Application of camellia sinensis endophytic bacillus thuringiensis in preparation of medicine for relieving uc

Abstract

The application provides an application of Camellia nitidissima endophytic Bacillus thuringiensis in preparation of a medicine for relieving ulcerative colitis, the Camellia nitidissima endophytic Bacillus thuringiensis is preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No.32945. The Bacillus thuringiensis in the application can treat ulcerative colitis through a multi-target synergistic mechanism of regulating intestinal flora, activating an aromatic hydrocarbon receptor AhR, repairing an intestinal barrier, regulating a metabolic pathway and the like, so as to solve the problems of large side effects and easy recurrence of traditional treatment methods.

Description

Technical fields:

[0001] This application pertains to the fields of microbiology and the treatment of digestive tract diseases. Specifically, this application provides the use of Bacillus thuringiensis endophytic in Camellia chrysantha in the preparation of a drug for relieving ulcerative colitis (UC). Background technology:

[0002] Ulcerative colitis (UC) is one of the two major inflammatory bowel diseases (IBD), and due to its chronic, relapsing, and high incidence, it has become a major health problem worldwide. Since ulcerative colitis is incurable, treatment aims to relieve symptoms, maintain remission, and improve quality of life. However, traditional treatments such as medication and surgery are often accompanied by a range of side effects and relapses. Therefore, developing a treatment method with fewer side effects and sustained efficacy is crucial.

[0003] Ulcerative colitis (UC) is characterized by mucosal inflammation that begins in the rectum and rapidly spreads to the proximal colon, typically affecting the mucosal layer and damaging the intestinal wall. The intestinal barrier comprises the chemical barrier of the mucus layer, the mechanical barrier of the epithelial cell layer, and the immune barrier of the lamina propria. In the colon, the mucus layer serves as the first barrier on the gastrointestinal tract surface, with MUC2, synthesized by intestinal goblet cells, being the most important component. The epithelial cell layer intestinal barrier consists of a single layer of columnar epithelial cells and tight junctions (TJs), which inhibit the entry of harmful and pathogenic substances. TJs are composed of various proteins, including transmembrane proteins (such as claudins and occludins) and accessory proteins (ZO-1), which maintain the integrity of the intestinal barrier and regulate intestinal permeability. Because intestinal inflammation can disrupt the intestinal barrier, enhancing intestinal barrier function is one of the potential therapeutic strategies for IBD.

[0004] When the intestinal barrier is compromised, harmful microorganisms can cross it and enter the lamina propria, inducing an excessive immune response and exacerbating inflammation. Therefore, regulating gut microbiota dysbiosis and suppressing inflammatory responses are crucial in the treatment of ulcerative colitis (UC). Probiotics have remarkable potential in regulating gut microbiota. Probiotics, defined by the World Health Organization (WHO) as live microorganisms that provide health benefits to the host, have been extensively studied in their mechanisms of action against UC, such as strengthening the intestinal barrier and regulating intestinal immunity. Furthermore, studies have found that IBD leads to a significant reduction in gut probiotics, particularly Bifidobacteria and Lactobacilli, prompting researchers to focus on relevant probiotics. Studies have reported that probiotics can improve ulcerative colitis by regulating intestinal immunity and gut microbiota. Summary of the Invention

[0005] This application involves isolating and purifying endophytic bacteria from the Camellia chrysantha plant, screening out strain YE10, which was subsequently identified as Bacillus thuringiensis. Further research revealed that this bacterium can treat ulcerative colitis (UC) through a multi-target synergistic mechanism (regulating gut microbiota, activating aryl hydrocarbon receptors (AHR), repairing the intestinal barrier, and modulating metabolic pathways), thus addressing the issues of significant side effects and high relapse rates associated with traditional treatments.

[0006] On the one hand, this application provides the application of Bacillus thuringiensis endophytic in Camellia chrysantha in the preparation of drugs to relieve ulcerative colitis. Bacillus thuringiensis endophytic in Camellia chrysantha is preserved at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 32945.

[0007] Furthermore, the medication inhibits the shortening of the colon, thus alleviating the symptoms of colitis.

[0008] On the one hand, this application provides the application of Bacillus thuringiensis endophytic in Camellia chrysantha in the preparation of drugs for repairing intestinal barrier damage. Bacillus thuringiensis endophytic in Camellia chrysantha is preserved at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 32945.

[0009] Furthermore, the drug increased the expression of MUC2, Occludin, and ZO-1.

[0010] On the one hand, this application provides the application of Bacillus thuringiensis endophytic in Camellia chrysantha in the preparation of a drug for treating dysbiosis. Bacillus thuringiensis endophytic in Camellia chrysantha is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 32945.

[0011] Furthermore, the dysbiosis is specifically caused by ulcerative colitis.

[0012] Furthermore, the drug upregulated Lachnospiraceae_NK4A136_group and Muribaculaceae, and downregulated Escherichia-Shigella, Bacteroides sartorii, and Bacteroides caecimuris.

[0013] On the one hand, this application provides the application of Bacillus thuringiensis endophytic in Camellia chrysantha in the preparation of drugs that activate aryl hydrocarbon receptors. Bacillus thuringiensis endophytic in Camellia chrysantha is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 32945.

[0014] Furthermore, the drug increases the expression of aryl hydrocarbon receptors and / or CYP1A1.

[0015] Furthermore, the drug is an oral medication, an injectable medication, or a topical medication.

[0016] Furthermore, the drug is an oral medication.

[0017] Furthermore, the drug also contains pharmaceutically acceptable carriers.

[0018] The pharmaceutical product of this application may use techniques known in the art to preserve bacterial cells and maintain their activity as much as possible, such as freeze-drying after adding a suitable protectant, or encapsulating bacterial cells with enteric-coated capsules or microcapsules.

[0019] The Bacillus thuringiensis strain described in this application can regulate gut microbiota, activate the aryl hydrocarbon receptor AhR, repair the intestinal barrier, and modulate metabolic pathways, demonstrating significant efficacy in the treatment of ulcerative colitis. This provides a new approach for treating this intractable disease. Attached Figure Description

[0020] Figure 1 The results of biochemical identification of Bacillus strain YE10.

[0021] Figure 2 The results of staining for protein toxin crystals from strain YE10.

[0022] Figure 3 This presents the results of an experiment demonstrating that Bacillus thuringiensis can alleviate DSS-induced ulcerative colitis in mice. Part A shows the rate of change in body weight during DSS induction in each group; Part B shows the change in Disease Activity Index (DAI) scores during DSS treatment. Parts C and D show colonic morphology and length. Data are expressed as Mean ± SEM. Significance is indicated by letter difference; different letters indicate significant differences between groups.

[0023] Figure 4 This study investigated the effects of Bacillus thuringiensis on histopathological findings of colonic injury, intestinal mucosal injury, and intestinal barrier damage. Part A shows hematoxylin and eosin (HE) staining of colonic tissue; Part B shows periodic acid-Schiff (PAS) staining of colonic tissue; Part C shows HE histopathological scoring; and Part D shows PAS-stained goblet cell counts. All images were magnified 200x. Data are expressed as mean ± SEM. Significance is indicated by letter difference, with different letters representing significant differences between groups.

[0024] Figure 5Results of an experiment demonstrating that Bacillus thuringiensis alleviates intestinal barrier damage in colonic tissue. Part A: Immunohistochemical analysis of MUC2; Part B: Immunohistochemical analysis of Occludin protein; Part C: Immunohistochemical analysis of ZO-1 protein; Part D: Mean optical density analysis of MUC2; Part E: Mean optical density analysis of Occludin; Part F: Mean optical density analysis of ZO-1. All images were magnified 200x. Data are expressed as mean ± SEM. Significance is expressed using the letter method, where different letters indicate significant differences between groups.

[0025] Figure 6 The effect of Bacillus thuringiensis on AhR activation was investigated. Part A shows the Western blot analysis of AhR and CYP1A1 proteins in colon tissue; Part B shows the relative expression level of AhR protein; and Part C shows the relative expression level of CYP1A1 protein. Differences were expressed using a letter-based method; completely different letters between groups indicated a significant difference (p < 0.05).

[0026] Figure 7 The results show the relative abundance changes at each level. Part A is the phylum level; Part B is the genus level; and Part C is the species level.

[0027] Figure 8 This presents the results of a Bacillus thuringiensis metabolomics assay. Part A represents quality control; Part B shows changes in metabolites between groups; and Part C presents KEGG analysis. Detailed Implementation

[0028] Example 1: Isolation, purification, and identification of endophytic bacteria from Camellia chrysantha.

[0029] Plant cleaning and disinfection:

[0030] Clean the fresh golden chrysanthemum tea leaves to remove impurities, and wipe the surface dry with sterile filter paper. Soak all parts of the plant in 75% ethanol, then treat with hydrogen peroxide, and finally rinse thoroughly with sterile water.

[0031] Isolation of plant endophytic bacteria:

[0032] Endophytic bacteria were isolated using a tissue isolation method: Sterilized plant parts were dissected in a laminar flow hood using autoclaved scissors, and surface moisture was removed. The dissected plant tissues were inoculated into beef extract peptone medium using sterile forceps and labeled. Three replicates were set for each tissue type. The inoculated plates were placed in a 28°C incubator and colony growth was observed.

[0033] Purification of the strain was performed using the streak plating method: Hyphae or colonies were carefully sampled from the cut edge of plant tissue using a sterile inoculation loop and transferred to a new plate for streak purification. After new colonies grew on the plate, the streak plating process was repeated at least three times.

[0034] Plant endophytic bacteria culture, biochemical and molecular identification:

[0035] The purified YE10 strain was inoculated into LB liquid medium and cultured on a 37°C constant temperature shaker for 24 hours to obtain a large number of strains for subsequent strain sequencing.

[0036] The bacterial strain was centrifuged at 5000 rpm and 4℃ for 10 minutes. The bacterial cells in the YE10 fermentation broth were collected, and DNA was extracted and amplified into 16S rDNA before being sent to BGI Genomics for sequencing.

[0037] ATCTTTTATCCCAGTTGAAGAGGATGGAAAAGAAATTGTAGAAGTAAAACAATCAGGAAGTATTGTTTT

[0038] ACAGGCTAAATATTTTAGTGAAATTGTAAAAAAATTGCCGAAAGAAACTGTAGAAATTTCTGTCGAAAA

[0039] TCATTTAATGACAAAAATAACTTCTGGGAAATCAGAATTTAATTTAAATGGTTTAGATTCTGCAGAATA

[0040] TCCATTGTTACCACAAATTGAAGAACATCATGTTTTTAAGATTCCAACAGATTTACTAAACATATGAT

[0041] CAGACAAACTGTATTTGCAGTCTCCACTTCTGAAACAAGACCAATCTTGACAGGTGTAAACTGGAAGGT

[0042] ATATAACAGCGAACTAACTTGTATTGCTACAGATAGTCACAGGTTAGCTCTTCGAAAAGCAAAAATTGA

[0043] AGGTATTGCAGATGAATTCCAGGCAAATGTTGTTATTCCGGGGAAAAGCTTAAATGAATTAAGCAAAAT

[0044] TCTAGATGAGTCTGAAGAAATGGTAGATATCGTTATTACGGAGTATCAAGTATTATTCCGTACAAAACA

[0045] TTTATTATTCTTCTCAAGATTGTTAGAAGGAAATTATCCTGATACAACTCGATTAATTCCTGCAGAGAG

[0046] TAAAACAGATATTTTTGTAAATACAAAAGAATTTTTACAAGCAATTGATCGTGCATCCCTATTAGCAAG

[0047] AGATGGTCGTAATAATGTTGTAAAATTATCAACTTTAGAGCAGGCAATGCTAGAAATTTCTTCAAATTC

[0048] ACCAGAAATCGGGAAAGTAGTAGAAGAAGTTCAATGTGAAAAAAGTAGATGGAGAAGAGTTAAAAATATC

[0049] TTTTAGTGCAAAATATATGATGGATGCACTAAAGGCATTAGATAGTACTGAGATTAAGATTAGCTTTAC

[0050] TGGAGCAATGAGACCATTCTTAATTCGTACGGTAAATGATGAATCCATTATTCAATTAATTTTACCGGT

[0051] TCGTACTTACTAAGTAAGAAATAAGGGTTGCTAGTTTTCAGATGCTAGTAGCCCTTATTTGATTTTTGG

[0052] GTATTACTTTCCTAATGCTAGTTTATTTAGTACAATGAAAGAATGAACACTTTCAGAAAGTGAGCGATTTTATGAAACGTATTAAAATTTCAACAGAGTATATTACACT (SEQ ID NO. 1).

[0053] The assembled sequence was compared with the 16S rRNA gene sequence using BLAST on the NCBI website. Based on the BLAST results, strain YE10 may be either Bacillus cereus or Bacillus thuringiensis.

[0054] The YE10 strain was biochemically identified using Bacillus biochemical identification strips and lysozyme biochemical tubes. Bacillus thuringiensis possesses unique biochemical characteristics, including a positive VP reaction, inability to utilize citrate and propionate, inability to ferment sugars to produce acid, ability to hydrolyze gelatin and starch, ability to reduce nitrates, and the ability to grow in an environment with pH 5.7, 7% NaCl, and lysozyme. Figure 1 It can be seen that, through biochemical identification, the biochemical characteristics exhibited by strain YE10 are consistent with those of Bacillus thuringiensis.

[0055] To further verify the identity of strain YE10, given the characteristic of Bacillus thuringiensis exhibiting square crystals, this application performed a protein toxin crystal staining test. The test results showed that... Figure 2 The crystals clearly exhibit the typical square crystal characteristics of Bacillus thuringiensis, thus confirming that YE10 is Bacillus thuringiensis.

[0056] Strain preservation:

[0057] This strain was deposited on December 6, 2024, at the China General Microbiological Culture Collection Center (No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing), with accession number CGMCC No. 32945.

[0058] Example 2: Relief effect on ulcerative colitis

[0059] 1. DSS-induced ulcerative colitis

[0060] Twenty-five male BALB / c mice were randomly divided into three groups: blank control group (CNG), model group (DSS), and Bacillus thuringiensis treatment group (BADT, 1×10⁻⁶). 7 CFU / animal / day, administered once by gavage) and the Bacillus thuringiensis control group (BA, 1×10⁻⁶). 7 CFU), CH223191+ Bacillus group (BACT, 1×10⁻⁶) 7 CFU), n=5. Mice in each group were orally administered 200 μl of sterile water or bacterial solution for 21 consecutive days. Simultaneously, from day 14 to day 24, mice in both the model and treatment groups were given free access to 4% (w / v) sodium dextran sulfate (DSS, Shanghai Yuanye Biotechnology Co., Ltd., Shanghai, China) to induce colitis. CH223191 was administered intraperitoneally at a dose of 10 mg / kg every two days to inhibit AhR receptors. The preparation ratio was as follows: 1.5 mg of the drug was dissolved in 150 μL of DMSO, 600 μL of PEG300 / PEG400 was added, and the mixture was stirred until clear. Then, 75 μL of Tween 80 was added, and the mixture was stirred until clear. Finally, 675 μL of physiological saline was added. The mixture was prepared fresh and used immediately.

[0061] Mice were recorded daily for body weight and disease activity index (DAI) during the experiment. Colon length was measured and photographed in different groups of mice. After the experiment, the mice were euthanized, and colonic sections and colonic contents samples were collected and stored at -80°C for further analysis.

[0062] The blank control group (CNG) provides a reference point under normal conditions for comparing the effects of other treatment groups.

[0063] The model group (DSS) was used to verify whether DSS could successfully induce an ulcerative colitis model in mice. Mice in this group received only DSS treatment to induce colitis without any other treatment.

[0064] The Bacillus thuringiensis (BADT) treatment group was used to evaluate whether Bacillus thuringiensis could alleviate DSS-induced ulcerative colitis. Mice in this group received Bacillus thuringiensis treatment concurrently with DSS. Results were compared with the model group (DSS) to determine whether Bacillus thuringiensis could alleviate DSS-induced colitis symptoms. Milder symptoms or faster recovery in this group indicated potential therapeutic value of Bacillus thuringiensis.

[0065] The Bacillus thuringiensis control group (BA) was used to exclude the influence of other variables and ensure that the observed effects were indeed caused by Bacillus thuringiensis. This group received the same dose of Bacillus thuringiensis but did not receive DSS treatment.

[0066] The CH223191+Bacillus thuringiensis group (BACT) was used to investigate the role of AhR in the process of Bacillus thuringiensis alleviating colitis. CH223191 is a known AhR antagonist (inhibitor) that specifically blocks AhR function. By combining CH223191 with Bacillus thuringiensis, the contribution of AhR to the therapeutic effect of Bacillus thuringiensis on colitis could be evaluated. If the therapeutic effect of Bacillus thuringiensis was significantly reduced or eliminated, it indicated that AhR played a key role in this process.

[0067] This study established a DSS-induced mouse model of ulcerative colitis to evaluate the potential therapeutic and alleviating effects of different treatment groups (including the Bacillus thuringiensis treatment group, the Bacillus thuringiensis control group, and the CH223191+ Bacillus thuringiensis group) on ulcerative colitis. The study not only focused on changes in clinical symptoms, such as weight changes, Disease Activity Index (DAI) scores, and colon length measurements, but also conducted further histological and molecular analyses to comprehensively evaluate the effectiveness of the Bacillus thuringiensis treatment group (BADT) in treating and alleviating ulcerative colitis.

[0068] 2. Bacillus thuringiensis alleviates colitis symptoms and strengthens the intestinal barrier.

[0069] Bacillus thuringiensis can alleviate DSS-induced colitis: After DSS treatment, the body weight of mice in both the BACT and DSS groups decreased significantly. Figure 3 Part A). Based on the Disease Activity Index (DAI) score, it was observed that Bacillus thuringiensis alleviated the symptoms of colitis caused by DSS (Disease Activity Syndrome). Figure 3 Part B). Similarly, Bacillus thuringiensis therapy also inhibited the shortening of colon length caused by DSS (part B). Figure 3 (CD portion). Bacillus thuringiensis can alleviate DSS-induced colitis symptoms in mice.

[0070] Colon tissue samples from each group were sent to Wuhan Saiwei Biotechnology Co., Ltd. for histological analysis. Morphological changes were observed under an optical microscope at different magnifications to assess the degree of colon tissue damage and changes in goblet cell count. Goblet cell counting and immunohistochemical mean optical density analysis were performed using ImageJ software.

[0071] Bacillus thuringiensis can alleviate intestinal barrier damage caused by DSS:

[0072] Figure 4 Part A: HE staining images, used to assess overall structural changes and inflammation in colonic tissue. CNG (blank control group): Shows normal colonic tissue structure, with neatly arranged crypts and no obvious inflammatory cell infiltration. BA (Bacillus thuringiensis control group): Similar to the CNG group, showing normal colonic tissue structure. DSS (model group): Shows significant tissue damage, including crypt detachment, inflammatory cell infiltration, mucosal damage, and submucosal edema. BADT (Bacillus thuringiensis treatment group): Shows milder tissue damage, with well-preserved crypt structure and less inflammatory cell infiltration. BACT (CH223191 + Bacillus thuringiensis group): Shows milder tissue damage, with well-preserved crypt structure and less inflammatory cell infiltration, but the overall effect is significantly worse than the BADT group.

[0073] Figure 4 Part B: PAS staining was used to detect the number and distribution of goblet cells, which are responsible for secreting mucus to protect the intestinal barrier. Results: CNG (blank control group): Numerous and evenly distributed goblet cells. BA (Bacillus thuringiensis control group): Numerous and evenly distributed goblet cells. DSS (model group): Significantly reduced goblet cells, indicating that DSS led to goblet cell depletion. BADT (Bacillus thuringiensis treatment group): The number of goblet cells recovered somewhat, but remained lower than in the CNG group. BACT (CH223191+Bacillus thuringiensis group): The number of goblet cells recovered somewhat, but remained lower than in the BADT group.

[0074] In addition, histological scoring of colon tissue is also used to assess histopathological changes. Figure 4 In Part C of the study, the histological score of the DSS group was significantly higher than that of the control group. The degree of injury in the BADT and BACT groups was lower than that in the colitis model mice. Therefore, Bacillus thuringiensis can alleviate the histopathological damage caused by DSS.

[0075] Figure 4 Part D shows the PAS-stained goblet cell count: By observing the goblet cell count, it can be seen that Bacillus thuringiensis (BADT group) significantly increases the number of goblet cells compared to DSS (model group), thereby alleviating tissue damage in the DSS-induced colitis model.

[0076] The colon tissue was analyzed for MUC2, Occludin, and ZO-1 proteins to assess the impact of Bacillus thuringiensis on colonic barrier function.

[0077] Immunohistochemical analysis of MUC2 was used to assess the expression of the mucin MUC2 secreted by goblet cells. Immunohistochemical analysis of Occludin protein was used to assess the expression of the tight junction protein Occludin. Immunohistochemical analysis of ZO-1 protein was used to assess the expression of the tight junction protein ZO-1. Figure 5 As shown in the AF, the expression levels of MUC2, Occludin, and ZO-1 in the crypts and mucosal layer of mice in the DSS group were lower than those in the normal control group. The BADT and BACT groups showed varying degrees of recovery, with BADT showing better recovery. This indicates that the expression of MUC2, Occludin, and ZO-1 increased in mice treated with Bacillus thuringiensis. Therefore, Bacillus thuringiensis has a positive effect on enhancing intestinal barrier function.

[0078] 3. Bacillus thuringiensis activates AhR and / or CYP1A1 expression

[0079] No significant difference in AhR expression was observed between the CNG (blank control group) and BA (Bacillus thuringiensis control group), while a significant difference was observed between the CNG (blank control group) and DSS (model group). A significant difference was also observed between the BADT (Bacillus thuringiensis treatment group) and DSS (model group). This indicates that Bacillus thuringiensis can enhance AhR expression in the DSS-induced ulcerative colitis environment. BACT (CH223191+Bacillus thuringiensis group) significantly reduced AhR expression.

[0080] Significant differences were observed in CYP1A1 protein expression between the BADT group and the DSS and BA groups. This indicates that CYP1A1 is one of the downstream target proteins of AhR, and changes in CYP1A1 protein expression are correlated with AhR expression. In the DSS-induced ulcerative colitis environment of Bacillus thuringiensis, CYP1A1 protein expression also increased to some extent with the increase of AhR expression. In the BACT group, the inhibitor group significantly reduced CYP1A1 expression.

[0081] Depend on Figure 6 It was found that AhR expression was significantly decreased in the model group (DSS) and significantly increased in the Bacillus thuringiensis treatment group (BADT).

[0082] CYP1A1 expression: CYP1A1 expression was significantly decreased in the model group (DSS). CYP1A1 expression was significantly increased in the Bacillus thuringiensis treatment group (BADT).

[0083] Therefore, it can be concluded that the Bacillus thuringiensis treatment group (BADT) significantly enhanced the expression of AhR and CYP1A1, indicating that Bacillus thuringiensis has the effect of relieving and treating ulcerative colitis.

[0084] 4. Microbiome analysis

[0085] Shanghai Weihuan Biotechnology Co., Ltd. performed 16S rRNA analysis on the colon contents of mice from each group. Sequencing was performed using the Illumina HiSeq PE250 platform, and the sequencing data were processed. Uparse (Usearch Version 10.0.240) was used to cluster all valid tags for each sample into Operational Taxonomic Units (OTUs) with 97% identity, and representative sequences were selected for species annotation. usearch-sintax was used to compare the representative sequences of each OTU with the SILVA (16S), RDP (16S), Greengenes (16S), SILVA (18S), and Unite (ITS) databases to obtain species annotation information (threshold set at 0.8–1), thereby achieving the goal of understanding the species origin of all sequences. R software (version 3.5.1) was used to calculate the number of OTU-level crossovers (cores) in different samples to assess the adequacy of the sample size. Then, contaminated OTUs were removed, resulting in an OTU classification information table (OTU_table). Common and unique OTU analyses, as well as relative abundance analyses at the phylum and genus levels, were performed using R software (version 3.5.1). The chao_1, shannon_2, and ACE indices were calculated using arch-alpha_div (V10). Alpha diversity index intergroup differences and principal component analysis (PCA) were also performed using R software.

[0086] The results show:

[0087] Bacillus thuringiensis can alleviate the changes in gut microbiota diversity induced by DSS: In Alpha diversity analysis, the ACE and chao1 indices reflected microbial richness, while the shannon_2 index reflected microbial diversity. Compared with the DSS group, the BADT and BACT groups showed slightly increased richness and diversity, alleviating the dysbiosis of gut microbiota diversity and richness caused by DSS. PCA analysis of Beta diversity indicated that administration of Bacillus thuringiensis did not significantly affect the changes in gut microbiota structure induced by DSS.

[0088] Figure 7 The relative abundance changes of each group at the phylum, genus, and species levels are shown. Bacillus thuringiensis alleviated DSS-induced microbiota dysbiosis: at the phylum level, DSS increased the abundance of Proteobacteria, a phylum that includes many pathogens, such as Escherichia coli, Salmonella, Vibrio cholerae, and Helicobacter pylori. Bacillus thuringiensis inhibited this change while upregulating Firmicutes. At the genus level, Bacillus thuringiensis upregulated Lachnospiraceae_NK4A136_group and Muribauculaceae. Lachnospiraceae_NK4A136_group contributes to the early production of SCFAs in inflammation. Muribauculaceae produces short-chain fatty acids through endogenous (mucoproteins) and exogenous polysaccharides (dietary fiber). Escherichia-Shigella, a harmful bacterium, was elevated after DSS administration. At the species level, *Bacteroides sartorii* and *Bacteroides caecimuris* are two major species associated with arginine synthesis and L-histidine degradation. The DSS group upregulated arginine synthesis and promoted L-histidine degradation. Overall, *Bacillus thuringiensis* is beneficial to microbial changes.

[0089] 5. Metabolomics analysis of Bacillus thuringiensis

[0090] Shanghai Weihuan Biotechnology Co., Ltd. performed non-targeted metabolomics analysis on the colon contents of mice in each group. Samples were taken from a -80℃ freezer and placed on prepared dry ice for sample pretreatment before LC / MS detection. Raw data were processed using Compound Discovery software for peak alignment, retention time correction, and peak area extraction. Metabolite structure identification was performed using Compound Discovery software with precise mass number matching (<10ppm) and secondary spectral matching to search the database. Downstream data processing was conducted using the Linux operating system and software R and Python.

[0091] In this experiment, QC samples were used for quality control during LC-MS detection. The stability of the peak area data extracted by the instrument was verified by observing whether there were significant inter-group differences and intra-group clustering between the QC samples and the actual samples.

[0092] Figure 8 Part A shows a dense distribution of QC samples, indicating reliable data. The DSS group was significantly separated from the other groups, indicating that DSS-induced colitis has a significant impact on metabolites. The BADT group showed some separation from the DSS group, indicating that Bacillus thuringiensis treatment can partially restore metabolite levels. The BACT group showed some distance from the BADT group, indicating that the addition of CH223191 as an AhR antagonist weakened the therapeutic effect of Bacillus thuringiensis.

[0093] Figure 8 Part B shows the upregulation and downregulation of metabolites among the groups. The CNG and DSS groups showed the largest changes, followed by the BADT, BACT, and DSS groups, with the CNG and BA groups showing the least changes.

[0094] The CNG and DSS groups showed the greatest changes, indicating that DSS-induced colitis significantly affected the metabolism of mice, leading to the upregulation or downregulation of a large number of metabolites. This typically reflects inflammatory responses, impaired intestinal barrier function, and other disease-related metabolic changes.

[0095] The changes were most pronounced in the BADT, BACT, and DSS groups, indicating that Bacillus thuringiensis can alleviate metabolic disorders caused by DSS to some extent. Although the BACT group also showed some metabolite recovery, the degree of change was less than that in the BADT group. This is because the BACT group contained CH223191, an AhR inhibitor, which weakens the protective effect of Bacillus thuringiensis by blocking the AhR signaling pathway. The therapeutic effect of Bacillus thuringiensis is achieved by activating the AhR pathway, and the presence of CH223191 interferes with this process, resulting in a less significant therapeutic effect than when Bacillus thuringiensis is used alone.

[0096] The CNG and BA groups showed the least change, indicating that in the absence of DSS induction, the addition of Bacillus thuringiensis (BA group) alone had little effect on the metabolic state of mice, meaning that the metabolite profile of the BA group was similar to that of CNG. This suggests that Bacillus thuringiensis itself has little effect on the metabolism of healthy individuals, but plays an important role in pathological states.

[0097] Figure 8Part C shows that the main differences between groups lie in metabolism, primarily in D-amino acid, tryptophan, and histidine metabolism. This figure reveals that DSS-induced colitis significantly affects multiple key metabolic pathways in mice, including D-amino acid metabolism, tryptophan metabolism, and histidine metabolism. These changes indicate that DSS not only damages gut health but also broadly disrupts the host's normal metabolic state. However, the BADT group was able to effectively alleviate these DSS-induced metabolic disturbances and promote partial recovery of the aforementioned metabolic pathways, demonstrating its potential in repairing damaged metabolic balance.

Claims

1. An endophytic Bacillus thuringiensis in Camellia chrysophagus (Bt) Bacillus thuringiensis The application of YE10 in the preparation of drugs to relieve ulcerative colitis: The endophytic Bacillus thuringiensis YE10 of Camellia chrysantha is preserved at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 32945.

2. According to claim 1, the drug inhibits the shortening of colon length and alleviates colitis symptoms.

3. The application according to claim 1, characterized in that, The drug is used to repair damage to the intestinal barrier.

4. In the application according to claim 3, the drug increases the expression of MUC2, Occludin, and ZO-1.

5. The application of Bacillus thuringiensis YE10 endophytic in Camellia chrysantha in the preparation of a drug for treating dysbiosis, wherein Bacillus thuringiensis YE10 endophytic in Camellia chrysantha is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 32945; The dysbiosis is a dysbiosis caused by ulcerative colitis.

Images