Spirotetramat / SPc / dsDpp multi-component composite pesticide and preparation method thereof

Abstract

The invention provides a spirotetramat / SPc / dsDpp multi-component composite insecticide and a preparation method thereof, the composite insecticide comprises a spirotetramat / SPc complex and dsDpp, and the mass ratio of SPc to dsDpp in the spirotetramat / SPc complex is 0.1-10; the nucleotide sequence of the dsDpp is as shown in SEQ ID NO. 1. The dsDpp in the spirotetramat / SPc / dsDpp multi-element composite insecticide participates in Dpp genes formed by fatty acid synthesis and epidermis through RNAi silencing, so that ecdysis failure and epidermis defects of aphids are caused; the SPI further destroys the epidermal barrier by inhibiting lipid metabolism, the fatality rate is remarkably increased to 94.5-96.6% by superposition of the SPI and the lipid metabolism, and the initial onset time is shortened.

Description

Technical Field

[0001] The present invention belongs to the field of insecticides, and particularly relates to a spirotetramat / SPc / ds Dpp multicomponent composite insecticide and a preparation method thereof. Background Art

[0002] In the face of the limitations of traditional synthetic pesticides due to environmental pollution and enhanced pest resistance, RNAi technology has become a revolutionary direction for green pesticides with its high specificity and low residue potential. However, it is limited by the bottlenecks of easy degradation of dsRNA in insects, low efficiency of single target, and high cost of target screening. The introduction of nanomaterials (such as chitosan, liposomes) protects dsRNA by encapsulation and promotes endocytosis absorption, but it is still difficult to break through the limitation of single target bioavailability. The existing commercial agent spirotetramat has problems such as slow action and poor quick-acting property, further restricting its application potential in the rapid prevention and control of pests. Summary of the Invention

[0003] In view of this, the present invention aims to overcome the defects in the prior art and provides a spirotetramat / SPc / ds Dpp multicomponent composite insecticide and a preparation method thereof.

[0004] To achieve the above object, the technical solution of the present invention is realized as follows: The present invention provides a spirotetramat / SPc / ds Dpp multicomponent composite insecticide, which comprises a spirotetramat / SPc complex and ds Dpp , and the mass ratio of the ds Dpp to SPc in the spirotetramat / SPc complex is 0.1-3:1; the nucleotide sequence of the ds Dpp is as shown in SEQ ID NO.1.

[0005] Furthermore, the spirotetramat / SPc complex is incubated from the nanocarrier SPc and spirotetramat, and the mass ratio of the nanocarrier SPc to spirotetramat is 1-6:1.

[0006] Preferably, the mass ratio of the ds Dpp to SPc in the spirotetramat / SPc complex is 0.5-2:1.

[0007] The present invention also provides a preparation method of the spirotetramat / SPc / ds Dpp multicomponent composite insecticide, comprising the following steps: Step 1 is to incubate the nanocarrier SPc with an excessive amount of spirotetramat to obtain a spirotetramat / SPc complex; Step 2 is to mix the spirotetramat / SPc complex with dsDpp Incubate to obtain the spirotetramat / SPc / ds Dpp multi-component composite insecticide.

[0008] Furthermore, the temperature of the incubation step in Step 1 is 20-35 °C and the time is 1-30 minutes.

[0009] Furthermore, the temperature of the incubation step in Step 2 is 20-35 °C and the time is 1-30 minutes.

[0010] The star-shaped polycation (SPc) with both a hydrophobic core and a multi-functional hydrophilic shell structure not only improves the stability of dsRNA, but also realizes the "gene regulation + chemical intervention" dual linkage effect through a multi-component co-delivery strategy, significantly improving the prevention and control efficiency and reducing the R & D cost. This technical system provides a new paradigm with high efficiency, sustainability and environmental friendliness for solving the industrialization problems of RNA pesticides through the multi-functional integration of nano-carriers and the spatio-temporal coordination of multi-active ingredients.

[0011] Compared with the prior art, the present invention has the following advantages: The spirotetramat / SPc / ds Dpp in the multi-component composite insecticide of Dpp ds silences the genes involved in fatty acid synthesis and cuticle formation through RNAi, resulting in aphid molting failure and cuticle defects; SPI further disrupts the cuticle barrier by inhibiting lipid metabolism. The superposition of the two significantly increases the lethality rate to 94.5-96.6% and shortens the initial onset time; SPc loads SPI through the hydrophobic core and electrostatically adsorbs and binds ds Dpp to form stable nanoparticles (322.95 nm, +28.22 mV). Its positive charge characteristics enhance the attachment to plant leaves and the contact area with the aphid body surface, promoting transmembrane absorption and gastric / contact toxicity; moreover, SPc delivers ds Dpp with rapid action, overcoming the short-acting and lagging properties of the single-component SPI; achieving efficient prevention and control of target pests. Dpp BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 is the relative expression level of the peach aphid Dpp after being interfered by ds described in Example 2 of the present invention; Dpp Figure 2 is the mortality rate of the peach aphid after being treated with ds described in Example 2 of the present invention; Dpp Figure 3 is the death phenotype of the peach aphid after being treated with ds described in Example 2 of the present invention; Dpp Figure 4 The volcano plot of transcriptome analysis after treatment for ds described in Example 2 of the present invention Dpp ; Figure 5 The KEGG analysis after treatment for ds described in Example 2 of the present invention Dpp ; Figure 6 The heat map of gene expression related to fatty acid synthesis described in Example 2 of the present invention Figure 7 The drug loading rate of the nano - carrier for spirotetramat: among them, Figure a is the absorption value at different concentrations, Figure b is the curve of the ultraviolet absorption value of spirotetramat at 277 nm and its concentration, and Figure c is the drug loading rate Figure 8 The agarose gel electrophoresis pattern of ds combined with spirotetramat / SPc described in Example 2 of the present invention Dpp ; Figure 9 The isothermal titration calorimetry result of titrating spirotetramat / SPc for ds described in Example 2 of the present invention Dpp ; Figure 10 The transmission electron microscope image of spirotetramat / SPc / ds described in Example 2 of the present invention: among them, Figure a is spirotetramat, Figure b is spirotetramat / SPc, Figure c is ds Dpp , Figure d is spirotetramat / SPc / ds Dpp ; Dpp ; Figure 11 The statistical analysis of the bright - blue - labeled spirotetramat / SPc / ds multi - component compound insecticide on the dorsal plate of Myzus persicae Dpp ; Figure 12 The mortality rate of Myzus persicae after dorsal - plate dropping of spirotetramat / SPc / ds multi - component compound insecticide described in Example 2 of the present invention Dpp ; Figure 13 The fluorescence quantitative result of Myzus persicae after dorsal - plate dropping of spirotetramat / SPc / ds multi - component compound insecticide described in Example 2 of the present invention: among them, Figure a is AAC, Figure b is FAS, Figure c is FABP, and Figure d is FACR Dpp ; Figure 14 The triglyceride content of Myzus persicae after dorsal - plate dropping of spirotetramat / SPc / ds multi - component compound insecticide described in Example 2 of the present invention Dpp ; Figure 15 The mortality rate of Myzus persicae after membrane - feeding of spirotetramat / SPc / ds multi - component compound insecticide described in Example 2 of the present invention Dpp ​ Figure 16 The spirotetramat / SPc / ds described in Example 2 of the present invention Dpp Fluorescence quantitative results after feeding Myzus persicae with the multi-component composite insecticide film: Among them, Figure a is AAC, Figure b is FAS, Figure c is FABP, and Figure d is FACR; Figure 17 The spirotetramat / SPc / ds described in Example 2 of the present invention Dpp The triglyceride content after feeding Myzus persicae with the multi-component composite insecticide film; Figure 18 The spirotetramat / SPc / ds described in Example 2 of the present invention Dpp The mortality rate of the simple mixture of the multi-component composite insecticide and other agents; Figure 19 The spirotetramat / SPc / ds described in Example 2 of the present invention Dpp The multi-component composite insecticide and spirotetramat / SPc / ds Scr The mortality rate. Detailed implementation manners

[0013] Unless otherwise defined, the technical terms used in the following examples have the same meanings as commonly understood by those skilled in the art to which the present invention belongs. The test reagents used in the following examples are all conventional biochemical reagents unless otherwise specified; the experimental methods are all conventional methods unless otherwise specified.

[0014] The preparation method of SPc refers to the article "A Facile-Synthesized Star Polycation Constructed as a Highly Efficient Gene Vector in Pest Management".

[0015] The present invention will be described in detail below with reference to the examples.

[0016] Example 1 Spirotetramat / SPc / ds Dpp Preparation of the multi-component composite insecticide 1. Synthesis of ds Dpp First, the total RNA of Myzus persicae at each instar was extracted using an RNA extraction kit (TransGen Biotech, China), and its quality was detected by measuring the RNA concentration and 1% agarose gel electrophoresis. Subsequently, the RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara, Japan). Obtained from the NCBI website

[0017] Obtained from the NCBI website DppThe sequence of (gene ID: LOC111033800) was used to design and synthesize primers for the target fragment (forward primer: GGTTTGCACACAACAACTGC, nucleotide sequence as shown in SEQ ID NO.2; reverse primer: TCCAGTGTGCTTTTCTGGCT, nucleotide sequence as shown in SEQ ID NO.3). Using the cDNA of Myzus persicae as a template, the target fragment was amplified by PCR with the above primers, and the amplification product was detected by agarose gel electrophoresis. After recovering the target band using a gel extraction kit, it was ligated to the pMD19T-Vector and transformed into Escherichia coli competent cells (DH5α). The transformed product was evenly spread on an LB solid medium containing 100 mg / L ampicillin and cultured overnight at 37°C in an inverted position. The next day, single colonies were picked as templates for PCR verification, and the strains with positive verification were subjected to gene sequencing. Dpp The plasmid of the strain with correct sequencing results was extracted as a template, and PCR amplification was performed again using primers with the T7 sequence, and the amplification product was recovered using a gel extraction kit. Finally, ds

[0018] was synthesized by in vitro transcription using the T7 RiboMAXTM expression kit (TransGen Biotech, China). Dpp primers, and the amplification product was recovered using a gel extraction kit. Finally, ds Dpp .

[0019] 2. Analysis of the lethal mechanism of ds Dpp interfering with Myzus persicae 150 ng of ds eGFP (control) and ds Dpp were used to treat 20 Myzus persicae respectively, with three replicates for each treatment. Total RNA of Myzus persicae was extracted 24 h after treatment. After reverse transcription, the relative expression level of the Dpp gene was determined by fluorescence quantitative PCR. As Figure 1 showed, it was found that the expression level of Dpp in Myzus persicae was reduced to 47.2% after interference; at the same time, the mortality within 3 d was observed and recorded, and using the treatment with ds Dpp as a control, the corrected mortality was calculated. As eGFP showed, it was found that the mortality of Myzus persicae reached 35.1% with ds Figure 2 , and the death phenotype of Myzus persicae after treatment with ds Dpp was as Dpp shown, and the death phenotype of Myzus persicae after treatment with ds Figure 3As shown. Take the green peach aphids after 24 hours of treatment, and use TRNzol (TIANGEN, China) to extract the total RNA of the green peach aphid tissues in each group. Three independent samples were prepared for each treatment. Use the Illumina HiSeq sequencing platform to construct a transcriptome library, and use BLASTX to compare and annotate with the KEGG database; use the FPKM value to characterize the expression level of each transcript. Through transcriptome analysis, it was found that compared with the ds Dpp treatment, the expression of 391 genes in the ds eGFP treatment changed significantly. A total of 348 genes were up-regulated and 43 genes were down-regulated, as Figure 4 shown. Through KEGG analysis, it was found that DEGs could be divided into multiple gene pathways, such as pathways of fat digestion and absorption, hormone synthesis and metabolism, and cuticle formation, as Figure 5 shown. Use DESeq to analyze the differentially expressed genes (DEGs) between different treatments, and the screening conditions are fold change (Fold change) ≥ 2.0 and FDR < 0.01 to further explore the molecular mechanism of the lethal effect of ds Dpp interference on green peach aphids. ds Dpp Compared with the ds eGFP treatment, the expression of multiple genes related to fatty acid synthesis was down-regulated, and it was found that interfering with Dpp genes could reduce the synthesis of fatty acids in green peach aphids, as Figure 6 described. As FASL, FACR1 and FACR3 the decrease in the expression level of genes could significantly reduce the synthesis of fatty acids. FABP plays an important role in transporting long-chain fatty acids in cells. ELOVL4 is involved in the synthesis of long-chain fatty acids and also plays an important role in the development of the body wall. Long-chain fatty acids are not only important components of cell membranes but also important respiratory substrates. After interfering with Dpp , it led to a decrease in long-chain fatty acids, seriously affecting the growth and development process of green peach aphids, especially during the molting process that consumes more energy, resulting in the failure of green peach aphids to molt successfully and die.

[0020] 3. Preparation of spirotetramat / SPc / ds Dpp multiple composite insecticides using nanocarriers First, mix the nanocarrier (SPc) with an excess of spirotetramat and incubate. Then, dialyze the mixed solution with a 20,000 Da dialysis bag to remove the spirotetramat that is not bound to the nanocarrier, obtaining the spirotetramat / SPc complex, and calculate the drug loading rate of SPc for spirotetramat. Spirotetramat can spontaneously bind to SPc in an aqueous solution to form the spirotetramat / SPc complex. The ultraviolet absorption value of spirotetramat at 277 nm is proportional to its concentration. Based on this, the drug loading rate of SPc for spirotetramat was calculated to be 24.7%, as Figure 7As shown. Then, according to the drug loading rate, spirotetramat and SPc were accurately added and incubated at room temperature for 15 min to obtain the spirotetramat / SPc complex. Subsequently, according to the mass of SPc in the complex, ds with different mass ratios was added, incubated at room temperature for 15 min, and the optimal binding ratio of ds to the spirotetramat / SPc complex was determined by agarose gel electrophoresis. When ds binds to the spirotetramat / SPc, it is difficult to move in the agarose gel under the action of an electric field. As shown in, when the mass ratio of ds to SPc is 1:1, ds completely binds to the spirotetramat / SPc. Finally, ds and the spirotetramat / SPc complex were added according to this binding ratio and incubated at room temperature for 15 min to obtain the spirotetramat / SPc / ds multi-component composite insecticide. Dpp , incubated at room temperature for 15 min, and the binding of ds Dpp to the spirotetramat / SPc complex was determined by agarose gel electrophoresis. When ds Dpp binds to the spirotetramat / SPc, it is difficult to move in the agarose gel under the action of an electric field. As Figure 8 shown, when ds Dpp binds to SPc with a mass ratio of 1:1, ds Dpp completely binds to the spirotetramat / SPc. Finally, ds Dpp and the spirotetramat / SPc complex were added according to this binding ratio and incubated at room temperature for 15 min to obtain the spirotetramat / SPc / ds Dpp multi-component composite insecticide.

[0021] Example 2 Testing of the spirotetramat / SPc / ds Dpp multi-component composite insecticide 1. Analysis and characterization of the binding mechanism of the spirotetramat / SPc / ds Dpp multi-component composite insecticide An isothermal titration calorimeter (ITC) was used to analyze the interaction between spirotetramat / SPc and ds Dpp . The specific operation was as follows: 250 μL of ds with a concentration of 1 mM was titrated into 2 mL of the spirotetramat / SPc (0.1 mM) solution, and the thermodynamic parameters during the titration were recorded to analyze the binding mechanism of the multi-component composite insecticide. The isothermal titration calorimetry results are shown in. The dissociation coefficient K Dpp (M) of ds and the spirotetramat / SPc was 7.9×10 Figure 9 , indicating a strong interaction between the two. The entropy change ΔH was -10.1 kJ / mol, and the enthalpy change ΔS was 64.1 J / mol•K. According to the Gibbs free energy: ΔG = ΔH - TΔS, the Gibbs free energy ΔG of the interaction reaction between the two substances was calculated to be -29.2 kJ / mol, indicating that ds Dpp and the spirotetramat / SPc could spontaneously bind. According to the ΔH and ΔS of the reaction, it can be speculated that the binding between ds d (M) was 7.9×10 -6 and the spirotetramat / SPc was mainly electrostatic interaction. Dpp and the spirotetramat / SPc was mainly electrostatic interaction. Dpp and the spirotetramat / SPc was mainly electrostatic interaction.

[0022] In addition, a high-sensitivity Zeta potential and particle size analyzer were used to sequentially measure spirotetramat, ds Dpp, Spc and its different combinations (spirotetramat / Spc, ds Dpp / Spc, spirotetramat / Spc / ds Dpp ). And the particle size distribution was observed by transmission electron microscopy to characterize the structural features of the multi-component compound insecticide. The particle size of spirotetramat in aqueous solution was 350 nm, the particle size of the spirotetramat / Spc complex decreased to 142 nm, and particles with a particle size of were formed after dsRNA was combined with spirotetramat / Spc, as shown in Table 1.

[0023] Table 1 Particle size of different components

[0024] The results in Table 1 were consistent with those of the transmission electron microscopy. Spirotetramat was an irregular aggregate, spirotetramat / Spc was an irregular near-sphere, ds Dpp was a linear chain, and uniform-sized spheres were formed after it was combined with spirotetramat / Spc, as Figure 10 shown.

[0025] 2. Attachment effect of spirotetramat / Spc / ds Dpp multi-component compound insecticide on aphids Brilliant blue solution was added to water, spirotetramat / Spc, ds Dpp and spirotetramat / Spc / ds Dpp solutions to label the solutions. The dorsal plates of Myzus persicae were treated dropwise with the above solutions, and then images of Myzus persicae were taken under a stereomicroscope. The attachment area of the solutions in different treatment groups was statistically analyzed using ImageJ software, and the solution area of the water treatment group was used as the normalization reference. After dropping the solutions with brilliant blue labels on the dorsal plates of Myzus persicae, the attachment area of brilliant blue was calculated. It was found that the attachment ability of ds Dpp was improved to a certain extent but there was no significant difference. The attachment ability of spirotetramat / Spc and spirotetramat / Spc / ds Dpp multi-component compound insecticides was increased to 1.5 times and 1.6 times respectively, as Figure 11 shown.

[0026] 6. Activity test of spirotetramat / Spc / ds Dpp multi-component compound insecticide The toxicity of spirotetramat / Spc / ds Dpp multi-component compound insecticide to aphids was evaluated by the membrane feeding method. The following treatments were set: water (control), Spc, spirotetramat (10 mg / L), spirotetramat / Spc (10 mg / L), dsDpp / Spc (100 mg / L), and spirotetramat / Spc / ds Dpp (spirotetramat: 10 mg / L, ds Dpp: 100 mg / L). Approximately 20 Myzus persicae were fed to each treatment group, with 3 replicates in total. Observe and record the mortality rate within 4 days, and calculate the corrected mortality rate with the water treatment group as the control.

[0027] The toxicity of spirotetramat / SPc / ds Dpp multi-component compound insecticide against aphids was further evaluated by the dorsal plate dropping method. The treatment groups and concentration settings were the same as above. Approximately 20 Myzus persicae were treated in each group, with 3 replicates. Record the mortality rate of aphids within 4 days, and finally calculate the corrected mortality rate with the water treatment group as the control. The results are as Figure 12 shown. The corrected mortality rate of ds Dpp was 25.7% after 4 days of treatment, the corrected mortality rate of spirotetramat was 60.7%, the mortality rate of spirotetramat / SPc increased to 79.5%, and the spirotetramat / SPc / ds Dpp multi-component compound insecticide increased to 98.0%, almost all died.

[0028] In addition, to further explore the effects of various treatments on the genes and physiological indexes related to fatty acid synthesis in Myzus persicae, total RNA of Myzus persicae was extracted after 24 h of treatment. After reverse transcription, the relative expression levels of genes related to fatty acid synthesis such as AAC, FAS, FABP, and FACR were determined by fluorescence quantitative PCR, with three replicates for each treatment. Then, the triglyceride content in Myzus persicae was measured using a triglyceride detection kit 2 days after each treatment, with three replicates for each treatment as well.

[0029] It was found by fluorescence quantitative analysis 1 day after treatment that genes related to fatty acid synthesis and transportation such as AAC, FAS, FABP, and FACR were significantly down-regulated, as Figure 13 shown. It was detected by a triglyceride detection kit 2 days after treatment that the triglyceride content decreased significantly after treatment with ds Dpp , spirotetramat, and spirotetramat / SPc. There was a further significant decrease in the spirotetramat / SPc / ds Dpp multi-component compound insecticide, as Figure 14 shown.

[0030] The toxicity of spirotetramat / SPc / ds Dpp multi-component compound insecticide against aphids was evaluated by the membrane feeding method. The results are as Figure 15 shown. The corrected mortality rate of ds Dpp was 40.5% after 4 days of treatment, the corrected mortality rate of spirotetramat was 74.1%, the mortality rate of spirotetramat / SPc increased to 93.5%, and the spirotetramat / SPc / ds Dpp multi-component compound insecticide increased to 100%, all died.

[0031] After 1 day of treatment, fluorescence quantitative analysis showed that genes related to fatty acid synthesis and transport, such as AAC, FAS, FABP, and FACR, were all significantly downregulated, as Figure 16 shown. After 2 days of treatment, triglyceride levels were detected using a triglyceride detection kit, and it was found that the triglyceride content decreased significantly after treatment with ds Dpp , spirotetramat, and spirotetramat / SPc. There was a further significant decrease in the triglyceride content after treatment with the spirotetramat / SPc / ds Dpp multi-component compound insecticide, as Figure 17 shown.

[0032] The toxicity of the spirotetramat / SPc / ds Dpp multi-component compound insecticide was compared with that of imidacloprid (where the mass ratio of imidacloprid to spirotetramat was 1:1) and the simple mixture of ds Dpp / SPc against aphids using the back-dropping method on the backplate. The results are as Figure 18 shown. After 4 days of treatment, the mortality rate of the spirotetramat / SPc / ds Dpp multi-component compound insecticide increased to 96.1%, and almost all aphids died. However, when ds Dpp / SPc was mixed with imidacloprid, the mortality rate only reached 67.8%, indicating that the multi-component compound insecticide using spirotetramat had a more significant effect. When a ternary complex was formed by mixing spirotetramat / SPc / ds Scr (the nucleotide sequence of ds Scr is shown in SEQ ID NO.4), the mortality rate only reached 64.9%, while that of spirotetramat / SPc / ds Dpp reached 94.5%. The results are as Figure 19 shown.

[0033] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A spirotetramat / SPc / ds Dpp The multi-component compound insecticide is characterized by: The compound insecticide comprises a spirotetramat / SPc complex and ds Dpp , the ds Dpp The mass ratio of ds to SPc in the spirotetramat / SPc complex is 0.1-3:1; Dpp The nucleotide sequence is shown in SEQ ID NO.

1.

2. Spirotetramat / SPc / ds according to claim 1 Dpp The multi-component compound insecticide is characterized by: The spirotetramat / SPc complex is formed by incubating the nanocarrier SPc and spirotetramat, and the mass ratio of the nanocarrier SPc to spirotetramat is 1-6:

1.

3. Spirotetramat / SPc / ds according to claim 2 Dpp The multi-component compound insecticide is characterized by: The ds Dpp The mass ratio of spirotetramat to SPc in the spirotetramat / SPc complex is 0.5-2:

1.

4. Spirotetramat / SPc / ds according to any one of claims 1 to 3 Dpp The preparation method of the multi-component compound insecticide is characterized by: The steps include: Step 1 is to incubate the nanocarrier SPc with an excess of spirotetramat to obtain a spirotetramat / SPc complex; Step 2 is to combine the spirotetramat / SPc complex with ds Dpp Incubate to obtain the spirotetramat / SPc / ds Dpp Multi-component compound insecticide.

5. Spirotetramat / SPc / ds according to claim 4 Dpp The preparation method of the multi-component compound insecticide is characterized by: The incubation step in step 1 is performed at a temperature of 20-35° C. and for a time of 1-30 minutes.

6. Spirotetramat / SPc / ds according to claim 4 Dpp The preparation method of the multi-component compound insecticide is characterized by: The incubation step in step 2 is performed at a temperature of 20-35° C. and for a time of 1-30 minutes.

Images