Monoclonal Antibody Targeting the Gn Protein of Rift Valley Fever Virus and Its Application in Virus Detection

Abstract

The present invention discloses monoclonal antibodies C8 and A4 targeting the Gn protein of Rift Valley fever virus and their applications in virus detection. By using monoclonal antibodies C8 and A4 to construct a double-antibody sandwich ELISA assay, it can specifically detect the Gn antigen of Rift Valley fever virus, and there is no cross-reaction with the Gn antigens of other Bunyaviridae viruses such as severe fever with thrombocytopenia syndrome virus. The sequences of the monoclonal antibodies are clear, and the used monoclonal antibodies can be prepared by large-scale culture, with high sensitivity and a detection limit of 781 pg / mL.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a monoclonal antibody targeting the Gn protein of Rift Valley fever virus and its application in virus detection. Background Art

[0002] Rift Valley fever is a zoonotic mosquito-borne infectious disease. Clinically, Rift Valley fever is manifested as fever, headache, and muscle and joint pain. Severe cases can involve multiple organs and have a high fatality rate. Currently, there are no marketed human vaccines or specific therapeutic drugs.

[0003] The pathogen of Rift Valley fever is Rift Valley fever virus (RVFV). The RVFV genome is a single-stranded negative-sense RNA virus, consisting of three segments, L, M, and S. The L segment encodes RNA polymerase. The M segment encodes the envelope glycoproteins Gn and Gc. Gn is mainly responsible for the binding of the virus to host cells, while Gc plays a key role in membrane fusion. After the virus enters the body, it first replicates in the invaded local tissues, transfers to local lymph nodes through the lymphatic system for further replication, and then enters the bloodstream to form viremia, which generally lasts for 4 - 7 days. Subsequently, symptoms of infection and intoxication such as fever may appear, and focal infections in multiple organs can be caused.

[0004] Currently, the laboratory diagnostic methods for virus infection mainly include virus isolation, nucleic acid detection, antigen detection, and serological detection, etc. Among them, virus isolation is the gold standard for the diagnosis of virus infection, but this method requires relatively high laboratory conditions and a long cultivation time. Although the virus nucleic acid detection method is more sensitive and rapid than the traditional virus isolation and cultivation method, it has high requirements for equipment and personnel. Serum IgM detection starts to appear 5 - 6 days after virus infection, and IgG appears 14 days after virus infection, so rapid detection cannot be achieved. It is imperative to establish a simple and easy-to-implement diagnostic reagent that can specifically detect early Rift Valley fever virus infection, which is of significance for the rapid detection of suspected infected populations.

[0005] The Gn protein of Rift Valley fever virus is a relatively conserved envelope glycoprotein, which is mainly highly expressed in infected cells, has strong antigenicity, and exists in the early peripheral blood of virus-infected patients or animals. Therefore, detecting the Gn antigen in the serum of acute-phase patients can be used for the early diagnosis of Rift Valley fever virus infection.

[0006] The Gn protein of Rift Valley fever virus is encoded by the M gene of Rift Valley fever virus and mediates the receptor recognition process of the virus. The Gn protein is a type I transmembrane protein and is anchored to the membrane surface of the virus particle through a helical structure at the C-terminus. The extracellular region of the Gn protein can be divided into a head region (154 - 469 aa) and a stem region (470 - 582 aa). Research reports show that the neutralizing epitopes of the Gn protein are mainly concentrated in the head region, and the head region is composed of three regions, namely domain I, domain II, and domain III. Currently, the main binding regions of known Rift Valley fever virus neutralizing antibodies are domain I and domain III.

[0007] The methods for detecting the virus by antigen capture ELISA can be divided into two categories. One category uses polyclonal antibodies as capture antibodies or detection antibodies. Such methods have great differences in different batches of antiserum, are difficult to repeat, and are difficult to achieve laboratory standardization. The other category uses monoclonal antibodies to detect the virus. Currently, there is no commercial kit for detecting Rift Valley fever virus using monoclonal antibodies against Gn.

[0008] The invention application with the publication number CN114409770A discloses a human monoclonal antibody against Rift Valley fever virus and its application, which discloses 8 human monoclonal antibodies that can effectively treat mice infected with RVFV and prevent the infection of RVFV in mice. However, when used for treatment, it is not disclosed that it can be used for ELISA detection. Summary of the Invention

[0009] The present invention provides a kit for detecting Gn antigen of Rift Valley fever virus based on a double-antibody sandwich ELISA method. In the kit of the present invention, the monoclonal antibodies C8 and A4 are both immunoglobulins of the human IgG1 subclass, and both monoclonal antibodies can specifically bind to the Gn antigen of Rift Valley fever virus. The monoclonal antibodies are obtained by immunizing rhesus monkeys with an adenovirus vector Rift Valley fever candidate vaccine and recombinant Gn antigen, screening for high-binding activity monoclonal antibody variable region genes from peripheral blood using flow sorting - single-cell PCR technology, and obtaining two recombinant monoclonal antibodies C8 and A4 of the human IgG1 subclass through genetic engineering techniques.

[0010] The present invention first provides monoclonal antibodies targeting the Gn protein of Rift Valley fever virus, which are monoclonal antibody C8 and / or monoclonal antibody A4.

[0011] Among them, the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the heavy chain variable region of monoclonal antibody C8 are shown as the amino acid sequences at positions 26 - 33, 51 - 58, and 97 - 111 of the sequence shown in SEQ ID NO:1; the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27 - 32, 50 - 52, and 89 - 97 of the sequence shown in SEQ ID NO:2.

[0012] The amino acid sequences of CDR1, CDR2, and CDR3 regions of the heavy chain variable region of monoclonal antibody A4 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-101 of the sequence shown in SEQ ID NO:3; the amino acid sequences of CDR1, CDR2, and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-38, 56-58, and 95-103 of the sequence shown in SEQ ID NO:4.

[0013] Among them, monoclonal antibody C8 and / or monoclonal antibody A4 represent one or a combination of both of monoclonal antibody C8 and monoclonal antibody A4.

[0014] Preferably, the amino acid sequence of the heavy chain of monoclonal antibody C8 is shown as SEQ ID NO:1, and the amino acid sequence of the light chain is shown as SEQ ID NO:2;

[0015] The amino acid sequence of the heavy chain of monoclonal antibody A4 is shown as SEQ ID NO:3, and the amino acid sequence of the light chain is shown as SEQ ID NO:4.

[0016] The present invention also provides a gene encoding the monoclonal antibody targeting the Gn protein of Rift Valley fever virus. The gene sequence encoding the heavy chain of monoclonal antibody C8 is shown as SEQ ID NO:5, and the gene sequence encoding the light chain of monoclonal antibody C8 is shown as SEQ ID NO:6;

[0017] The gene sequence encoding the heavy chain of monoclonal antibody A4 is shown as SEQ ID NO:7, and the gene sequence encoding the light chain of monoclonal antibody A4 is shown as SEQ ID NO:8.

[0018] The present invention also provides the application of the monoclonal antibody targeting the Gn protein of Rift Valley fever virus in the preparation of a detection kit for detecting the Gn antigen of Rift Valley fever virus.

[0019] The present invention also provides a detection kit for detecting the Gn antigen of Rift Valley fever virus, including the monoclonal antibody targeting the Gn protein of Rift Valley fever virus. When the monoclonal antibody is one of monoclonal antibody C8 or monoclonal antibody A4, detection methods such as Western Blotting can be directly used for detection, or a secondary antibody that specifically binds to the constant region of the antibody can be additionally used for detection methods such as ELISA. When the monoclonal antibody is a combination of monoclonal antibody C8 and monoclonal antibody A4, a double antibody sandwich ELISA detection method can be used for detection.

[0020] Preferably, the detection kit is a double antibody sandwich ELISA detection kit, where monoclonal antibody C8 and monoclonal antibody A4 are used. One of monoclonal antibody C8 and monoclonal antibody A4 is used as a capture antibody, and the other is used as a detection antibody, and the detection antibody is labeled.

[0021] The capture antibody is used to bind to the antigen to capture the antigen to be detected; the detection antibody is used to detect the antigen after the antigen is captured by the captured antigen, and then the detection antibody binds to the antigen and is used for detection by means such as color development or fluorescence. It can be monoclonal antibody C8 as the capture antibody and monoclonal antibody A4 as the detection antibody, or vice versa, monoclonal antibody C8 as the detection antibody and monoclonal antibody A4 as the capture antibody.

[0022] Preferably, the label used to label the monoclonal antibody in the detection antibody is peroxidase, phosphatase or luciferase.

[0023] More preferably, the peroxidase is horseradish peroxidase.

[0024] The present invention also provides the application of the detection kit in detecting Rift Valley fever virus Gn antigen for non-diagnostic purposes.

[0025] The present invention also provides a double-antibody sandwich ELISA detection method for detecting Rift Valley fever virus Gn antigen for non-diagnostic purposes. Using the detection kit, the double-antibody sandwich ELISA detection method includes the following steps:

[0026] S1, coating the enzyme-labeled plate with the capture antibody;

[0027] S2, blocking with the blocking solution;

[0028] S3, discarding the blocking solution, washing with the buffer solution, then adding the sample to be detected, and incubating;

[0029] S4, washing with the buffer solution, then adding the detection antibody, and incubating;

[0030] S5, developing color and detecting.

[0031] Preferably, the double-antibody sandwich ELISA detection method includes the following steps:

[0032] (1) Coating: Dilute monoclonal antibody C8 with coating buffer to 2 μg / mL and coat it on the enzyme-labeled plate, 100 μL / well, overnight at 4°C;

[0033] (2) Blocking: Wash the plate 4 times with PBST, add 5% skim milk powder prepared with PBS, 100 μL / well, block at 37°C for 2 h;

[0034] (3) Sampling: Discard the blocking solution, wash the plate 4 times with PBST, add the sample to be tested, incubate at 37°C for 60 min;

[0035] (4) Adding enzyme-labeled antibody: Wash the plate 4 times with PBST, add the diluted horseradish peroxidase-labeled monoclonal antibody A4 (0.25 μg / mL), 100 μL / well, react at 37°C for 60 min;

[0036] (5) Color development: Wash the plate 4 times with PBST, add single-component TMB color development solution, 100 μL / well, and develop color at 37 °C in the dark for 10 min;

[0037] (6) Termination: Add 2 M H2SO4 to terminate the reaction, 50 μL / well;

[0038] (7) Reading: Measure OD with an enzyme-linked immunosorbent assay (ELISA) reader 450-630nm .

[0039] Result determination criterion: Use the ratio of OD of the sample to be tested 450-630nm (S) and OD of the negative control 450-630nm (N) as the criterion for determining positive. When S / N ≥ 2.1, it is determined as positive, that is, the sample to be tested contains Rift Valley fever virus; otherwise, it is determined as negative, that is, the sample to be tested does not contain Rift Valley fever virus.

[0040] The capture antibody C8 and detection antibody A4 described in the present invention are screened from a group of monoclonal antibodies targeting the Gn protein of Rift Valley fever virus, can specifically bind to Rift Valley fever virus, have no cross-reaction with other viruses of the genus Bunyavirus such as severe fever with thrombocytopenia syndrome virus, and have a high sensitivity to Rift Valley fever virus, which is beneficial to the early diagnosis of Rift Valley fever virus. At the same time, the monoclonal antibody sequence in this method is clear, can be obtained through large-scale fermentation, without the process of animal breeding and ascites extraction, and has low cost.

[0041] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0042] The present invention provides a kit for detecting the Gn antigen of Rift Valley fever virus based on the double-antibody sandwich ELISA method. When using this kit for double-antibody sandwich ELISA detection, it can specifically detect the Gn antigen of Rift Valley fever virus, has no cross-reaction with the Gn antigens of other viruses of the genus Bunyavirus such as severe fever with thrombocytopenia syndrome virus, the monoclonal antibody sequence is clear, the monoclonal antibody used can be prepared by large-scale culture, has high sensitivity, and the detection limit is 781 pg / mL. Description of the Drawings

[0043] Figure 1 It is the SDS-PAGE result of the truncated RVFV-Gn protein.

[0044] Figure 2 It is the SDS-PAGE result of the RVFV-Gn specific binding antibodies C8 and A4.

[0045] Figure 3 It is the ELISA result curve of the specific binding activity of C8 and A4 against RVFV-Gn (EC 50 determination).

[0046] Figure 4 ELISA result curve of C8-A4 antibody for detecting RVFV-Gn protein.

[0047] Figure 5 ELISA binding diagrams of two monoclonal antibodies with recombinant Rift Valley fever virus Gn antigen (RVFV-Gn) and severe fever with thrombocytopenia syndrome virus Gn antigen (SFTSV-Gn) respectively.

[0048] Figure 6 Detection standard curves of the two antibodies at their optimal concentrations in the present invention. Detailed implementation manners

[0049] Example 1: Obtaining of truncated RVFV-Gn protein

[0050] In this study, the head region (154-469aa) of the Gn protein was intercepted for eukaryotic expression and purification, laying a foundation for subsequent booster immunization of rhesus monkeys, sorting of Gn protein-specific memory B cells, and screening of Gn protein-binding antibodies.

[0051] The open reading frame (MORF) corresponding to the M gene (GenBank: DQ380208.1) of Rift Valley fever virus MP-12 strain was codon-synthesized by Shanghai Sangon Biotech Co., Ltd., and primers were designed based on this as a template to amplify the gene of truncated Gn protein. At the same time, the tPA signal peptide (ATGGACGCCATGAAGCGGGGCCTCTGCTGTGTTCTGCTGCTCTGCGGCGCCGTGTTCGTGAGTAACTCG) and Strep II tag (TTACTTTTCGAACTGCGGGTGGCTCCAGGCAGATCCTCCAGATCCTCCTCCAGATCCTCCTCCCTTTTCGAACTGCGGGTGGCTCCAAGCGGA) were respectively added to the N-terminus and C-terminus of the truncated Gn protein by PCR. Restriction enzyme cutting sites Eco R I and Not I and the homologous arms of the pCAGGs vector were added at both ends of the upstream and downstream primers, and then the target gene was ligated to the linear pCAGGs vector digested with double enzymes ( Eco R I and Not I) by homologous recombination method. After obtaining the recombinant plasmid containing the truncated Gn protein, it was transfected into Expi293F cells, and the truncated Gn protein was purified using an affinity chromatography column (Strep Trap XT). Its expression and purity were identified by SDS-PAGE. The purified Gn protein is as Figure 1 shown, with a size of about 40 kDa.

[0052] Example 2: Obtaining Monoclonal Antibodies Binding to RVFV-Gn Protein

[0053] Obtaining RVFV-Gn-binding monoclonal antibody: First, a recombinant human adenovirus type 4 expressing RVFV-Gn protein was constructed. The specific method was as follows: The open reading frame (MORF) of the M gene of Rift Valley fever virus MP-12 strain (GenBank: DQ380208.1) synthesized after codon optimization was cloned into plasmid pUC57 to obtain pUC57-opMORF. Using this as a template, restriction enzyme cleavage sites Swa I and pAd4 vector homologous arms were added to both ends of the target gene by PCR. Then, the plasmid pAd4 digested with restriction endonuclease Swa I alone was homologously recombined with the target gene to obtain a recombinant human adenovirus type 4 expressing Rift Valley fever virus Gn protein.

[0054] The truncated Gn protein obtained by purification was used to immunize rhesus monkeys twice. The immunization protocol was as follows: At the first immunization, 1×10 8 IFUs of the recombinant human adenovirus type 4 expressing Rift Valley fever virus Gn protein were used to immunize rhesus monkeys by intramuscular injection; the rhesus monkeys were immunized again in the same way and at the same dose on the 28th day after the first immunization. Finally, on the 56th and 182nd days after the first immunization, 0.25 mg of Gn protein was fully mixed with 0.25 mg of aluminum adjuvant (purchased from Invivogen, vac-alu-50), and the rhesus monkeys were boost-immunized by intramuscular injection.

[0055] Blood was collected intravenously on the 210th day after the first immunization. The antibody titer in the serum was detected by ELISA. Peripheral blood was collected, and Gn-specific B cells were sorted by flow cytometry. The antibody genes were cloned by single-cell PCR technology, and a linear expression cassette was constructed. The heavy and light chains were co-transfected into 293T cells. After culturing for 48 h, the supernatant was collected. Then, ELISA was used to detect whether the supernatant contained binding antibodies against Gn protein. The full-length genes of the heavy and light chains of the screened positive antibodies were cloned into the eukaryotic expression plasmid pCDNA3.4 by homologous recombination, transfected into the suspension cell Expi293F for large-scale expression, and purified by Protein A affinity column (HiTrapTM Protein A HP). Finally, two monoclonal antibodies C8 and A4 with good binding activity to Gn protein were obtained. Their expression and purity were identified by SDS-PAGE, and the results were as Figure 2 shown.

[0056] The amino acid sequence of the heavy chain of monoclonal antibody C8 is shown in SEQ ID NO:1, and the amino acid sequence of the light chain is shown in SEQ ID NO:2. The gene sequence encoding the heavy chain of monoclonal antibody C8 is shown in SEQ ID NO:5, and the gene sequence encoding the light chain of monoclonal antibody C8 is shown in SEQ ID NO:6. The amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of monoclonal antibody C8 are shown as the amino acid sequences at positions 26-33, 51-58, 97-111 of the sequence shown in SEQ ID NO:1, and the amino acid sequences of FR1, FR2, FR3 and FR4 regions are shown as the amino acid sequences at positions 1-25, 34-50, 59-96, 112-122 of the sequence shown in SEQ ID NO:1; the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-32, 50-52, 89-97 of the sequence shown in SEQ ID NO:2, and the amino acid sequences of FR1, FR2, FR3 and FR4 regions are shown as the amino acid sequences at positions 1-26, 33-49, 53-88, 98-107 of the sequence shown in SEQ ID NO:2;

[0057] The amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of monoclonal antibody A4 are shown as the amino acid sequences at positions 26-33, 51-58, 97-101 of the sequence shown in SEQ ID NO:3, and the amino acid sequences of FR1, FR2, FR3 and FR4 regions are shown as the amino acid sequences at positions 1-25, 34-50, 59-96, 102-112 of the sequence shown in SEQ ID NO:3; the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-38, 56-58, 95-103 of the sequence shown in SEQ ID NO:4, and the amino acid sequences of FR1, FR2, FR3 and FR4 regions are shown as the amino acid sequences at positions 1-26, 39-55, 59-94, 104-113 of the sequence shown in SEQ ID NO:4. The amino acid sequence of the heavy chain of monoclonal antibody A4 is shown in SEQ ID NO:3, and the amino acid sequence of the light chain is shown in SEQ ID NO:4. The gene sequence encoding the heavy chain of monoclonal antibody A4 is shown in SEQ ID NO:7, and the gene sequence encoding the light chain of monoclonal antibody A4 is shown in SEQ ID NO:8.

[0058] Example 3: Determination of the binding activity of monoclonal antibodies C8 and A4

[0059] 1. Coat an ELISA plate with purified RVFV-Gn protein (2 μg / mL, 100 μL / well) overnight at 4 °C. After washing 4 times with PBST, block it with 5% skim milk powder at 37 °C for 2 h;

[0060] 2. After washing 4 times with PBST, monoclonal antibodies C8 and A4 against Gn protein antigen with an initial concentration of 9 μg / mL were added respectively, diluted in a gradient ratio of 1:3, and incubated at 37 °C for 1 h;

[0061] 3. After washing 4 times with PBST, HRP-labeled goat anti-human IgG antibody (Sigma, AP113P) was added, the antibody dilution ratio was 1:5000, 100 μL / well, and incubated at 37 °C for 1 h;

[0062] 4. After washing 4 times with PBST, 100 μL of single-component TMB chromogenic solution was added, developed at 37 °C for 10 min, 50 μL of ELISA stop solution was added, and finally the OD 450-630nm value was read with an enzyme-linked immunosorbent assay reader.

[0063] With the monoclonal antibody concentration as the X-axis and OD 450-630nm as the Y-axis, the binding curves of monoclonal antibodies C8 and A4 to RVFV-Gn were obtained as Figure 3 .

[0064] Table 1 ELISA binding EC of monoclonal antibodies C8 and A4 to RVFV-Gn antigen 50

[0065]

[0066] Table 1 shows the EC 50 values of monoclonal antibodies C8 and A4.

[0067] Example 4: Detection sensitivity experiment of antibody pair C8-A4

[0068] To establish a double-antibody sandwich ELISA method for the detection of Gn antigen, it is necessary to conduct a detection sensitivity experiment on the screened antibody pair. Monoclonal antibody C8 is used as the capture antibody, and monoclonal antibody A4 is used as the detection antibody (in this application, the detection monoclonal antibody is obtained by the HRP direct labeling method).

[0069] Experimental method:

[0070] 1. Coat the capture antibody C8 at a concentration of 2 μg / mL on a 96-well ELISA plate, set two duplicate wells. Incubate overnight at 4 °C. The next day, wash the plate 4 times with PBST and block it with 5% skim milk powder at 37 °C for 2 hours.

[0071] 2. After completion of the closure, wash the plate 4 times with PBST, and add RVFV-Gn protein (concentration gradients are 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, 1.562 ng / mL, 0.781 ng / mL, 0.390 ng / mL, 0.195 ng / mL, 97.5 pg / mL, 48.75 pg / mL, 0 ng / mL) as the primary antibody, 100 μL per well, and incubate at 37 °C for 1 hour.

[0072] 3. After completion of the primary antibody incubation, wash the plate 4 times with PBST, and add HRP-labeled A4 as the secondary antibody (concentration is 2 μg / mL), and incubate at 37 °C for 1 hour.

[0073] 4. After completion of the secondary antibody incubation, wash the plate 4 times with PBST, add 100 μL of single-component TMB chromogenic solution, develop color at 37 °C for 10 minutes, add 50 μL of stop solution, and measure the OD 450-630nm absorbance value at this point to determine the binding activity.

[0074] Table 2 shows the OD 450-630nm values of the antibody pair C8-A4 for detecting RVFV-Gn. Using the ratio of the OD 450-630nm value S of the sample to be tested and the OD 450-630nm value N of the negative control as the standard for determining a positive test, when S / N ≥ 2.1, it is determined as positive, that is, the sample to be tested contains RVFV-Gn, otherwise it is judged as negative, that is, the sample to be tested does not contain RVFV-Gn. It can be concluded from Table 2 that the lowest detectable concentration of RVFV-Gn by this antibody pair is 390 pg / mL.

[0075] Table 2 OD 450-630nm values of the antibody pair C8-A4 for detecting RVFV-Gn

[0076]

[0077] Taking the RVFV-Gn concentration as the X-axis and the OD 450-630nm as the Y-axis, the binding curve of C8-A4 and RVFV-Gn is Figure 4 .

[0078] Example 5: Specificity of antibody pair detection

[0079] Two monoclonal antibodies C8 and A4 were respectively subjected to a binding test with recombinant Rift Valley fever virus Gn antigen and Severe fever with thrombocytopenia syndrome virus (SFTSV) Gn antigen. By detecting the OD 450-630nmDetermine whether C8 and A4 have detection specificity.

[0080] Experimental method:

[0081] 1. Coat an ELISA plate (2 μg / mL, 100 μL / well) with SFTSV-Gn protein (Gn antigen of SFTSV, purchased from ACROBiosystems, GNN-S52H3) overnight at 4 °C. After washing 4 times with PBST, block it with 5% skim milk powder at 37 °C for 2 h;

[0082] 2. After washing 4 times with PBST, add monoclonal antibodies C8 and A4 against RVFV-Gn protein antigen with an initial concentration of 200 ng / mL, and dilute them in a 1:2 ratio gradient. Incubate at 37 °C for 1 h;

[0083] 3. After washing 4 times with PBST, add HRP-labeled goat anti-human IgG antibody (Sigma, AP113P), with an antibody dilution ratio of 1:5000, 100 μL / well, and incubate at 37 °C for 1 h;

[0084] 4. After washing 4 times with PBST, add 100 μL of single-component TMB chromogenic solution, develop color at 37 °C for 10 min, then add 50 μL of ELISA stop solution, and finally read the OD 450-630nm value with an ELISA reader.

[0085] The binding experiments of the two monoclonal antibodies C8 and A4 with RVFV-Gn antigen are the same as in Example 3. Integrate and compare the results of Example 3 with the results of this example. Using the monoclonal antibody concentration as the X-axis and OD 450-630nm as the Y-axis, the binding curves of monoclonal antibodies C8 and A4 with RVFV-Gn and SFTSV-Gn are obtained as Figure 5 .

[0086] Figure 5 The binding curves of monoclonal antibodies C8 and A4 with RVFV-Gn antigen and SFTSV-Gn antigen are shown respectively. The results show that monoclonal antibodies C8 and A4 can specifically bind to RVFV-Gn antigen and do not bind to SFTSV-Gn antigen, indicating detection specificity.

[0087] Example 6: Optimization of the double-antibody sandwich ELISA detection protocol

[0088] When the antibody pair C8-A4 detects RVFV-Gn, the OD 450-630nm value of the blank well is relatively large, which is related to the concentration of the HRP-labeled antibody added. To establish a double-antibody sandwich ELISA method for the detection of RVFV-Gn antigen, it is necessary to optimize the addition amount of the monoclonal antibody during the detection process.

[0089] The specific optimization plan is as follows: reduce the addition amount of HRP-labeled antibody A4.

[0090] Experimental operation:

[0091] 1. Coat antibody C8 at a concentration of 2 μg / mL on a 96-well ELISA plate, set two replicate wells. Incubate overnight at 4°C. The next day, wash the plate 4 times with PBST and block it with 5% skim milk powder at 37°C for 2 hours.

[0092] 2. After blocking, wash the plate 4 times with PBST, add RVFV-Gn protein, diluted with 1% BSA, 100 μL / well, and incubate at 37°C for 1 hour. The initial concentration of the RVFV-Gn protein after dilution is 50 ng / mL, and it is serially diluted 2-fold, namely 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, 1.562 ng / mL, 0.781 ng / mL, 0.390 ng / mL, 0.195 ng / mL, 97.5 pg / mL, 48.75 pg / mL, 0 ng / mL.

[0093] 3. After incubation, wash the plate 4 times with PBST, add HRP-labeled antibody A4 as the secondary antibody, 100 μL / well, and incubate at 37°C for 1 hour. The concentrations of the secondary antibody are 1 μg / mL, 0.5 μg / mL, 0.25 μg / mL, and 0.125 μg / mL respectively.

[0094] 4. After incubation of the secondary antibody, wash the plate 4 times with PBST, add single-component TMB chromogenic solution, 100 μL / well, develop color at 37°C for 10 min, add 50 μL of stop solution, and measure the absorbance at OD 450-630nm value.

[0095] Table 3 shows the OD 450-630nm values for detecting RVFV-Gn with different concentrations of HRP-A4. As the concentration of the HRP-labeled antibody decreases, the OD 450-630nm value of the blank well (without adding RVFV-Gn protein) gradually decreases. Generally, it is required that the OD 450-630nm value of the blank well < 0.10.

[0096] It can be seen from Table 3 that as the concentration of HRP-A4 decreases, the OD 450-630nm values at the same Gn protein concentration gradually decrease, but the sensitivity is all at 0.781 ng / mL. Therefore, select the HRP-labeled antibody concentration under the condition that the blank OD 450-630nm value is less than 0.10 to make the kit, that is, coat antibody C8 at 2 μg / mL and detect antibody HRP-A4 at 0.25 μg / mL.

[0097] Table 3 OD values for detecting RVFV-Gn at different HRP-A4 concentrations 450-630nm Value

[0098]

[0099] Figure 6 Under the condition that the antibody HRP-A4 is 0.25 μg / mL, with the RVFV-Gn concentration as the X value and the OD value as the Y value, calculation is performed using ELISA calc, and the fitting curve is obtained by selecting a logistic curve (four parameters) for the fitting model. 450-630nm Value

[0100] Example 7: Sensitivity of double-antibody sandwich ELISA for detecting RVFV-Gn in serum

[0101] The object of the present invention is to detect whether Rift Valley fever virus is contained in human serum. Therefore, it is necessary to determine the detection sensitivity of this double-antibody sandwich ELISA for RVFV-Gn in human serum.

[0102] The specific implementation method is to dilute the RVFV-Gn protein with single-person serum (serum of healthy volunteers) stored in the laboratory and detect the detection range of this double-antibody sandwich ELISA in this situation.

[0103] Table 4 OD values for detecting RVFV-Gn in serum by double-antibody sandwich ELISA 450-630nm Value

[0104]

[0105] Table 4 shows the OD values for detecting RVFV-Gn in serum by double-antibody sandwich ELISA. It can be concluded from Table 4 that the detection sensitivity of this double-antibody sandwich ELISA for RVFV-Gn in human serum decreases compared with that in 1% BSA, but it can still reach 781 pg / mL. 450-630nm Value

Claims

1. A monoclonal antibody targeting the Gn protein of Rift Valley fever virus, characterized in that, It is monoclonal antibody C8 and / or monoclonal antibody A4, wherein, the amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of monoclonal antibody C8 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-111 of the sequence shown in SEQ ID NO:1; the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-32, 50-52, and 89-97 of the sequence shown in SEQ ID NO:2; the amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of monoclonal antibody A4 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-101 of the sequence shown in SEQ ID NO:3; the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-38, 56-58, and 95-103 of the sequence shown in SEQ ID NO:

4.

2. The monoclonal antibody targeting the Gn protein of Rift Valley fever virus according to claim 1, characterized in that, The amino acid sequence of the heavy chain of monoclonal antibody C8 is shown as SEQ ID NO:1, and the amino acid sequence of the light chain is shown as SEQ ID NO:2; The amino acid sequence of the heavy chain of monoclonal antibody A4 is shown as SEQ ID NO:3, and the amino acid sequence of the light chain is shown as SEQ ID NO:

4.

3. The gene encoding the monoclonal antibody targeting the Gn protein of Rift Valley fever virus according to claim 2, characterized in that, The gene sequence encoding the heavy chain of monoclonal antibody C8 is shown as SEQ ID NO:5, and the gene sequence encoding the light chain of monoclonal antibody C8 is shown as SEQ ID NO:6; The gene sequence encoding the heavy chain of monoclonal antibody A4 is shown as SEQ ID NO:7, and the gene sequence encoding the light chain of monoclonal antibody A4 is shown as SEQ ID NO:

8.

4. Use of the monoclonal antibody targeting the Gn protein of Rift Valley fever virus according to any one of claims 1-3 in the preparation of a detection kit for detecting Rift Valley fever virus Gn antigen.

5. A detection kit for detecting Rift Valley fever virus Gn antigen, characterized in that, It includes the monoclonal antibody targeting the Gn protein of Rift Valley fever virus according to any one of claims 1-3.

6. The detection kit according to claim 5, wherein The detection kit is a double-antibody sandwich ELISA detection kit, wherein the monoclonal antibodies are monoclonal antibody C8 and monoclonal antibody A4, one of monoclonal antibody C8 and monoclonal antibody A4 is used as a capture antibody, and the other is used as a detection antibody, and the detection antibody is labeled.

7. The detection kit according to claim 6, characterized in that, The label used for labeling the monoclonal antibody in the detection antibody is peroxidase, phosphatase or luciferase.

8. The detection kit according to claim 7, wherein The peroxidase is horseradish peroxidase.

9. Use of the detection kit according to any one of claims 6-8 in the detection of Rift Valley fever virus Gn antigen for non-diagnostic purposes.

10. A double-antibody sandwich ELISA detection method for detecting Rift Valley fever virus Gn antigen for non-diagnostic purposes, characterized in that, Using the detection kit according to any one of claims 6-8, the double-antibody sandwich ELISA detection method includes the following steps: S1, coating an enzyme-labeled plate with a capture antibody; S2, performing blocking with a blocking solution; S3, discarding the blocking solution, washing with a buffer, and then adding a sample to be detected and incubating; S4, washing with a buffer, and then adding a detection antibody and incubating; S5, developing color and detecting.

Images