invention, the original DNA is untreated DNA.
[0029] According to an embodiment of the present invention, the conversion DNA is DNA subjected to cytosine methylation conversion treatment.
[0030] According to an embodiment of the present invention, the methylation conversion treated DNA is obtained by subjecting the DNA to bisulfite or enzyme treatment.
[0031] According to an embodiment of the present invention, the methylase comprises at least one of the following: TET methylcytosine dioxygenase 2 (TET2).
[0032] According to an embodiment of the present invention, the universal sequence 3 and the universal sequence 4 are the same or different.
[0033] According to an embodiment of the present invention, the T base content of the conversion DNA primer pair is 10%-70%.
[0034] According to an embodiment of the present invention, at least one of the universal sequence 3, the universal sequence 4, the universal primer 3 and the universal primer 4 includes a sequencing adapter sequence, a sample tag sequence or a molecular tag sequence.
[0035] Preferably, when designing the conversion DNA primer pair and / or the original DNA primer pair, CG sites and SNP sites should be avoided as much as possible, continuous polyT structures should be avoided, and the TM value should be 50-65.
[0036] According to an embodiment of the present invention, those skilled in the art can adjust the molar ratio of the original DNA, the converted DNA, one or more original DNA primer pairs and one or more converted DNA primer pairs included in the system of the first round of amplification reaction 2 as needed. Similarly, the molar ratio of the first round of amplification reaction 2 product and the second round of amplification primer group included in the system of the second round of amplification reaction 2 can also be adjusted.
[0037] In addition, those skilled in the art can adjust the conditions of the first round PCR amplification reaction 2 and the second round PCR amplification reaction 2 according to the different original DNA and converted DNA to be tested and the corresponding primers used.
[0038] According to some specific embodiments of the present invention, the conditions of the first round of PCR amplification reaction 2 are 90°C-97°C, 0.5-5 min, 1 cycle; 90°C-97°C, 25-35 s, 55-65°C, 1.5-2.5 min, 65°C-78°C, 25-35 s, 12-18 cycles; 65°C-78°C, 4 min-6 min, 1 cycle.
[0039] According to some specific embodiments of the present invention, the conditions of the second round of PCR amplification reaction 2 are: 90°C-97°C, 0.5-5 min, 1 cycle; 90°C-97°C, 25-35 s, 55-65°C, 1.5-2.5 min, 65°C-78°C, 25-35 s, 18-22 cycles; 65°C-78°C, 4 min-6 min, 1 cycle.
[0040] In a third aspect, the present invention provides a method for preparing a sequencing library. According to an embodiment of the present invention, the method includes the step of constructing a sequencing library using the method described in the first aspect or the second aspect.
[0041] According to an embodiment of the present invention, the above method further includes at least one of the following additional technical features:
[0042] According to an embodiment of the present invention, the method further includes purifying the product of the second-round PCR amplification system 1 or 2 in the aforementioned multiplex PCR method.
[0043] According to an embodiment of the present invention, the purification process is a magnetic bead purification process, an ethanol precipitation process or a tubular kit purification process.
[0044] In a fourth aspect, the present invention provides a kit. According to an embodiment of the present invention, the kit includes at least one of the following: one or more first-round conversion DNA primer pairs, the first-round conversion DNA primer pairs comprising a forward primer and a reverse primer, wherein the 5' end of the forward primer or the reverse primer comprises universal sequence 1;
[0045] One or more second-round transforming DNA primer sets, the second-round transforming DNA primer sets comprising: 1) a semi-nested primer 1 having a 3' end that binds to a transforming DNA target region and a 5' end having a universal sequence 2, and 2) a universal primer 1 having a 3' end identical to the universal sequence 1 and / or a universal primer 2 having a 3' end identical to the universal sequence 2.
[0046] According to an embodiment of the present invention, the kit further comprises one or more first-round original DNA primer pairs, wherein the first-round original DNA primer pair comprises a forward primer and a reverse primer, wherein the 5' end of the forward primer or the reverse primer comprises a universal sequence 3; and
[0047] One or more second-round original DNA primer sets, the second-round original DNA primer sets comprising: 3) a semi-nested primer 2 having a 3' end that binds to the original DNA target region and a 5' end having a universal sequence 4, and 4) a universal primer 3 having a 3' end identical to the universal sequence 3 and / or a universal primer 4 having a 3' end identical to the universal sequence 4.
[0048] According to an embodiment of the present invention, the kit includes a set of upstream and downstream specific primers with 3'-end specific sequences designed for multiple target segment DNA and / or methylated DNA sequences and different universal sequences added to their 5' ends, and a set of upstream and downstream universal primers with 3' ends complementary to the universal sequences and 5' ends being sequencing adapter sequences. The kit can amplify thousands of target methylation sites in one tube. At the same time, during the detection process, it can also be compatible with the simultaneous capture of DNA and methylated DNA in one tube, realizing the synchronous amplification of DNA and DNA methylation. The amplified library can be used for the simultaneous detection of DNA and DNA methylation sites.
[0049] According to an embodiment of the present invention, the sequence length of the forward primer and the reverse primer in the first round conversion DNA primer pair is 15-50 bases. The first round conversion DNA primer pair is a primer pair designed for the converted DNA, and the primer design principle follows the basic design principle of primers.
[0050] According to an embodiment of the present invention, the sequence length of the universal sequence 1 and the universal sequence 2 is 10-100 bases. The universal sequence 1 and the universal sequence 2 are not particularly limited and can be any fixed sequence or functional sequence, including but not limited to a sequencing adapter sequence, a sample tag sequence, a molecular tag sequence, etc.
[0051] According to an embodiment of the present invention, the sequence length of the semi-nested primer 1 and the semi-nested primer 2 is 15-50 bases. The semi-nested primer 1 and the semi-nested primer 2 are designed for the transformed DNA, and the primer design principle follows the basic design principle of the primer.
[0052] According to an embodiment of the present invention, the sequences of the universal primer 1 and the universal primer 2 may be the same or different.
[0053] According to an embodiment of the present invention, the sequence length of the universal primer 1 and the universal primer 2 is 10-100 bases. Those skilled in the art will understand that the universal primer 1 and the universal primer 2 can be any fixed sequence or functional sequence, including but not limited to a sequencing adapter sequence, a sample tag sequence, a molecular tag sequence, etc.
[0054] According to an embodiment of the present invention, the kit may further include one or more of a DNA sample extraction reagent, a DNA methylation conversion reagent, a Taq enzyme, dNTPs, divalent magnesium ions, and a PCR system buffer.
[0055] In a fifth aspect, the present invention provides the use of the aforementioned kit for preparing a sequencing library. As previously described, the kit is capable of amplifying methylated DNA, or a mixture of methylated and unmethylated DNA, and the resulting library meets sequencing requirements.
[0056] In a sixth aspect of the present invention, a sequencing library is provided. According to an embodiment of the present invention, the library is obtained using the method described in the third aspect.
[0057] In a seventh aspect of the present invention, the present invention provides a method for sequencing a target nucleic acid molecule and / or detecting methylation sites. According to an embodiment of the present invention, the method comprises: 1) constructing a sequencing library for the target nucleic acid molecule according to the method described in the third aspect; 2) sequencing the sequencing library to obtain sequencing results; and 3) determining the nucleic acid sequence of the target nucleic acid molecule and / or the methylation sites of the nucleic acid molecule based on the sequencing results. The method according to an embodiment of the present invention can effectively sequence the original DNA and / or detect the methylation sites of the methylated modified DNA.
[0058] In its eighth aspect, the present invention provides a method for detecting methylation-related diseases. According to an embodiment of the present invention, the method comprises the following steps: i) constructing a subject sequencing library using the method described in the third aspect for nucleic acid molecules derived from a subject; ii) sequencing the subject sequencing library to obtain sequencing results; iii) determining methylation sites on the nucleic acid molecules derived from the subject based on the sequencing results; and iv) determining whether the subject suffers from a methylation-related disease based on the methylation sites.
[0059] According to an embodiment of the present invention, the above detection method may further include at least one of the following additional technical features:
[0060] According to an embodiment of the present invention, the methylation-related disease includes at least one selected from the group consisting of: cardiovascular disease, cerebrovascular disease, autoimmune disease, metabolic disease and cancer.
[0061] According to an embodiment of the present invention, the cardiovascular disease is ischemic cardiomyopathy, atherosclerosis, hypertension or heart failure.
[0062] According to an embodiment of the present invention, the cerebrovascular disease is cerebral hemorrhage or cerebral stroke.
[0063] According to an embodiment of the present invention, the autoimmune disease is psoriasis, lupus erythematosus or psoriasis.
[0064] According to an embodiment of the present invention, the metabolic disease is obesity, type 2 diabetes, non-alcoholic fatty liver disease or osteoporosis.
[0065] According to an embodiment of the present invention, the cancer is rectal cancer, lung cancer, liver cancer, gastric cancer, pancreatic cancer or brain glioma.
[0066] It can be seen from the above technical solutions that the multiplex PCR detection method provided by the present invention has at least the following advantages:
[0067] 1. Reduction of primer dimers by semi-nested PCR amplification using universal primers
[0068] During the first round of PCR amplification, the methylation-specific primer pair F / R, rich in ATG and ATC, easily dimerizes. Therefore, the inventors introduced a round of semi-nested amplification to reduce the dimer ratio. During this semi-nested PCR, 1) all semi-nested specific PCR primers are rich in ATG or ATC bases, making it difficult for all specific ATG-ATG or ATC-ATC primers to dimerize with each other. 2) During the second round of amplification, the semi-nested specific primers (ATG or ATC) and the universal primer (ATCG) also rarely dimerize, effectively reducing the dimer ratio in the second round of amplification.
[0069] 2. Improved specificity through semi-nested PCR amplification using universal primers
[0070] In the present invention, two rounds of PCR are performed to improve the specificity of targeted amplification, and a further round of semi-nested amplification is performed on the basis of the first round of PCR amplification to improve the specificity of target amplification.
[0071] 3. The sequencing library prepared using the multiplex PCR method described in this application is compatible with the simultaneous capture of DNA and DNA methylation, and can achieve simultaneous detection of DNA and DNA methylation. BRIEF DESCRIPTION OF THE DRAWINGS
[0072] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0073] Figure 1 is a schematic diagram of the design of semi-nested PCR amplification primers for the introduction of the universal sequence (fixed tag) T1 or T2 provided in an embodiment of the present invention, wherein three primers are designed for each target region, namely, the outer specific primer pair F and R, and the semi-nested primer F1 or R1, the 5' end of one of the primers F or R in the outer specific primer pair is connected to the universal sequence T1, the 5' end of the semi-nested primer is connected to the universal sequence T2, and the semi-nested primer is arranged downstream of the F or R primer whose 5' end is not connected to the universal sequence T1;
[0074] FIG2 is a schematic diagram of nested PCR amplification according to an embodiment of the present invention;
[0075] FIG3 is a schematic diagram of library preparation based on fixed tag introduction according to an embodiment of the present invention;
[0076] FIG4 is a fragment distribution diagram of a methylation library based on fixed tag introduction according to an embodiment of the present invention, with a fragment size of 150-180 bp;
[0077] FIG5 is a graph showing the stability (Pearson coefficient) of methylated DNA detection with different initial input amounts according to an embodiment of the present invention;
[0078] FIG6 is a schematic diagram of preparing a mixed library of DNA and methylated DNA based on fixed tag introduction according to an embodiment of the present invention;
[0079] FIG7 is a fragment distribution diagram of a mixed library of DNA and methylated DNA based on fixed tag introduction according to an embodiment of the present invention. The fragment size of the methylated library is 150-180 bp, and the fragment size of the DNA library is 340-390 bp. DETAILED DESCRIPTION
[0080] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0081] This application proposes a method for preparing a targeted methylation sequencing library based on multiplex PCR, in which a semi-nested multiplex amplification method with universal sequence introduction is invented. By introducing universal primers, the enrichment of target methylation regions is integrated into the two-step semi-nested PCR, reducing primer dimers and improving primer amplification specificity, thereby achieving amplification of tens of thousands of target methylation sites in one tube. At the same time, this method is compatible with two schemes, namely, capturing methylated DNA in one tube, or capturing unmethylated DNA and methylated DNA simultaneously in one tube, the latter of which can achieve simultaneous detection of DNA and DNA methylation. The specific technical solutions are as follows:
[0082] Example 1 Methylation Multiplex PCR Library Construction and Sequencing
[0083] This example mainly includes the following experimental contents: gDNA undergoes chemical conversion (bisulfite) or enzymatic conversion (TET enzyme-assisted conversion) to convert unmethylated cytosine to uracil. In this example, sample NA12878 gDNA is treated with bisulfite, and detection primers are designed. Then, the DNA and primers are used to prepare a DNA targeted methylation library. The obtained library is placed on the MGISEQ-2000 sequencer for on-machine sequencing, sequencing type PE100, and then data analysis is performed, including data utilization, alignment rate, amplicon specificity, uniformity, and other performance. The specific experimental procedures are as follows:
[0084] 1.1 Bisulfite treatment to obtain methylated target DNA
[0085] Using EZ DNA Methylation-Gold Kit TM (ZYMO) performed an experiment in which sample NA12878 gDNA was set to four mass gradients of 0.5, 1, 5, and 10 ng, with three replicates for each gradient. The gDNA was then co-treated with bisulfite. The specific steps were as follows:
[0086] 1) Preparation of CT Conversion Reagent Solution: Remove the CT Conversion Reagent (solid mixture) from the above-mentioned kit, add 900 μL of water, 50 μL of M-Dissolving Buffer, and 300 μL of M-Dilution Buffer to the CT Conversion Reagent, respectively, and dissolve with shaking at room temperature for 10 minutes or on a shaker for 10 minutes.
[0087] 2) Preparation of M-wash buffer: Add 24 mL of 100% ethanol to the M-wash buffer and set aside.
[0088] 3) Add 130 μL of CT conversion reagent solution and the above DNA to the PCR tube and gently flick or pipette to suspend and mix the sample.
[0089] 4) Place the treated PCR tube on a PCR instrument and operate according to the following steps: 98°C for 5 minutes and 64°C for 2.5 hours.
[0090] 5) After completing the above steps, the PCR product can be immediately processed for the next step or stored at 4°C (up to 20 hours) for future use.
[0091] 6) Insert the Zymo-Spin IC TM Place the centrifugal column in a collection tube and add 600 μL of M-Binding Buffer.
[0092] 7) Add the bisulfite-treated sample to the Zymo-Spin IC containing M-binding buffer. TM In the column, cover and mix by inversion.
[0093] 8) Centrifuge the sample obtained in step 7) at full speed (>10,000 x g) for 30 seconds and discard the liquid in the collection tube. Add 100 μL of M-wash buffer to the spin column and centrifuge at full speed (>10,000 x g) for 30 seconds and discard the liquid in the collection tube.
[0094] 9) Add 200 μL of M-Desulphonation Buffer to the spin column obtained in step 8), incubate at room temperature for 15 min, centrifuge at full speed (>10,000 x g) for 30 s, and discard the liquid in the collection tube.
[0095] 10) Add 200 μL of M-wash buffer to the spin column, centrifuge at full speed (>10,000 x g) for 30 seconds, discard the liquid in the collection tube, and repeat this step once more.
[0096] 11) Zymo-Spin IC obtained in step 10) TM Place the column in a new 1.5 mL EP tube, add 40 μL of M-elution buffer r to the column matrix, place at room temperature for 2 minutes, and centrifuge at full speed (>10,000xg) to elute the target DNA.
[0097] 1.2 Design of DNA methylation detection primers
[0098] Primers were designed based on the methylated DNA obtained in Experiment 1.1. The design method is shown in Figure 1-3. The specific experimental steps are as follows:
[0099] i) Design one or more specific primer pairs (F / R) for the methylated genomic sequence, each pair of primers responsible for amplifying a target region, and a fixed universal sequence T1 is added to the 5' end of one primer in each pair (forward primer F or reverse primer R) (as shown in Figure 1);
[0100] ii) designing a semi-nested specific primer F1 or R1 based on the first-round specific primer, wherein the binding position of the primer is set inside the first-round specific amplification primer described in step i) (as shown in FIG1 ), wherein another universal sequence (T2, which can be the same as or different from T1) is introduced at the 5′ end of the semi-nested specific primer;
[0101] iii) Design a universal primer U1, whose 3' end sequence contains all the sequences of T1 (U1 ≥ T1). Perform a second round of multiplex amplification on the first round PCR products using all specific primers with T2 sequences and a universal primer (U1) to obtain the target fragment with T2 sequences and U1 universal primer sequence (as shown in Figure 2); or
[0102] iv) Design a universal primer U1, the 3' end sequence of U1 contains all the sequences of T1 above (U1 ≥ T1). Design a universal primer U2, the 3' end sequence of U2 contains all the sequences of T2 above (U2 ≥ T2). All specific primers with T2 sequences at the 5' end, universal primer U1 and universal primer U2 perform a second round of multiple amplification on the PCR products of the first round to obtain a target fragment with U2 sequence and U1 universal primer sequence (as shown in Figure 3); wherein, sample tag sequences, molecular tag sequences, chemical modifications (phosphorylation, amination, etc.), enzyme cutting sites (USER enzyme, restriction endonuclease), etc. can be introduced into the T1, T2, U1 and U2 primer sequences for subsequent different experimental processes. The primer sequences finally obtained in this embodiment are shown in Tables 1 and 2.
[0103] Table 1: Methylation-specific primers
[0104]
[0105]
[0106]
[0107] Note: All primers were mixed at an initial concentration of 10 uM to obtain a methylation-specific primer pool.
[0108] Table 2: Methylation-specific semi-nested primers
[0109]
[0110]
[0111] Note: All primers were mixed at an initial concentration of 10 μM to obtain a semi-nested methylation-specific primer pool.
[0112] 1.3 First round of PCR
[0113] 1) Prepare the reaction system in a PCR tube according to Table 3.
[0114] Table 3:
[0115] Component volume (μL) 1.1 Partially obtained methylated DNA 20 2×KAPA2G Fast ReadyMix 25 DNA methylation specific primer pool (10 μM) 5.0 Total volume 50
[0116] 2) The first round of PCR reaction conditions are as follows:
[0117]
[0118] 3) The reaction product was purified using 1.5X AMPure magnetic beads and finally dissolved in 22 μL elution buffer.
[0119] 1.4 Second round of PCR
[0120] 1) Prepare the reaction system in a PCR tube according to Table 4, wherein the specific sequences of the universal primers are shown in Table 5.
[0121] Table 4:
[0122] Component volume (μL) 1.3 Purified DNA obtained from the part 17.5 2×KAPA2G Fast ReadyMix 25 DNA methylation semi-nested primer pool (10 μM) 2.5 First universal primer U1 (10 μM) 2.5 Second universal primer U2 (10 μM) 2.5 Total volume 50
[0123] Table 5: Universal primers and index primers
[0124] ID number SEQ(5'-3')U1TGTGAGCCAAGGAGTTGBBBBBBBBB*TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT
[0125] (SEQ ID NO:136)U2PHOS#GAACGACATGGCTACGATCCGACTT(SEQ ID NO:137)
[0126] 2) The second round of PCR reaction conditions are as follows:
[0127]
[0128] 3) After the second round of PCR reaction, the product obtained was purified using 1.0X AMPure magnetic beads and finally dissolved in 22 μL elution buffer.
[0129] 1.5 Library detection:
[0130] The products obtained after the PCR amplification reactions in Experiments 1.3 and 1.4 were analyzed using a Bioanalyzer system (Agilent, Santa Clara, USA) to determine the size and content of the library inserts. The detection method was conventional in the art, and the specific results are shown in Figure 4. The obtained library met the requirements for the instrument.
[0131] 1.6 Sequencing
[0132] The obtained library was subjected to high-throughput sequencing using the MGISEQ-2000 sequencing platform and PE100 sequencing type. The sequencing data were aligned and various basic parameters were calculated, including offline data, available data, alignment rate, specificity, and uniformity.
[0133] 1.6.1 Result Analysis:
[0134] 1) The basic performance parameters obtained by the amplification method are shown in Table 6, among which the data utilization rate is 0.97-0.99, the unique alignment rate is 0.91-0.93, the target area ratio is 0.95-0.97, and the 0.1X average depth uniformity is 0.92-0.96;
[0135] 2) According to the results shown in Figure 5, the accuracy of methylation detection is very consistent under different input amounts (Pearson coefficient > 0.87). Under certain conditions, the higher the input amount, the better the stability.
[0136] Table 6: Methylation multiplex PCR sequencing data statistics
[0137]
[0138] Note: @ The statistical method is Mean±SD.
[0139] Example 2 DNA and methylated DNA multiplex PCR mixed library construction and sequencing
[0140] This example mainly includes the following experimental contents: NA12878 gDNA was used for the experiment. The gDNA was converted into uracil by chemical conversion (bisulfite) or enzymatic conversion (TET enzyme-assisted conversion) to convert unmethylated cytosine. A methylation capture panel containing 24 methylation sites was designed. At the same time, a DNA capture panel without methylation was designed, containing 20 DNA capture areas. The gDNA of the NA12878 standard was treated with bisulfite and then mixed with genomic DNA. The mixed DNA was prepared into a DNA and DNA methylation mixed library according to the steps of the invention. The sample was repeated 3 times. The obtained library was placed on the MGISEQ-2000 sequencer for on-machine sequencing. The sequencing type was PE100. The data was then analyzed, including data utilization, alignment rate, amplicon specificity, uniformity and other performance. The specific experimental procedures are as follows:
[0141] 2.1 Bisulfite treatment to obtain methylated target DNA
[0142] Using EZ DNA Methylation-Gold Kit TM(ZYMO) performed an experiment in which NA12878 gDNA was co-treated with bisulfite in triplicate. The specific steps were as follows:
[0143] 1) Preparation of CT Conversion Reagent Solution: Remove the CT Conversion Reagent (solid mixture) from the above-mentioned kit, add 900 μL of water, 50 μL of M-Dissolving Buffer, and 300 μL of M-Dilution Buffer to the CT Conversion Reagent, respectively, and dissolve with shaking at room temperature for 10 minutes or on a shaker for 10 minutes.
[0144] 2) Preparation of M-wash buffer: Add 24 mL of 100% ethanol to the M-wash buffer and set aside.
[0145] 3) Add 130 μL of CT conversion reagent solution and 10 ng of the above DNA to a PCR tube and gently flick or pipette to resuspend the sample.
[0146] 4) Place the treated PCR tube on a PCR instrument and operate according to the following steps: 98°C for 5 minutes and 64°C for 2.5 hours.
[0147] 5) After completing the above steps, the PCR product can be immediately processed for the next step or stored at 4°C (up to 20 hours) for future use.
[0148] 6) Insert the Zymo-Spin IC TM Place the centrifugal column in a collection tube and add 600 μL of M-Binding Buffer.
[0149] 7) Add the bisulfite-treated sample to the Zymo-Spin IC containing M-binding buffer. TM In the column, cover and mix by inversion.
[0150] 8) Centrifuge the sample obtained in step 7) at full speed (>10,000 x g) for 30 seconds and discard the liquid in the collection tube. Add 100 μL of M-wash buffer to the spin column and centrifuge at full speed (>10,000 x g) for 30 seconds and discard the liquid in the collection tube.
[0151] 9) Add 200 μL of M-Desulphonation Buffer to the spin column obtained in step 8), incubate at room temperature for 15 min, centrifuge at full speed (>10,000 x g) for 30 s, and discard the liquid in the collection tube.
[0152] 10) Add 200 μL of M-wash buffer to the spin column, centrifuge at full speed (>10,000 x g) for 30 seconds, discard the liquid in the collection tube, and repeat this step once more.
[0153] 11) Zymo-Spin IC obtained in step 10) TM The column was placed in a new 1.5 mL EP tube, 40 μL of M-elution buffer was added to the column matrix, and the column was placed at room temperature for 2 min. The methylated target DNA was eluted by centrifugation at full speed (>10,000 x g).
[0154] 12) The methylated DNA obtained in step 11) was mixed with 5 ng of genomic DNA, and the mixed DNA was used as a template for subsequent library preparation.
[0155] 2.2 Design of DNA and methylated DNA detection primers
[0156] Primers were designed based on the unmethylated DNA and methylated DNA obtained in Experiment 2.1. The specific experimental steps are as follows:
[0157] i) First-round specific primer design: One or more pairs of primers (F / R) are designed for the original genomic DNA sequence or the methylated genomic DNA sequence. Each primer pair is responsible for amplifying a specific genomic target region of the original DNA or methylated DNA. A fixed universal sequence T1 is added to the 5' end of one primer (F or R) in each primer pair. All primers with the T1 sequence and all primers without the T1 sequence are amplified in a single tube for singleplex or multiplex PCR to obtain the target product with a T1 adapter.
[0158] ii) designing a semi-nested specific primer F1 or R1 based on the first-round specific primers. The primer is positioned inside the first-round specific amplification primers, and another universal sequence T2 is introduced at the 5' end of the semi-nested specific primer (the sequences of T2 and T1 may be the same or different);
[0159] iii) Design a universal primer, U1, whose 3' end sequence contains all the sequences of T1 (U1 ≥ T1). Multiplex amplification of the first-round PCR products is performed using all specific primers with T2 sequences and a universal primer (U1) to obtain the target fragment with T2 sequences and the U1 universal primer. Sequencing adapter sequences, sample tag sequences, molecular tag sequences, chemical modifications (phosphorylation, amination, etc.), and enzyme cleavage sites (USER enzymes, restriction endonucleases) can be introduced into the T1, T2, and U1 primer sequences for subsequent molecular experiments.
[0160] iv) Design another universal primer U2, the 3' end sequence of U2 contains all the sequences of T2 (U2 ≥ T2). All specific primers with T2 sequences at the 5' end, universal primer U1 and universal primer U2 are used to perform multiple amplification on the products of the first round of PCR amplification reaction in this embodiment to obtain target fragments with U2 sequences and U1 universal primer sequences. The specific primer design and usage process are shown in Table 7; sequencing adapter sequences, sample tag sequences, molecular tag sequences, chemical modifications (phosphorylation, amination, etc.), enzyme cutting sites (USER enzymes, restriction endonucleases), etc. can be introduced into the T1, T2, U1 and U2 primer sequences for subsequent different molecular experiments. The methylated DNA specific primer sequences F / R and methylated DNA semi-nested primer R1 finally obtained are shown in Tables 1 and 2, and the obtained DNA specific primer sequences F / R and DNA semi-nested primer R1 are shown in Tables 7 and 8, respectively.
[0161] Table 7: DNA specific primers
[0162]
[0163]
[0164]
[0165] Note: All primers were mixed at an initial concentration of 10 μM to obtain a specific primer pool.
[0166] Table 8: DNA semi-nested specific primers
[0167]
[0168]
[0169] Note: All primers were mixed at 10 μM to obtain a semi-nested specific primer pool.
[0170] 2.3 First round of PCR
[0171] 1) Prepare the reaction system shown in Table 7 in a PCR tube.
[0172] Table 9:
[0173] Component volume (μL) DNA treated in the previous step + untreated genomic DNA 20 2 X KAPA2G Fast ReadyMix 25 DNA methylation-specific primer pool (10 μM) 2.5 DNA-specific primer pool (10 μM) 2.5 Total volume 50
[0174] 2) The first round of PCR reaction conditions are as follows:
[0175]
[0176] 3) After the first round of PCR reaction, the product obtained was purified using 1.5X AMPure magnetic beads and finally dissolved in 22 μL elution buffer.
[0177] 2.4 Second round of PCR
[0178] 1) Prepare the reaction system in the PCR tube according to Table 10
[0179] Table 10:
[0180] Component volume (μL) 2.2 Purified DNA obtained in part 17.5 2 X KAPA2G Fast ReadyMix 25 DNA methylation semi-nested primer pool (10 μM) 1.25 DNA semi-nested primer pool (10 μM) 1.25 First universal primer U1 (10 μM) 2.5 Second universal primer U2 (10 μM) 2.5 Total volume 50
[0181] 2) PCR reaction conditions
[0182]
[0183] 3) After the reaction, the product was purified using 1.0X AMPure magnetic beads and dissolved in 22 μl elution buffer.
[0184] 2.5 Library detection:
[0185] The products obtained after PCR in Experiments 2.3 and 2.4 were analyzed using a Bioanalyzer system (Agilent, Santa Clara, USA) to determine the size and content of the insert fragments. The detection method was conventional in the art, and the specific results are shown in Figure 7. The obtained library met the requirements for the instrument.
[0186] 2.6 Sequencing
[0187] The obtained library was subjected to high-throughput sequencing using the MGISEQ-2000 sequencing platform and PE100 sequencing type. The sequencing data were aligned and statistically analyzed for various basic parameters, including offline data, available data, alignment rate, GC content, etc.
[0188] 2.6.1 Results:
[0189] 1) The basic performance parameters of methylation sequencing obtained by the hybrid sequencing protocol are shown in Table 11: data utilization rate was 0.99±0.00, overall alignment rate was 0.98±0.02, specificity was 0.96±0.00, and uniformity was 0.96±0.00. These parameters were not different from those obtained by DNA methylation, and DNA amplification did not affect DNA methylation amplification.
[0190] 2) The basic performance parameters of DNA sequencing obtained by the hybrid sequencing scheme are shown in Table 12: the data utilization rate is 0.99±0.00, the overall alignment rate is 0.98±0.02, the specificity is 0.98±0.00, and the uniformity is 1.00±0.00, which can achieve effective detection of DNA targets.
[0191] Table 11: DNA methylation data statistics
[0192]
[0193] Table 12: DNA data statistics
[0194]
[0195] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of the technical features being referred to. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. In the description of the present invention, "plurality" means at least two, such as two, three, etc., unless otherwise specifically defined.
[0196] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.
[0197] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.
Claims
1. A multiplex PCR method, characterized in that: include: A first round amplification reaction 1, wherein the system of the first round amplification reaction 1 includes: transforming DNA and one or more transforming DNA primer pairs, wherein each transforming DNA primer pair includes a forward primer and a reverse primer, and the 5' end of the forward primer or the reverse primer in each transforming DNA primer pair has a universal sequence 1; A second-round amplification reaction 1, wherein the system of the second-round amplification reaction 1 includes: the product of the first-round amplification reaction 1 and one or more primer sets, wherein each primer set includes: 1) a semi-nested primer 1 having a 3' end that binds to one or more target regions of the product of the first-round amplification reaction 1 and a 5' end that has a universal sequence 2, wherein the semi-nested primer 1 is arranged at a position close to the target region of the forward primer or reverse primer that does not have the universal sequence 1 in the system of the first-round amplification reaction 1, and 2) a universal primer 1 having a 3' end identical to the universal sequence 1 and / or a universal primer 2 having a 3' end identical to the universal sequence 2.
2. The method according to claim 1, characterized in that The conversion DNA is DNA that has been subjected to cytosine methylation conversion treatment; Optionally, the methylase comprises at least one of the following: TET methylcytosine dioxygenase 2.
3. The method according to claim 1 or 2, characterized in that The universal sequence 1 and universal sequence 2 are the same or different. Optionally, the T base content in the conversion DNA primer pair is 10-70%; Optionally, at least one of the universal sequence 1, universal sequence 2, universal primer 1 and universal primer 2 includes a sequencing adapter sequence, a sample tag sequence or a molecular tag sequence. Optionally, the methylation conversion treated DNA is obtained by subjecting the DNA to bisulfite or enzyme-assisted treatment; 4. A multiplex PCR method, characterized in that: The following steps are involved: A first-round amplification reaction 2, wherein the system of the first-round amplification reaction 2 includes: original DNA, converted DNA, one or more original DNA primer pairs, and one or more converted DNA primer pairs, wherein each of the original DNA primer pairs and the converted DNA primer pairs includes a forward primer and a reverse primer, and the 5' end of the forward primer or the reverse primer in each of the original DNA primer pairs and the converted DNA primer pairs has a universal sequence 3; A second round of amplification reaction 2, wherein the system of the second round of amplification reaction 2 includes: the product of the first round of amplification reaction 2 and a second round of amplification primer set, wherein the second round of amplification primer set includes: i) a semi-nested primer 2 having a 3' end that binds to one or more target regions in the product of the first round of amplification reaction 2 and a 5' end that has a universal sequence 4, wherein the semi-nested primer 2 is arranged at a position close to the target region of the forward primer or reverse primer that does not have the universal sequence 3 in the first round of amplification system 2, and ii) a universal primer 3 having a 3' end that is identical to the universal sequence 3 and / or a universal primer 4 having a 3' end that is identical to the universal sequence 4.
5. The method according to claim 4, characterized in that The conversion DNA is DNA that has been subjected to cytosine methylation conversion treatment; Optionally, the methylation conversion treated DNA is obtained by subjecting the DNA to bisulfite or enzyme-assisted treatment; Optionally, the methylase comprises at least one of the following: TET methylcytosine dioxygenase 2 (TET2).
6. The method according to claim 4 or 5, characterized in that The universal sequence 3 and the universal sequence 4 are the same or different; Optionally, the T base content of the conversion DNA primer pair is 10-70%; Optionally, at least one of the universal sequence 3, universal sequence 4, universal primer 3 and universal primer 4 includes a sequencing adapter sequence, a sample tag sequence or a molecular tag sequence.
7. A method for constructing a sequencing library, characterized in that: The method comprises the step of constructing a sequencing library using the multiplex PCR method according to any one of claims 1 to 6.
8. The method according to claim 7, characterized in that The method further includes purifying the product of the first round amplification reaction 1 or 2 in the multiplex PCR method; Optionally, the purification treatment is magnetic bead purification treatment, ethanol precipitation purification or tubular kit purification.
9. A kit, characterized in that Include at least one of the following: One or more first-round transforming DNA primer pairs, wherein the first-round transforming DNA primer pairs have a forward primer and a reverse primer, wherein the 5' end of the forward primer or the reverse primer has universal sequence 1; One or more second-round transforming DNA primer sets, the second-round transforming DNA primer sets comprising: 1) a semi-nested primer 1 having a 3' end that binds to a transforming DNA target region and a 5' end having a universal sequence 2, and 2) a universal primer 1 having a 3' end identical to the universal sequence 1 and / or a universal primer 2 having a 3' end identical to the universal sequence 2.
10. The kit according to claim 9, characterized in that The kit further comprises: One or more first-round original DNA primer pairs, wherein the first-round original DNA primer pairs have a forward primer and a reverse primer, wherein the 5' end of the forward primer or the reverse primer has a universal sequence 3; and One or more second-round original DNA primer sets, the second-round original DNA primer sets comprising: 3) a semi-nested primer 2 having a 3' end that binds to the original DNA target region and a 5' end having a universal sequence 4, and 4) a universal primer 3 having a 3' end identical to the universal sequence 3 and / or a universal primer 4 having a 3' end identical to the universal sequence 4.
11. The kit according to claim 9, characterized in that The sequences of the universal primer 1 and the universal primer 2 may be the same or different; Optionally, at least one of the universal sequence 1, universal sequence 2, universal primer 1 and universal primer 2 includes but is not limited to a sequencing adapter sequence, a sample tag sequence or a molecular tag sequence.
12. Use of the kit according to any one of claims 9 to 11 in preparing a sequencing library.
13. A method for sequencing and / or detecting methylation sites of a target nucleic acid molecule, characterized in that: include: 1) constructing a sequencing library for the target nucleic acid molecule according to the method of claim 7 or 8; 2) performing sequencing on the sequencing library to obtain sequencing results; and 3) Based on the sequencing results, determining the nucleic acid sequence of the target nucleic acid molecule and / or the methylation site of the nucleic acid molecule.
14. A method for detecting methylation-related diseases, characterized in that: The following steps are involved: i) constructing a subject sequencing library for the nucleic acid molecule derived from the subject using the method according to claim 7 or 8; ii) performing sequencing on the subject sequencing library to obtain sequencing results; iii) determining the methylation sites of the nucleic acid molecule derived from the subject based on the sequencing results; and iv) determining whether the subject suffers from a methylation-related disease based on the methylation site.
15. The method according to claim 14, characterized in that The methylation-related diseases include at least one selected from the group consisting of cardiovascular disease, cerebrovascular disease, autoimmune disease, metabolic disease and cancer; Optionally, the cerebrovascular disease is cerebral hemorrhage or stroke; Optionally, the autoimmune disease is psoriasis, lupus erythematosus or psoriasis; Optionally, the metabolic disease is obesity, type 2 diabetes, non-alcoholic fatty liver disease or osteoporosis; Optionally, the cancer is colorectal cancer, lung cancer, liver cancer, gastric cancer, pancreatic cancer or brain glioma.