Application of NbClpT2 in regulating plant resistance to PVY infection

Abstract

This invention discloses the application of NbClpT2 in regulating plant resistance to PVY infection, belonging to the field of plant disease control technology. Based on the fact that PVY infection can induce NbClpT2 gene expression and related protein expression, and that silencing the NbClpT2 gene can promote PVY infection, further experiments revealed that: NbClpT2 overexpressing plants have lower PVY virus content and are more resistant; mutant (knockout) lines have higher PVY virus content and are more susceptible; NbClpT2-mediated PVY resistance requires ROS participation; the PVY CP gene is significantly elevated in NbClpT2 overexpressing plants, while its expression is suppressed in NbClpT2 knockout mutants; NbClpT2 can enhance SA accumulation in Nicotiana benthamiana, etc. In other words, this invention clarifies the role of NbClpT2 in positively regulating plant resistance to PVY infection, which has a very broad application prospect in the control of plant viral diseases.

Description

Technical Field

[0001] This invention belongs to the field of plant disease control technology, and in particular relates to the application of NbClpT2 in regulating plant resistance to PVY infection. Background Technology

[0002] Viral diseases pose a significant threat to crop production safety, causing severe economic losses. As obligate live parasites, viruses, with their simple genomes and limited protein encoding, typically rely on host resources for replication, proliferation, and transmission. In the long-term interaction and interplay between plants and viruses, their offensive and defensive strategies have continuously evolved, ultimately leading to the multifunctionality of viral proteins and the involvement of various host organelles in viral defense. Chloroplasts, as a crucial site of viral infection, are frequently disrupted in structure and function by viruses; however, chloroplasts and their proteins also play a vital role in plant defense. Therefore, studying the interaction between plant viruses and chloroplast proteins not only helps elucidate viral infection mechanisms but also provides genetic materials and technical support for cultivating superior resistant crop varieties.

[0003] Potato virus Y (PVY), a typical representative of the Potyvirus genus, is one of the most damaging RNA viruses in crop production. Although significant progress has been made in understanding the infection mechanism of PVY, its interaction with host chloroplast proteins remains unclear. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides an application of the gene NbClpT2 in regulating plant resistance to PVY infection. The invention first experimentally discovered that PVY infection can induce NbClpT2 gene expression and related protein expression, and that silencing the NbClpT2 gene can promote PVY infection. Further experiments based on this found that NbClpT2 overexpressing plants have lower PVY virus content and are more resistant; mutant (knockout) lines have higher PVY virus content and are more susceptible; NbClpT2-mediated PVY resistance requires ROS involvement; PVY-related genes are significantly elevated in NbClpT2 overexpressing plants, while expression is suppressed in NbClpT2 knockout mutants; NbClpT2 can enhance SA accumulation in Nicotiana benthamiana, etc. In short, this invention clarifies the role of NbClpT2 in positively regulating plant resistance to PVY infection, which has broad application prospects in the control of plant viral diseases.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] One of the objectives of this invention is to provide the application of the NbClpT2 gene in plant resistance to PVY infection, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] Furthermore, in the aforementioned application, the NbClpT2 gene positively regulates plant resistance to PVY infection.

[0008] Furthermore, in the aforementioned application, plant resistance to PVY infection is achieved by increasing the expression level of the NbClpT2 gene.

[0009] The second objective of this invention is to provide a primer combination for amplifying the NbClpT2 gene, the nucleotide sequence of which is shown in SEQ ID NO.2 to SEQ ID NO.3.

[0010] A third objective of this invention is to provide a kit containing the aforementioned primer combination.

[0011] The fourth objective of this invention is to provide a recombinant expression vector containing the NbClpT2 gene.

[0012] The fifth objective of this invention is to provide a host bacterium containing the NbClpT2 gene or the recombinant expression vector.

[0013] The sixth objective of this invention is to provide the application of the primer combination, the kit, the recombinant expression vector, or the host bacterium in plant resistance to PVY infection.

[0014] Compared with the prior art, the present invention has the following technical effects:

[0015] (1) In this invention, *Nicotiana benthamiana* was inoculated with a PVY-GFP infectious clone. PVY accumulation was observed 4 days after inoculation, and it spread to the systemic leaves 6-10 days later. Subsequent proteomic analysis of *Nicotiana benthamiana* before and after PVY infection revealed upregulation of multiple ATP-dependent Clp protease family members after PVY infection, with the most significant upregulation of the terrestrial plant-specific subunit NbClpT2. Further analysis by qRT-PCR (Real-time reverse transcription PCR) showed that the NbClpT2 gene was significantly upregulated 4 and 6 days after PVY infection, subsequently gradually returning to baseline levels, indicating that it may play an important (positively regulatory) role in *Nicotiana benthamiana*'s defense against PVY infection.

[0016] (2) Through the construction and phenotypic analysis of NbClpT2 overexpression lines, this invention found that the GFP brightness of NbClpT2 overexpression plants OE8-2 and OE12-3 was lower than that of the wild-type control. Further detection of PVY CP gene expression revealed that the expression level of PVY CP gene in the overexpression plants was significantly lower than that in the control group, indicating that the PVY virus content was lower and thus the plants were more resistant to disease.

[0017] (3) Through the construction and phenotypic analysis of NbClpT2 gene-edited (knockout) lines, this invention found that the GFP brightness was higher in the two CRISPR-nbclpt2 mutant lines compared with the wild-type control. Further detection of PVY CP gene expression revealed that the expression level of PVY CP gene in the mutant lines was significantly higher than that in the control group, indicating that they were more susceptible to the disease.

[0018] (4) This invention, through detecting ROS bursting, found that both flg22 and chitin treatments induced ROS accumulation in leaves compared to the water control (mock). Compared to the wild type, flg22 significantly induced ROS accumulation in NbClpT2 overexpressing lines; conversely, the intensity of flg22-induced ROS bursting was suppressed in the nbclpt2 knockout mutant. Similarly, after chitin treatment, the amount of ROS accumulated in NbClpT2 overexpressing plants was higher than that in the wild type and the nbclpt2 knockout mutant. These results indicate that NbClpT2-mediated PVY resistance requires the participation of ROS.

[0019] (5) This invention, by detecting the expression of plant disease-related genes NbPR1 and NbPR2, PTI marker genes NbAcre31 and NbCYP71D20, salicylic acid marker genes NbPR1a and NbNPR1, and SA marker genes, found that these genes were significantly elevated in NbClpT2 overexpressing plants, while their expression was suppressed in NbClpT2 knockout mutants. This indicates that NbClpT2 may enhance the resistance of Nicotiana benthamiana to PVY by inducing the expression of disease-related genes, PTI, and SA, as well as other disease resistance signaling pathway genes.

[0020] (6) This invention, through detecting the SA content in leaves after PVY inoculation, found that the SA content in all groups of plants increased 4 days after PVY infection. However, the highest SA accumulation was observed in the NbClpT2 overexpressing plants, reaching 107.1 μg / g, while the lowest accumulation was observed in the NbClpT2 knockout mutant, at only 22.1 μg / g. This indicates that NbClpT2 can enhance the accumulation of SA in Nicotiana benthamiana.

[0021] In summary, this invention is the first to discover the application of a novel gene—NbClpT2—in regulating plant resistance to PVY infection, and clarifies that this gene plays a positive regulatory role in plant resistance to PVY infection. This has very broad application prospects in the prevention and control of plant viral diseases. Attached Figure Description

[0022] Figure 1 To observe the GFP fluorescence results of PVY-GFP inoculated with F. benthamiana under UV light during the infection process of PVY in Example 1 of this invention, bright field and fluorescence images were taken using an SLR camera and a LUYOR-3103P (Shanghai Luyang) UV lamp.

[0023] Figure 2 The following is an analysis of PVY expression after inoculation with *Nicotiana benthamiana* in Example 1 of this invention: (A) Expression analysis of the PVY CP gene at different time points after *Nicotiana benthamiana* inoculation with PVY; (B) Expression analysis of the PVY CP protein at different time points after *Nicotiana benthamiana* inoculation with PVY. Error bars represent the standard errors of three biological replicates, Student's t-test (*, p < 0.05; **, p < 0.01), NbActin is the internal reference gene of *Nicotiana benthamiana*. Actin and CCB (Coomassie Brilliant Blue) staining indicate the amount of total protein loaded into the sample. Anti-CP is a specific antibody for PVY CP.

[0024] Figure 3 For the proteomic analysis of PVY after infection with *Nymphaea benthamiana* in Example 1 of this invention: (A) Principal component analysis (PCA) before and after PVY infection with *Nymphaea benthamiana*; (B) Volcano plot analysis of differentially expressed proteins; (C) Heatmap analysis of differentially expressed proteins; (D) GO (Gene Ontology) functional annotation of differentially expressed proteins; (E) KEGG (Kyoto Encyclopedia of Genes and Genomes) metabolic pathway annotation of differentially expressed proteins.

[0025] Figure 4 This study analyzed the expression of the NbClpT2 gene at different time points (0, 4, 6, 8, 10 days) after *Nicotiana benthamiana* inoculation with PVY in Example 1 of this invention. Mock results were obtained using PBS control. Error bars represent the standard errors of three biological replicates. Student's t-test (***, p < 0.001) was used. NbActin was the internal reference gene for *Nicotiana benthamiana*.

[0026] Figure 5The effect of silencing the NbClpT2 gene on PVY infection in Example 1 of this invention: (A) The NbClpT2 gene was constructed into the pTRV2 vector and co-transformed with pTRV1 into tobacco leaves for 12 days, with NbPDS gene (phytoene dehydrogenase) as a positive control; (B) The silencing efficiency of the NbClpT2 gene was detected, with pTRV2:GUS as a negative control; (C) The GFP fluorescence results of NbClpT2 gene-silenced plants at different times (4, 6, 8, 10 days) after inoculation with PVY-GFP were observed under ultraviolet light; (D) The expression analysis of PVY CP gene in NbClpT2 gene-silenced plants at different times after inoculation with PVY was performed. Error bars represent the standard errors of three biological replicates. Student's t-test (*, p < 0.05; **, p < 0.01). NbActin is the internal reference gene for Nicotiana benthamiana. (E) Analysis of PVY CP protein expression at different time points after inoculation of NbClpT2 gene-silenced plants. Actin and CCB staining indicate the total protein loading amount in the sample. Anti-CP is a specific antibody against PVY CP.

[0027] Figure 6 The creation and identification process of NbClpT2 overexpression lines in Example 1 of this invention is as follows: (A) DNA level detection of NbClpT2 gene in overexpressing plants; (B) Western blot detection of NbClpT2 protein accumulation in overexpressing plants; (C) qRT-PCR detection of NbClpT2 gene expression level in overexpressing plants. "+" and "-" represent positive and negative controls, respectively; OE2-5 and OE6-1, OE8-2 and OE12-3 represent independent T3 generation transgenic lines, and the protein level of NbClpT2 was detected using Anti-HA antibody; NbActin is the internal reference gene of Nicotiana benthamiana, and the expression level of PVY CP gene is used to represent the accumulation of PVY mRNA. The error bar represents the standard error of three biological replicates, Student's t-test (****, p value < 0.0001).

[0028] Figure 7The effect of NbClpT2 gene overexpression on PVY resistance in Nicotiana benthamiana in Example 1 of this invention is as follows: (A) GFP fluorescence results of NbClpT2 overexpressing plants at different time points (6, 8, 10 days) after inoculation with PVY-GFP were observed under UV light; (B) PVY accumulation in NbClpT2 overexpressing plants at different time points after inoculation with PVY-GFP was detected by qRT-PCR. Error bars represent the standard errors of three biological replicates, Student's t-test (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001), NbActin is the internal reference gene of Nicotiana benthamiana; OE8-2 and OE12-3 represent independent T3 generation transgenic lines; the expression level of PVYCP gene is used to represent the accumulation of PVY mRNA.

[0029] Figure 8 The creation and identification of the NbClpT2 CRISPR-Cas9 gene-editing line in Example 1 of this invention: (A) The gene structure of NbClpT2 and the position of the PAM sequence on the target sequence; (B) DNA-level detection of the CRISPR-nbclpt2 mutant line; (C) PCR sequencing analysis of the CRISPR-nbclpt2 mutant line. ATG is the start codon, "+" and "-" represent positive and negative controls, respectively; the red base sequence represents the PCR amplification and sequencing results of the wild type and the CRISPR-nbclpt2 mutant line, WT represents the wild type; nbclpt2#3-4 and nbclpt2#7-5 represent independent T3 generation transgenic lines.

[0030] Figure 9 The effect of knocking out the NbClpT2 gene on PVY resistance in Nicotiana benthamiana in Example 1 of this invention is as follows: (A) GFP fluorescence results of nbclpt2 mutants inoculated with PVY-GFP at different time points (6, 8, 10 days) were observed under UV light; (B) PVY accumulation of nbclpt2 mutants after inoculation with PVY-GFP was detected by qRT-PCR. Error bars represent the standard errors of three biological replicates, Student's-test (*, p < 0.05; **, p < 0.01), NbActin is the internal reference gene of Nicotiana benthamiana; nbclpt2#3-4 and nbclpt2#7-5 represent independent T3 generation transgenic lines; the expression level of PVY CP gene is used to represent the accumulation of PVY mRNA.

[0031] Figure 10To illustrate the effect of NbClpT2 on ROS emission in Example 1 of this invention: Leaves from wild-type (WT), NbClpT2-overexpressing (NbClpT2-OE8-2), and knockout (nbclpt2-CRISPR3-4) plants were analyzed using leaf discs to detect ROS content. Samples were treated with 100 nM flg22 (A), 80 nM chitin (B), or sterile distilled water, respectively. Chemiluminescence values ​​were collected continuously for 25 min using a GloMax96 microplate chemiluminescence analyzer. Error bars represent the standard errors of three biological replicates.

[0032] Figure 11 To illustrate the effect of NbClpT2 on the expression of disease resistance-related genes in Nicotiana benthamiana in Example 1 of this invention: After inoculating wild-type (WT), NbClpT2-overexpressing (NbClpT2-OE8-2), and knockout (nbclpt2-CRISPR3-4) Nicotiana benthamiana plants with PVY at different times (0, 4, 6 days), the expression of disease-related genes NbPR1 (A), NbPR2 (B), PTI (Pathogen-Associated Molecular Patterns-Triggered Immunity) marker genes NbAcre31 (C), NbCYP71D20 (D), and SA (salicylic acid) marker genes NbPR1a (E), NbNPR1 (F) was detected. Error bars represent the standard errors of three biological replicates: Student's t-test (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001), where NbActin is the internal reference gene for Nicotiana benthamiana.

[0033] Figure 12 To investigate the effect of NbClpT2 on SA accumulation in Nicotiana benthamiana in Example 1 of this invention, ultra-high performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS) was used to detect the salicylic acid content in leaves of wild-type (WT), NbClpT2-overexpressing (NbClpT2-OE8-2), and knockout (nbclpt2-CRISPR3-4) Nicotiana benthamiana inoculated with PVY at different time points (0, 4d). Error bars represent the standard errors of three biological replicates, Student's t-test (*, p < 0.05; **, p < 0.01; ***, p < 0.001). Detailed Implementation

[0034] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the invention without departing from its spirit and essence are within the scope of the invention. The reagents, kits, and instruments used in the following examples are commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventional methods.

[0035] The specific methods used in the following embodiments can be found in the following literature:

[0036] (1)https: / / www.sciencedirect.com / science / article / pii / S0168170219307609;

[0037] (2)Acetyl-Proteomic Profiling ofSorghum bicolor Seedlings afterChitin Treatment Reveals the Involvement ofAcetylated Chlorophyll a / b BindingProteins in the Innate Immune Response

[0038] (3)Superoxide dismutase positively regulates Cu / Zn toxicity tolerance in Sorghum bicolor by interacting with Cu chaperone for superoxidedismutase. Journal of Hazardous Materials, 2024, 480: 135828

[0039] (4)Jansing J, Sack M, Augustine SM, et al. CRISPR / Cas9-mediated knockout of six glycosyltransferase genes in Nicotiana benthamiana for the production of recombinant proteins lacking β-1,2-xylose and coreα-1,3-fucose[J]. PlantBiotechnology Journal, 2019, 17(2): 350-361.

[0040] (5)Qiaoli Du # ,Yuanpeng Fang # ,Junmei Jiang # ,Meiqing Chen,Xiaodong Fu,Zaifu Yang,Liting Luo,Qijiao Wu,Qian Yang,Lujie Wang,Zhiguang Qu,XiangyangLi,Xin Xie*.Characterization ofhistone deacetylases and their roles inresponse to abiotic and PAMPs stresses in Sorghum bicolor.BMC Genomics,2022,23:28.

[0041] (6)XiaoLin Chen,Xin Xie,Liye Wu,Caiyun Liu,Lirong Zeng,Xueping Zhou,Feng Luo,Guo-Liang Wang * ,Wende Liu*.Proteomic analysis ofubiquitinatedproteins in rice(Oryza sativa)after treatment with pathogen-associatedmolecular pattern(PAMP)elicitors.Frontiers in Plant Science.2018,9:1064

[0042] (7)Yuanpeng Fang,Bingqian Zhou,Yushan Guo,Junmei Jiang,Xiangyang Li,Xin Xie*.Comparative transcriptome analysis reveals the core molecularnetwork in pattern-triggered immunity in Sorghum bicolor.InternationalJournal ofBiological Macromolecules,2023,242:124834 etc.

[0043] The technical solutions of the present invention will be further elaborated in detail below in conjunction with the embodiments.

[0044] Example 1

[0045] 1PVY infection induces NbClpT2 expression

[0046] During plant virus infection of the host, changes in host cell protein expression often accompany the response to viral invasion. We inoculated *N. tabacum* var. *xanthi* with a PV-GFP infectious clone, using the pulp of diseased leaves as the virus source, and then rubbed the inoculation with wild-type *N. benthamiana* (https: / / www.sciencedirect.com / science / article / pii / S0168170219307609, etc.). The results are as follows: Figure 1 As shown in the figure. The results showed that the appearance of green fluorescent signals on tobacco leaves 4 days after inoculation indicated the beginning of PVY accumulation. The green fluorescent signals gradually intensified 6-10 days after inoculation, and GFP fluorescence gradually diffused from the inoculated leaves to the system leaves (new terminal leaves), where it accumulated in large quantities. Figure 1 ).

[0047] To detect the accumulation of PVY, qRT-PCR was used to quantitatively detect the CP gene in samples at different time points after inoculation using PVY CP gene-specific primers (PVY-CP-F: GATGAAATGGGCTTATGGTTTGGTG (SEQ ID NO.2); PVY-CP-R: GATTTTGCCTAAGGGTTGGTTTCG (SEQ ID NO.3)). The results are as follows: Figure 2 As shown. The results showed that the expression of the CP gene increased significantly with prolonged infection time. Figure 2 A). To further confirm the accumulation of PVY protein, we used a PVY CP protein-specific antibody (Shanghai Youlong Biotechnology Co., Ltd., catalog number EC0224-46#) to detect the virus. Consistent with the fluorescence observation results, under the same sample loading amount, the PVY CP band gradually deepened with the extension of infection time, indicating that the viral load gradually increased. Figure 2 B).

[0048] 2. Proteomic analysis of PVY-infected *Nymphaea benthamiana*

[0049] To reveal the potential resistance mechanism in the PVY-N. benthamiana interaction, we investigated the proteomic changes in Sorghum bicolor seedlings before and after PVY infection. Label-free protein quantification methods (such as Acetyl-Proteomic Profiling of Sorghum bicolor Seedlings after Chitin Treatment Reveals the Involvement of Acetylated Chlorophyll a / b Binding Proteins in the Innate Immune Response) were used, and the reproducibility of protein quantification was assessed using relative standard deviation. Results are as follows: Figure 3 As shown, the relative standard deviations of all samples were less than 0.1, indicating good reproducibility of the tested samples. This study identified 55,716 peptides and 9,326 proteins, of which 7,562 proteins were successfully quantified. Using PBS treatment as a control, each treatment was repeated three times. PCA analysis results for samples from each treatment showed good reproducibility among samples from the same treatment. Figure 3 A) Further analysis revealed that multiple ATP-dependent Clp protease family members were upregulated after PVY infection, with NbClpT2 (ATP-dependent Clp protease subunit T2) showing the most significant upregulation. Figure 3 BC). To clarify the potential functions of differentially expressed proteins, enrichment analysis was performed. GO analysis showed that differentially expressed proteins were mainly enriched in chloroplasts and light signal transduction-related subunits, such as plasmidpyruvate dehydrogenase complex, plasmidlarge ribosomal subunit, and response to light intensity. Figure 3 D). Similarly, KEGG is also enriched in the chloroplast metabolism-related pathways Porphyrin and chlorophyll metabolism (D). Figure 3 E) indicates that chloroplast-related elements play an important role in tobacco's response to PVY infection. Therefore, we selected the chloroplast protein NbClpT2 for further research.

[0050] We amplified the full-length NbClpT2 gene sequence (TransStart FastPfu FLyDNAPoLymerase) using Nicotiana benthamiana cDNA as a template via homology alignment. This sequence encodes 235 amino acids. To further validate the proteomic data, we reverse transcribed samples from PVY-inoculated Nicotiana benthamiana (0, 4, 6, 8, 10 days) and then detected NbClpT2 gene expression using qRT-PCR. Results... Figure 4 As shown. The results showed that, compared with the control (inoculated with 1×PBS buffer), the expression of the NbClpT2 gene in the experimental group was significantly upregulated after 4 and 6 days of PVY inoculation; at 8 and 10 days of inoculation, the expression of the NbClpT2 gene gradually decreased to the background level. Figure 4 The above results indicate that PVY infection can significantly induce the expression of the NbClpT2 gene, suggesting that it may play an important role in tobacco's defense against PVY infection.

[0051] The full-length sequence of the NbClpT2 gene is as follows (SEQ ID NO.1):

[0052] ATGGCTGCTCTCTCCACAGTGGCAGCCACTTCAAATGGCATCAACCAGCTCAATTACAGAGTAGGACCCAATTCGTCTATCTGTACAACAAACCCACAAAATTTGCATAGTCAATGGCTTGGTACTCCAATCAAAATCTCTCTTCAGTCCAACAATTTCAAACCATTTCTTACAAAACATTGCCCCATTAAAGCTACTGTCTCCTTTAGCCTTCCTTATGGGAAGTCAGAGGCTGCAGTATCTGCAGAGAAAATTCCTAAATGGTCGTCAAAGGCGATAAAATCATTTGCCATGGGTGAATTGGAAGCAAGAAAACTTAAATATCCCACTACTGGAACAGAAGCTCTTCTCATGGGAATTTTGATTGAAGGGACAAATTTTGCTTCAAAATATTTGAGGGCGAACAGCATTACTCTCTTTAAAGTACGTGAAGAAACTATCAAAGTACTTGGAAAAGCTGACATGTGGTTTTTCAGTCCCGAGCATCCTCCTTTGACTGAAGATGCACAAAAGGCTCTTGATTGGGCACTTGATGAAAAACTCAAATCCAGTGACAATGGGGAAATTACAACTACTCATTTGCTCCTTGGGGTGTGGTCACAAGTAGGATCACCAGGTTATAAGATATTGTCTGCATTGGGCTTTAATGATGAAAAAGCTCAAGAGTTGAAGAATGTAATTTCAGAACCTGGTTTTGTGGATGATTAA

[0053] Silencing of NbClpT2 gene promotes the infection of PVY

[0054] To investigate the role of NbClpT2 in PVY infection, we systematically silenced the NbClpT2 gene in *Nicotiana benthamiana* using TRV (Tobacco rattle virus)-mediated gene silencing (VIGS) technology. Subsequently, we inoculated the leaves of the silenced plants with PVY-GFP and analyzed the infection status. We designed NbClpT2 gene silencing-specific primers (Sol genomics Network, NbClpT2-TRV2-F: CACTTCAAATGGCATCAACC (SEQ ID NO.4); NbClpT2-TRV2-R: ATGGCAAATGATTTTATCGC (SEQ ID NO.5)), amplified the fragment, and constructed the fusion expression vector pTRV2:NbClpT2. The results are as follows: Figure 5 As shown in A-5B. The results showed that 12 days after co-transformation of tobacco leaves with pTRV1, the leaves and new leaves of the control group (pTRV1+pTRV2:NbPDS) system showed whitening, indicating that the silencing effect of this experiment was good. In addition, there was no significant difference in plant growth between the control group and the experimental group, indicating that NbClpT2 does not participate in the regulation of plant growth. Figure 5 A). Simultaneously, systemic leaves from both the control group (pTRV1+pTRV2:GUS) and the experimental group were collected, and the silencing efficiency of NbClpT2 was detected by qRT-PCR. The results showed that, compared with the control, the expression of the NbClpT2 gene was significantly downregulated, with a silencing efficiency reaching 90%. Figure 5 B).

[0055] Next, we inoculated the leaves of NbClpT2 gene-silenced plants and control plants with PVY-GFP and observed the GFP fluorescence signal at different time points (4, 6, 8, 10 days) after infection using ultraviolet light. The results are as follows: Figure 5 As shown in Figure C. The results showed that 4 days after PVY inoculation, the experimental group plants exhibited GFP fluorescence in their leaves, while the control group plants showed no fluorescence; as the inoculation time progressed, the fluorescence brightness and intensity of the NbClpT2-silenced plants were higher than those of the control group (…). Figure 5 C).

[0056] We extracted samples from the above-mentioned treatment times, reverse transcribed them, and then used qRT-PCR to detect the expression of the PVY CP gene. The results are as follows: Figure 5 As shown in D. The results showed that PVY CP gene expression was significantly higher in the silencing NbClpT2 group than in the control group, peaking at 8 days post-inoculation and then declining. Figure 5 D).

[0057] We further employed the Western blot method, using a PVY CP-specific antibody to detect the virus, and the results were as follows: Figure 5 As shown in Figure E. The results showed that, consistent with qRT-PCR and fluorescence observation, under the same loading amount, the PVY CP band gradually intensified, especially accumulating more in NbClpT2 silenced plants. Figure 5 E).

[0058] For details of the methods used in the above experiments, please refer to "Superoxide dismutase positively regulates Cu / Zn toxicity tolerance in Sorghum bicolor by interacting with Cu chaperone for superoxide dismutase". Journal of Hazardous Materials, 2024, 480: 135828, etc.

[0059] These results suggest that NbClpT2 may play a positive regulatory role in the process of plant resistance to viral infection.

[0060] Construction and phenotypic analysis of 4NbClpT2 overexpression lines

[0061] Next, we stably overexpressed NbClpT2 in Nicotiana benthamiana and analyzed the DNA, transcription, and protein levels of the T3 generation transgenic plants. The results are as follows: Figure 6 As shown. The results showed that the specific primers (PVY-CP-F: GATGAAATGGGCTTATGGTTTGGTG (SEQ ID NO. 6); PVY-CP-R: GATTTTGCCTAAGGGTTGGTTTCG (SEQ ID NO. 7)) could amplify the NbClpT2 band ( Figure 6 A) Further analysis using HA-tagged antibodies to detect the expression of NbClpT2 protein in transgenic lines revealed specific NbClpT2 bands in all four candidate lines: OE2-5 and OE6-1, OE8-2 and OE12-3. Figure 6 B) indicates that NbClpT2 was successfully overexpressed in tobacco. We selected two lines with strong protein expression, OE8-2 and OE12-3, for gene expression analysis. qRT-PCR results showed that the expression of the NbClpT2 gene in the OE8-2 and OE12-3 lines was significantly higher than that in the wild type (B). Figure 6 C), therefore it can be used for the next step of phenotypic determination.

[0062] The results observed under a UV lamp after PVY infection are as follows: Figure 7As shown. The results showed that, compared with the wild-type control, the GFP brightness on NbClpT2 overexpressing plants OE8-2 and OE12-3 was lower ( Figure 7 A). Further analysis of PVY CP gene expression revealed that the expression level of PVY CP gene in overexpressing plants was significantly lower than that in the control group. Figure 7 B) indicates that the PVY virus content is lower, suggesting that it is more resistant to disease.

[0063] Construction and phenotypic analysis of 5NbClpT2 gene-edited lines

[0064] To further verify the anti-PVY function of NbClpT2, we constructed a mutant line of the NbClpT2 gene using the CRISPR-Cas9 system (Jansing J, Sack M, Augustine SM, et al. CRISPR / Cas9-mediated knockout of six glycosyltransferase genes in Nicotiana benthamiana for the production of recombinant proteins lacking β-1,2-xylose and coreα-1,3-fucose[J]. Plant Biotechnology Journal, 2019, 17(2): 350-361). The first 20 bp of TGG at the 5' end of the first exon of the NbClpT2 coding region was selected as the target sequence ( Figure 8 A,ATTTGAAGTGGCTGCCACTG (SEQ ID NO.8) was used to construct the Cas9-NbClpT2 vector, which was then transformed into Nicotiana benthamiana to obtain transgenic knockout plants. Single-plant DNA was extracted from the transgenic plants and amplified using specific primers (NbclpT2_JNT4074-A1-F1: TATCATCTCATCATCCCAACC (SEQ ID NO.9) NbclpT2_JNT4074-A1-R1: AACCCTTATCCATAGACAAACA (SEQ ID NO.10)) and detected using gel electrophoresis. Figure 8 B), the corresponding positive clones were then sequenced, yielding two independent T3 generation mutant lines: CRISPR-nbclpt2-3-4 (2 nucleotide deletions) and CRISPR-nbclpt2-7-5 (7 nucleotide deletions). Both nucleotide changes resulted in frameshift mutations in the corresponding amino acid sequences. Figure 8 C).

[0065] The observation results after PVY infection under ultraviolet light are as follows: Figure 9 As shown. The results showed that, compared with the wild-type control, the GFP brightness was higher in the two CRISPR-nbclpt2 mutant lines ( Figure 9 A). Further analysis of PVY CP gene expression revealed that the expression level of PVY CP gene in the mutant line was significantly higher than that in the control group. Figure 9 B) indicates that they are more susceptible to disease.

[0066] 6NbClpT2 enhanced flg22 / Chitin-induced ROS bursts

[0067] To examine whether NbClpT2 affects the PTI (pathogen-associated molecular patterns-triggered immunity) signaling pathway in plants, we treated leaves of wild-type (WT), NbClpT2-overexpressing (NbClpT2-OE8-2), and knockout (nbclpt2-CRISPR3-4) plants with the PAMP molecules flg22 and chitin, respectively, and then examined ROS bursts. The results are as follows: Figure 10 As shown in the figure. The results showed that both flg22 and chitin treatments induced ROS accumulation in leaves compared to the water control (mock). Interestingly, flg22 significantly induced ROS accumulation in NbClpT2 overexpression lines compared to the wild type, while the ROS burst intensity induced by flg22 was suppressed in the nbclpt2 knockout mutant. Figure 10 A). Similarly, after chitin treatment, the accumulation of ROS in NbClpT2 overexpressing plants was higher than that in wild-type and nbclpt2 knockout mutants. Figure 10 B). The above results indicate that NbClpT2-mediated PVY resistance requires the participation of ROS.

[0068] 7NbClpT2 enhanced the expression of genes related to resistance to Nicotiana benthamiana.

[0069] To further determine the impact of NbClpT2 on plant disease resistance signaling pathways, we used qRT-PCR to detect the expression of disease-related genes NbPR1 and NbPR2, PTI marker genes NbAcre31 and NbCYP71D20, and salicylic acid marker genes NbPR1a and NbNPR1 in wild-type (WT), NbClpT2 overexpression (NbClpT2-OE8-2), and knockout mutant (nbclpt2-CRISPR3-4) after PVY inoculation. The results are as follows: Figure 11As shown in A-11D. The results showed that PVY infection could induce the expression of disease-related genes NbPR1 and NbPR2, and their accumulation in NbClpT2 overexpressing plants was significantly higher than that in WT and NbClpT2 knockout mutants. Figure 11 Similarly, compared with wild-type and mutant controls, the accumulation levels of PTI marker genes NbAcre31 and NbCYP71D20 in NbClpT2 overexpressing plants were highest at 4-6 days after PVY infection. Figure 11 CD).

[0070] We further tested the expression of the SAmarker gene (using the same method as above), and the results are as follows: Figure 11 As shown in E-11F. The results are consistent with the previous results; the expression of NbPR1a and NbNPR1 was significantly increased in NbClpT2 overexpressing plants, while their expression was suppressed in NbClpT2 knockout mutants. Figure 11 These results suggest that NbClpT2 may enhance resistance to PVY in Nicotiana benthamiana by inducing the expression of disease-related genes, PTI, and SA, among other disease resistance signaling pathway genes.

[0071] 8NbClpT2 enhances the accumulation of SA in Benn's smoke.

[0072] The results above show that NbClpT2 can induce the expression of SA marker genes NbPR1a and NbNPR1. Figure 11 Next, we further investigated whether it would also induce SA accumulation in plants. The SA content in leaves of wild-type (WT), NbClpT2 overexpression (NbClpT2-OE8-2), and knockout mutant (nbclpt2-CRISPR3-4) after PVY inoculation was measured using UPLC-MS / MS. The results are as follows: Figure 12 As shown in the figure. The results showed that the SA content in all groups of plants increased 4 days after PVY infection, but the highest SA accumulation was observed in the NbClpT2 overexpressing plants, reaching 107.1 μg / g, while the lowest accumulation was observed in the NbClpT2 knockout mutant, at only 22.1 μg / g. Figure 12 This indicates that NbClpT2 can enhance the accumulation of SA in Benedict's tobacco.

[0073] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. The application of the NbClpT2 gene in tobacco resistance to Potato virus Y (PVY) infection, characterized in that, The nucleotide sequence of the NbClpT2 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, In the application described, the NbClpT2 gene positively regulates tobacco resistance to PVY infection.

3. The application according to claim 2, characterized in that, In this application, tobacco resistance to PVY infection is achieved by increasing the expression level of the NbClpT2 gene.

Images