Two-dimensional DNA origami film carrying oncolytic virus medicine and preparation method and application thereof

Abstract

The invention discloses a two-dimensional DNA origami film-loaded oncolytic virus drug and a preparation method and application thereof, and relates to the field of antitumor drugs, and the two-dimensional DNA origami film-loaded oncolytic virus drug is constructed by a two-dimensional DNA origami film and a type 5 oncolytic adenovirus. 5 type oncolytic adenovirus with the concentration of 5 * 10 < 11 > VP / mL is mixed with the two-dimensional DNA origami film, a 1 * TAE / Mg < 2 + > solution is added, incubation is conducted at the room temperature, then centrifugation is conducted, a PBS solution is supplemented after supernate is removed, and the adenovirus-based two-dimensional DNA origami film is obtained. The two-dimensional DNA origami film is used for carrying the 5-type oncolytic adenovirus, so that the virus intake of tumor cells is remarkably improved, and the anti-tumor curative effect of the oncolytic virus is enhanced.

Description

Technical Field

[0001] The present invention relates to the field of anti-tumor drugs, and particularly to the combined application of two-dimensional DNA origami thin films and oncolytic viruses in anti-tumor treatment. Background Art

[0002] Oncolytic virus is a novel and unique cancer immunotherapeutic agent that can selectively eliminate tumor cells by targeting cytotoxicity and simultaneously inducing a systemic anti-tumor immune response while leaving normal cells unharmed. Oncolytic virus is a highly versatile cancer treatment platform with the ability to selectively replicate in tumor cells and induce tumor cell lysis, and can induce infiltration of immune cells at the tumor site through virus-mediated inflammatory responses, turning "cold tumors" into "hot tumors". The tumor-associated neoantigens and damage-associated molecular patterns released following oncolytic virus-induced immunogenic cell death can effectively activate dendritic cell maturation, recruit and activate immune cells such as T cells to infiltrate into an immune-excluded or immunosuppressive tumor microenvironment, enhancing the recognition and killing ability of immune cells, thereby driving anti-tumor immunity and alleviating the immunosuppressive tumor microenvironment, thus triggering a potent anti-tumor immune response. Local injection of oncolytic virus into a single tumor site can induce a distant effect, promoting innate and adaptive anti-tumor immune responses, and distant uninfected tumors will also undergo immune-mediated rejection leading to tumor regression. The anti-tumor effectiveness of oncolytic virus mainly depends on its strong ability to induce antigen-specific anti-tumor immune responses. In addition, oncolytic virus can be genetically engineered to express therapeutic genes that can further enhance anti-tumor activity. Oncolytic virus can also help regulate abnormalities in the tumor microenvironment, such as angiogenesis, tumor metabolism, and the rigid extracellular matrix barrier brought about by tumor stromal cells.

[0003] Two-dimensional nanomaterials, as an ultrathin layered structure substance, exhibit great potential in the field of drug delivery due to their extremely high surface area to volume ratio. They can efficiently load and transport a variety of therapeutic agents, covering a wide range such as small molecule drugs, peptides, and macromolecular proteins. This high surface area property not only promotes the achievement of high therapeutic loads but also ensures the continuous and stable release of therapeutic agents. Some two-dimensional nanomaterials have the ability to respond to external stimuli, enabling precise control of the timing of therapeutic release and realizing triggered or on-demand precise drug delivery. In the biomedical field, a variety of two-dimensional nanomaterials have been applied, including but not limited to carbon-based materials (such as graphene), nanoclays, black phosphorus, layered double hydroxides, metal-organic frameworks, covalent organic frameworks, two-dimensional metal carbides and nitrides, transition metal dichalcogenides, transition metal oxides, polymer nanosheets, and hexagonal boron nitride, etc. Most of these nanomaterials exhibit good biocompatibility and can degrade into non-toxic products in vivo. This property is undoubtedly beneficial for the design and application of therapeutic delivery systems, as it ensures that the materials can be safely excreted from the body after completing their tasks without imposing additional burdens or damages on the body. Summary of the Invention

[0004] Aiming at the problem that the insufficient uptake of viruses by tumor cells in current oncolytic virus therapy leads to weak killing of tumors by viruses, the present invention constructs a new preparation of oncolytic virus carried by two-dimensional DNA origami film by using two-dimensional DNA origami film to carry type 5 oncolytic adenovirus (Type 5 Adenovirus, AD5), significantly increasing the uptake of viruses by tumor cells, significantly enhancing the anti-tumor efficacy of intratumoral injection of oncolytic virus, and significantly slowing down tumor growth. Moreover, the oncolytic virus preparation provided by the present invention also has the characteristics of good biocompatibility, strong stability, high safety, and high bioavailability.

[0005] The present invention is achieved by the following technical solutions:

[0006] A drug of oncolytic virus carried by two-dimensional DNA origami film is constructed by two-dimensional DNA origami film and type 5 oncolytic adenovirus (Type 5 Adenovirus, AD5).

[0007] The preparation method of the drug of oncolytic virus carried by two-dimensional DNA origami film described in the present invention includes the following steps:

[0008] Mix AD5 with a concentration of 5×10 11 VP / mL with two-dimensional DNA origami film, add 1×TAE / Mg 2+ solution, incubate at room temperature, then centrifuge, discard the supernatant, and supplement PBS solution.

[0009] The specific steps include: Mix 100 μL of AD5 with a concentration of 5×10 11 VP / mL with 20 μL of two-dimensional DNA origami film, and supplement 1×TAE / Mg 2+ solution to 500 μL, and incubate at room temperature for 10 min - 15 min. The presence of Mg 2+ in the solution system can enable the virus particles to firmly adsorb on the surface of the two-dimensional DNA origami film. Subsequently, centrifuge at 10000 g - 12000 g for 5 min - 8 min. After discarding 450 μL of the supernatant, supplement 450 μL of PBS solution to obtain AD@DNA.

[0010] Application of the drug of the two-dimensional DNA origami film carrying oncolytic virus in the preparation of anti-tumor drugs. The preparation AD@DNA of the present invention is administered by intratumoral injection during the treatment process.

[0011] Beneficial effects of the present invention:

[0012] By using the two-dimensional DNA origami film to carry oncolytic adenovirus type 5, the present invention significantly increases the uptake of the virus by tumor cells, which helps to enhance the anti-tumor efficacy of the oncolytic virus.

[0013] Examples show that the preparation AD@DNA induces a strong anti-tumor response in mice and significantly slows down tumor growth. It indicates that this preparation is more effective than using oncolytic virus or DNA origami film alone.

[0014] The stability of the two-dimensional DNA origami film in the present invention helps to protect the virus particles from being damaged during the in vivo circulation process, thereby improving the efficiency of their reaching tumor cells.

[0015] In in vivo experiments, there was no significant change in the body weight of mice during the administration period, indicating that the preparation AD@DNA has good safety and does not cause significant side effects.

[0016] Due to the high surface area to volume ratio characteristics of the two-dimensional DNA origami film, it can efficiently load and transport therapeutic agents, and can improve the bioavailability of therapeutic agents.

[0017] By combining the two-dimensional DNA origami film and oncolytic virus, the present invention discloses a new anti-tumor treatment method, which has obvious advantages over the prior art in terms of improving efficacy, safety and bioavailability. Description of the Drawings

[0018] Figure 1 It is the relative content of the genomic copy number of AD5 in the precipitate after the two-dimensional DNA origami film and AD5 are mixed and incubated for 10 min and centrifuged in Example 1 of the present invention;

[0019] Figure 2 A is the transfection efficiency of AD5 and AD@DNA in Example 2 of the present invention on B16F10 cells at a dose of 100 VP / cell. * P < 0.05;

[0020] Figure 2 B is the relative content of the AD5 genome after 24 h and 48 h of replication of AD5 and AD@DNA in B16F10 cells at a dose of 100 VP / cell in Example 2 of the present invention. ns indicates no statistically significant difference;

[0021] Figure 3 A is the growth curve of subcutaneous melanoma in mice in Example 3 of the present invention. ** P < 0.01, **** P < 0.0001;

[0022] Figure 3 B is the display of the final tumor size of subcutaneous melanoma in mice in Example 3 of the present invention.

[0023] Figure 3 C is the tumor weight of subcutaneous melanoma in mice in Example 3 of the present invention. ** P < 0.01, **** P < 0.0001;

[0024] Figure 3 D is the body weight curve of mice in Example 3 of the present invention. Detailed implementation manners

[0025] The technical solutions of the present invention will be further described below through specific implementation manners. Those skilled in the art should understand that the embodiments are only for helping to understand the present invention and should not be regarded as specific limitations on the present invention.

[0026] Unless otherwise specified, the instruments, reagents, and materials used in the present invention are all commercially available.

[0027] Experimental materials:

[0028] Type 5 oncolytic adenovirus (AD5) was purchased from Beijing Chuangte Biotechnology Co., Ltd. B16F10 cells were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences. RPMI 1640 medium was purchased from Wuhan Punosai Life Science Co., Ltd. C57BL / 6 mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. 1×TAE / Mg 2+ solution was prepared from 40 mM trisbase, 20 mM acetic acid, 2 mM EDTA, and 12.5 mM magnesium acetate, and the pH was adjusted to 8.0. The above materials were all purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0029] Example 1

[0030] Construct a two-dimensional DNA origami film to carry the AD5 preparation AD@DNA and detect the binding rate of AD5. The specific steps are as follows:

[0031] The two-dimensional DNA origami film of the present invention is prepared according to the published literature (Tang, Y.; Liu, H.; Wang, Q.; Qi, X.; Yu, L.; P.; Zhang, F.; Yan, H.; Jiang, S. DNA Origami Tessellations. J. Am. Chem. Soc. 2023, 145, 13858–13868.) by mixing the M13mp18 scaffold strand and its corresponding core short strand and edge short strand in 1×TAE / Mg 2+ buffer. The core short strand connects the scaffold strands into monomer DNA origami nanostructures, and the edge short strands connect the monomer DNA origami nanostructures together to form a two-dimensional DNA origami film. By mixing the M13mp18 scaffold strand (25 nM), the core short strand (250 nM), and the edge short strand (375 nM) in 1×TAE / Mg 2+ buffer, and then using a nexus X2PCR thermal cycler (Eppendorf) to anneal the mixture from 80 °C to 20 °C in about 101 h. The annealing program is as follows: hold at 80 °C for 10 min, cool from 80 °C to 40 °C at a rate of -1 °C / min, hold at 40 °C for 10 min, and cool from 40 °C to 20 °C at a rate of -0.1 °C / 30 min to obtain the two-dimensional DNA origami film. The M13mp18 scaffold strand is purchased from Bayou Biolabs, and the core short strand and edge short strand are purchased from GenScript.

[0032] Mix 5 μL, 2 μL, 1 μL of the two-dimensional DNA origami film with 100 μL of AD5 (concentration 5×10 11 VP / mL), supplement 1×TAE / Mg 2+ solution to a total volume of 500 μL, incubate at room temperature for 10 min, then centrifuge at 10000 g for 20 min, discard 490 μL of the volume (supernatant), and supplement 490 μL of PBS to obtain AD@DNA. The method for detecting the binding rate of AD5: Extract DNA from the remaining 10 μL of the volume after discarding 490 μL of the volume (supernatant), and perform qPCR (quantitative polymerase chain reaction) to detect the relative content of the AD5 genome in the precipitate. The control group is a solution containing only 100 μL of AD5 without adding the two-dimensional DNA origami film.

[0033] Figure 1It is the relative content of the copy number of the AD5 genome in the precipitate after the two-dimensional DNA origami film and AD5 in Example 1 were mixed and incubated for 10 min and centrifuged. Among them, the Y-axis represents the copy number of AD5 in the two-dimensional DNA film, and the X-axis represents different treatment groups, including the control group and the mixing ratios of the two-dimensional DNA origami film and AD5 of 1:20, 1:50, and 1:100. The copy number of AD5 in the control group was close to 0, indicating that in the absence of the two-dimensional DNA origami film, the genomic content of AD5 was extremely small. The copy numbers of AD5 in the 1:20, 1:50, and 1:100 groups were all very high, and the binding efficiency of AD5 to the two-dimensional DNA origami film was close to 100%, indicating that when the two-dimensional DNA origami film was mixed with AD5, the binding efficiency of AD5 to the two-dimensional DNA origami film was very high.

[0034] Example 2

[0035] Verify the infection and replication functions of AD@DNA on tumor cells. The specific operations are as follows:

[0036] (1) Take B16F10 cells in the logarithmic growth phase in the incubator, add 1640 medium to adjust the cell suspension concentration to 1×10 6 cell / mL, and spread 100 μL of the cell suspension per well on 2 12-well cell culture plates. At this time, the cell density in the wells to be tested in each 12-well plate is 1×10 5 cells / well, and a total of 24 experimental wells are set. Add 900 μL of 1640 medium to dilute the cell suspension concentration to 1×10 5 cell / mL.

[0037] (2) Incubate the cells conventionally for 14 - 16 h, that is, take out the culture plates when the cells are completely adherent but have not yet proliferated.

[0038] (3) For the 2 12-well plates, one is the AD5 group and the other is the AD@DNA group. Each group is divided into 3 time points, namely 4 h, 24 h, and 48 h, and there are 4 wells at each time point. Add 30 VP / cell of AD5 or AD@DNA to each well.

[0039] (4) After culturing the cells conventionally for 4 h, discard the medium in each well. Add 100 μL of trypsin to the samples at 4 h, and add 1 mL of 1640 medium to the samples at the other time points. After trypsin digestion for 2 min, add 1 mL of 1640 medium to the wells to terminate the digestion, and collect the samples at the 4 h time point into 1.5 mL EP tubes. The samples are stored in a -80 °C refrigerator.

[0040] (5) After culturing for 24 h or 48 h, the culture medium in the sample wells at the 24 h or 48 h time point was added to 1.5 mL EP tubes. Subsequently, 100 μL of trypsin was added and digested for 2 min, and then the culture medium in the EP tubes was added back to the original wells to terminate the digestion. Subsequently, each sample was collected into a 1.5 mL EP tube. The samples were stored frozen at -80 °C in a refrigerator.

[0041] (6) 1×10 5 HCT116 cells were added as an internal reference. Subsequently, DNA was extracted from each sample according to the operation of a DNA extraction kit (Novoprotein, DC102-01).

[0042] (7) Using human genomic GAPDH as the internal reference primer and AD5 genomic E1A as another primer for fluorescence quantitative PCR. The primers were purchased from Sangon Biotech (Shanghai) Co., Ltd., and the primer sequences were as follows:

[0043] Human genomic GAPDH-F: TTCTTGCCTTGCTCTTGCTACTC;

[0044] Human genomic GAPDH-R: TTAGCCTGCCTGGTGATAATCTT;

[0045] AD5-E1A-F: TGATCGATCCACCCAGTGAC;

[0046] AD5-E1A-R: ATGACAAGACCTGCAACCGT.

[0047] As Figure 2 shown in A, after 4 h of drug administration, the cells in the AD@DNA group of the preparation took up more AD5; as Figure 2 shown in B, the preparation AD@DNA had no obvious effect on the replication of AD5 in cells. Generally speaking, the preparation AD@DNA could improve the initial infection efficiency of AD5 on B16F10 tumor cells, indicating that the DNA origami technology enhanced the infectivity of AD5 on tumor cells. In addition, within the observation period of 24 h and 48 h, the preparation AD@DNA had no obvious effect on the replication of AD5 in cells, that is, it did not change the kinetics of virus replication. These results are of great significance for evaluating AD@DNA as a potential tumor treatment vector, especially in terms of improving the infection efficiency of viral vectors.

[0048] Example 3

[0049] To verify the anti-tumor effect of the preparation AD@DNA in vivo, the specific operation was as follows:

[0050] (1) On the -5th day (the fifth day before the official start of the experiment (the 0th day)), 2×106 B16F10 cells were injected subcutaneously into the right flanks of 28 male C57BL / 6 mice (6 - 8 weeks old) and divided into 4 groups, namely the PBS group, the two-dimensional DNA origami film (referred to as DNA) group, the AD5 group, and the AD@DNA group, with 7 mice in each group.

[0051] (2) On days 0, 2, 4, and 6, different preparations were injected into the tumors. The injection dose of the PBS group was 25 μL of PBS solution per mouse. The DNA group was injected with a two-dimensional DNA origami film solution diluted with PBS (prepared by mixing 1 μL of the original film solution + 24 μL of PBS solution), and the injection dose of the DNA group was 1 μL of DNA / 25 μL per mouse. The injection doses of the AD5 group and the AD@DNA group were 2×10 9 VP / 25 μL per mouse. The tumor volume and body weight were measured every 2 days. The formula for calculating the tumor volume (V) is: V = 1 / 2ab 2 , where a and b are the major axis and minor axis of the tumor respectively. On day 8, the mice were sacrificed to analyze the tumor weight and volume.

[0052] As Figure 3 shown in A, 3B, and 3C, compared with other groups, the AD@DNA group significantly inhibited tumor growth, suggesting the potent anti-tumor effect of AD@DNA. As Figure 3 shown in D, there was no significant change in the body weight of the mice during the administration period, suggesting good safety of the preparation.

Claims

1. A two-dimensional DNA origami film carrying an oncolytic virus drug, characterized in that: Constructed by two-dimensional DNA origami film and type 5 oncolytic adenovirus.

2. A method for preparing a drug containing an oncolytic virus carried by the two-dimensional DNA origami film according to claim 1, characterized in that: The concentration was 5×10 11 VP / mL of type 5 oncolytic adenovirus was mixed with the two-dimensional DNA origami film and 1×TAE / Mg 2+ The solution was incubated at room temperature, centrifuged, the supernatant was discarded, and PBS solution was added.

3. The method for preparing a drug containing an oncolytic virus carried by a two-dimensional DNA origami film according to claim 2, characterized in that: The following steps are included: 100 μL of 5×10 11 VP / mL of type 5 oncolytic adenovirus was mixed with 20 μL of 2D DNA origami film supplemented with 1×TAE / Mg 2+ The solution was diluted to 500 μL and incubated at room temperature for 10 min-15 min; then centrifuged, the supernatant was discarded, and PBS solution was added.

4. The method for preparing a drug containing an oncolytic virus carried by a two-dimensional DNA origami film according to claim 3, characterized in that: After incubation at room temperature for 10-15 minutes, centrifuge at 10000g-12000g for 5-8 minutes, discard 450 μL of supernatant, and add 450 μL of PBS solution.

5. Use of the two-dimensional DNA origami film according to claim 1 carrying oncolytic virus in the preparation of anti-tumor drugs.

6. The use according to claim 5, characterized in that: The application method is through intratumoral injection.

Images