Breeding method for screening early generation of wheat through molecular marker

Abstract

The invention discloses a breeding method for screening early generations of wheat through molecular markers. The method comprises the following steps: detecting and planting parents; f1 is planted and selected; planting and selecting F2; planting and selecting F3; f4, planting and selecting; f5, planting and selecting; planting F6, and screening to obtain a stable and high-yield new strain suitable for early sowing. Molecular marker detection is carried out in parents, F2 and F3, and the selection accuracy is improved. The parents are planted at low density, the disease resistance, tillering potential, yield potential, plant type and other characters of the parents are determined, and the utilization value of the prepared hybrid combination is clearer. According to the method, F2 and F3 are subjected to molecular marker detection, individuals containing target genes can be accurately selected, meanwhile, individuals without the target genes can be accurately eliminated, the selection efficiency is improved, whether wheat can be sown in early October or not is determined by the existence of the target genes, and high yield is achieved; the method provided by the invention can be used for quickly and accurately selecting'early-sowing and early-maturing 'excellent wheat which can be sown in the first ten days of October.

Description

Technical Field

[0001] The present application relates to the technical field of wheat breeding, and in particular to a breeding method for screening early generations of wheat by molecular markers. Background Art

[0002] Wheat is one of the most important food crops in the world. Improving wheat yield and quality is of vital importance to ensuring global food security. Traditional wheat breeding methods mainly rely on phenotypic selection, but this method has problems such as long cycle and low efficiency, and is greatly affected by environmental factors. In addition, the wheat genome is large, with more than 100,000 genes. The types of individual plants in its early separation generation are very rich, and the separation population is very large. Using traditional wheat breeding methods to screen is likely to miss individuals containing target genes. With the development of molecular biology technology, molecular marker-assisted breeding technology has brought new opportunities for wheat breeding. Molecular markers can directly reflect genetic differences, are not affected by the environment, and can accurately screen out individuals containing target genes in early generations with rich variant types, thereby improving the accuracy of selection.

[0003] Sichuan Province is an important wheat producing area in my country. It has complex terrain and an ecological climate characterized by "spring temperature higher than autumn temperature, dry winter and rainy summer, many clouds, heavy fog and humidity, and little sunshine". The heat conditions are "three crops are insufficient, two crops are more than enough". Sichuan's current planting system is mainly "rice and wheat two-cropping system (referred to as two-cropping system)". This planting system currently has obvious drawbacks, that is, rice is transplanted into the field after wheat is harvested in mid-to-early May, and harvested in September, while traditional wheat varieties can only be sown in late October to early November due to their light and temperature response characteristics. If sown in advance, they will ear early, and may encounter late spring cold, resulting in reduced production or even no harvest. Therefore, the land will have nearly two months of idle time, resulting in a serious waste of light, heat and water resources. Summary of the invention

[0004] In view of this, the present application provides a breeding method for screening early generations of wheat through molecular markers, aiming to quickly and accurately select "early sowing and early maturing" wheat that can be sown in early October, so as to improve the current situation in Sichuan where wheat can only be sown from the end of October to the beginning of November, leaving the land idle for nearly two months, resulting in a serious waste of light, heat and water resources.

[0005] The embodiment of the present application is implemented as follows: a breeding method for screening early generations of wheat by molecular markers, comprising:

[0006] Parent detection and planting: obtain parent molecular marker detection results, sow parents, prepare hybrid combinations, and harvest F 1 seed;

[0007] F 1Planting and selection: Planting F 1 , harvest F 2 seed;

[0008] F 2 Planting and selection: Planting F 2 , for F 2 Molecular marker detection was performed to screen for F 3 seed;

[0009] F 3 Planting and selection: Planting F 3 , for F 3 Molecular marker detection was performed to screen for F 4 seed;

[0010] F 4 Planting and selection: Planting F 4 , screen and obtain F 5 seed;

[0011] F 5 Planting and selection: Planting F 5 , F 5 Continue to select and purify, and screen to obtain F 6 seed;

[0012] Planting F 6 , screen and obtain new varieties with stable high yield and suitable for early sowing.

[0013] Optionally, in some embodiments of the present application, the method for obtaining the results of parental molecular marker detection includes: sampling wheat plants at the three-leaf stage, extracting DNA using the CTAB method, and verifying the wheat plants using molecular markers tightly linked to the photoperiod genes Ppd-D1b and Ppd-D1a, wherein the upstream and downstream primers of Ppd-D1b are Ppd-D1F: ACGCCTCCCACTACACTG;

[0014] Ppd-D1R1: TGTTGGTTCAAACAGAGAGC, the upstream and downstream primers of Ppd-D1a are Ppd-D1F: ACGCCTCCCACTACACTG; Ppd-D1R2:

[0015] CACTGGTGGTAGCTGAGATT, PCR amplification was performed, and the amplified products were separated by agarose gel electrophoresis. The band pattern of the molecular marker was observed. The presence of a band at 288 bp indicated that the material contained the Ppd-D1a gene, and the presence of a band at 414 bp indicated that the material contained the Ppd-D1b gene.

[0016] Optionally, in some embodiments of the present application, the hybrid combination is prepared to include one parent containing the photoperiod-sensitive gene Ppd-D1b and the other parent containing the photoperiod-insensitive gene Ppd-D1a.

[0017] Optionally, in some embodiments of the present application, the hybrid combination is prepared including two parents that both contain the photoperiod-sensitive gene Ppd-D1b.

[0018] Optionally, in some embodiments of the present application, the spacing between parents when sowing is 40 cm-60 cm.

[0019] Optionally, in some embodiments of the present application, the different parents include one or more of Chuannong 32, Chuannong 19, Neimai 416, Chuannong 30, and Hanlumai No. 1.

[0020] Optionally, in some embodiments of the present application, the sowing period of the parent containing the Ppd-D1b gene is in early October; and / or

[0021] The sowing period of the parent containing the Ppd-D1a gene is from late October to early November; and / or

[0022] Plant F in late October every year 1 ; and / or

[0023] Planting F in mid-October every year 2 ; and / or

[0024] Planting F in early October every year 3 ; and / or

[0025] Planting F in early October every year 4 ; and / or

[0026] Planting F in early October every year 5 .

[0027] Optionally, in some embodiments of the present application, for a hybrid combination in which one parent contains the photoperiod-sensitive gene Ppd-D1b and the other parent contains the photoperiod-insensitive gene PpdD1a, 2 The molecular marker detection is carried out in the first generation. After the wheat three-leaf stage, individual plants are sampled and DNA is extracted. Each wheat plant is numbered during sampling. The molecular marker is used to detect the allelic variation gene of the Ppd-D1 gene of each wheat plant. The method for detecting the allelic variation gene of the Ppd-D1 gene of each wheat plant using molecular markers is the same as the method for obtaining the molecular marker detection results of the parent. 2 Homozygous individuals containing only Ppd-D1b and heterozygous individuals containing both Ppd-D1b and Ppd-D1a were retained, and individuals without Ppd-D1b were eliminated.

[0028] Optionally, in some embodiments of the present application, F 2 The seeds were germinated indoors, and the leaf DNA was extracted for Ppd-D1 gene detection. The homozygous individuals containing only Ppd-D1b and the heterozygous individuals containing both Ppd-D1b and Ppd-D1a were transplanted to the field and harvested after maturity. 3 seed.

[0029] Optionally, in some embodiments of the present application, F 3 The heterozygous F 2 The plants are tested for molecular markers. After the wheat three-leaf stage, individual plants are sampled and DNA is extracted. Each wheat plant is numbered during sampling. The allele variation gene of the Ppd-D1 gene of each wheat plant is detected using molecular markers. The method for detecting the allele variation gene of the Ppd-D1 gene of each wheat plant using molecular markers is the same as the method for obtaining the molecular marker detection results of the parent. 3 Homozygous individuals containing only Ppd-D1b were retained, and individuals without Ppd-D1b and heterozygous individuals containing both Ppd-D1b and Ppd-D1a were eliminated.

[0030] In the present invention, in the parent, F 2 and F 3 Molecular marker detection was performed in the experiment, which improved the accuracy of selection. The parents were planted at low density to determine their disease resistance, tillering potential, yield potential, plant type and other traits, which further clarified the utilization value of the hybrid combination. 1 All individuals have the same genotype, so no screening or molecular marker testing is required. 2 At the beginning, the plant will undergo gene separation, recombination and exchange, with rich variation types. As the generations increase, the proportion of homozygotes will also increase, which will have an impact on F 2 and F 3 Molecular marker detection can accurately select individuals containing the target gene and accurately eliminate individuals without the target gene, thereby improving the efficiency of selection. The method of the present invention can quickly and accurately select "early sowing and early maturing" wheat that can be sown in early October. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For those skilled in the art, other drawings can be obtained based on these drawings without paying any creative work.

[0032] Figure 1 It is the result diagram of the vernalization gene molecular marker of some parent materials of the present invention;

[0033] Figure 2 This is a diagram showing the results of molecular markers of the Ppd-A1 and Ppd-B1 loci genes at the photoperiod of some parental materials of the present invention;

[0034] Figure 3 This is a diagram showing the molecular marker results of the Ppd-D1 locus gene of some parental materials of the present invention;

[0035] Figure 4 A flow chart of a breeding method for screening early generations of wheat by molecular markers according to the present invention;

[0036] Figure 5 For the present invention F 2 Field planting and hanging map;

[0037] Figure 6 For the present invention F 2 Detection results of Ppd-D1a and Ppd-D1b genes in some individual plants. DETAILED DESCRIPTION

[0038] The technical solutions in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without making creative work belong to the scope of protection of the present application. In addition, it should be understood that the specific implementation methods described herein are only used to illustrate and explain the present application, and are not used to limit the present application.

[0039] In this application, unless otherwise stated, directional words such as "upper" and "lower" generally refer to the upper and lower parts of the device in actual use or working state, specifically the drawing direction in the accompanying drawings; while "inner" and "outer" refer to the outline of the device. In addition, in the description of this application, the term "including" means "including but not limited to". The terms first, second, third, etc. are used only as labels and do not impose numerical requirements or establish an order.

[0040] In this application, "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can represent: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural.

[0041] In the present application, "at least one" means one or more, and "plurality" means two or more. "One or several", "at least one of the following" or similar expressions refer to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, c can be single or multiple, respectively.

[0042] Various embodiments of the present application may be presented in the form of a range; it should be understood that the description in the form of a range is only for convenience and brevity, and should not be understood as a rigid limitation on the scope of the present application; therefore, the range description should be considered to have specifically disclosed all possible sub-ranges and single numerical values ​​within the range. For example, the range description from 1 to 6 should be considered to have specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as single numbers within the range, such as 1, 2, 3, 4, 5 and 6, which apply regardless of the range. In addition, whenever a numerical range is indicated herein, it is meant to include any cited number (fractional or integer) within the indicated range.

[0043] Vernalization and photoperiod phenomena are the main factors affecting the transition from heading to flowering in wheat, and are closely related to the adaptability of wheat. The temperature and light development of wheat is regulated by four major vernalization genes VRN-1, VRN-2, VRN-3 and VRN-4, and three photoperiod genes Ppd-D1, Ppd-B1 and Ppd-A1. VRN-1, VRN-3 and VRN-4 genes synergistically promote heading and flowering of wheat, while Vrn-2 gene inhibits heading and flowering. The dominant and recessive composition of these four genes jointly regulates the heading period and winter-spring nature of wheat. VRN-1 gene has three alleles, Vrn-A1, Vrn-B1 and Vrn-D1. Current studies have found that Vrn-A1 gene has 6 allele variations, Vrn-A1a, Vrn-A1b, Vrn-A1c, Vrn-A1d, Vrn-A1e and vrn-A1. The Vrn-B1 gene has five allelic variations: vrn-B1, Vrn-B1a, Vrn-B1b, Vrn-B1c and Vrn-B1d. The Vrn-D1 gene has 5 allelic variations: Vrn-D1a, Vrn-D1b, Vrn-D1c, Vrn-D1s and vrn-D1; the VRN-2 gene is composed of Vrn-A2, Vrn-B2 and Vrn-D2; the VRN-3 gene has 6 allelic variations: Vrn-B3a, Vrn-B3b, Vrn-B3c, Vrn-B3d, Vrn-B3e and vrn-B3; the allelic variation and gene function of the VRN-4 gene are currently less studied. The Ppd-A1 gene has two allelic variations: Ppd-A1b and Ppd-A1a. The Ppd-B1 gene has two allelic variations: Ppd-B1b and Ppd-B1a. The Ppd-D1 gene has two main alleles, Ppd-D1b and Ppd-D1a. Previous researchers have developed molecular markers corresponding to these genes, which can accurately and quickly identify whether wheat individuals carry the relevant genes.

[0044] The technical solution of this application is as follows:

[0045] See also Figure 4 The present application provides a breeding method for early wheat generations by molecular marker screening, comprising:

[0046] S01, Parent detection and planting: Obtain parent molecular marker detection results, sow parents, prepare hybrid combinations, and harvest F 1 seed;

[0047] S02, F 1 Planting and selection: Planting F 1 , harvest F 2 seed;

[0048] S03, F 2 Planting and selection: Planting F 2 , for F2 Molecular marker detection was performed to screen for F 3 seed;

[0049] S04, F 3 Planting and selection: Planting F 3 , for F 3 Molecular marker detection was performed to screen for F 4 seed;

[0050] S05, F 4 Planting and selection: Planting F 4 , screen and obtain F 5 seed;

[0051] S06, F 5 Planting and selection: Planting F 5 , F 5 Continue to select and purify, and screen to obtain F 6 seed;

[0052] S07, Planting F 6 , screen and obtain new varieties with stable high yield and suitable for early sowing.

[0053] In the present invention, in the parent, F 2 and F 3 Molecular marker detection was performed in the experiment, which improved the accuracy of selection. The parents were planted at low density to determine their disease resistance, tillering potential, yield potential, plant type and other traits, which further clarified the utilization value of the hybrid combination. 1 All individuals have the same genotype, so no screening or molecular marker testing is required. 2 At the beginning, the plant will undergo gene separation, recombination and exchange, with rich variation types. As the generations increase, the proportion of homozygotes will also increase, which will have an impact on F 2 and F 3 Molecular marker testing can accurately select individuals containing the target gene and accurately eliminate individuals without the target gene, thereby improving the efficiency of selection.

[0054] The selected wheat individuals bred by the breeding method of the present application contain the light-sensitive gene Ppd-D1b, and have a wide adaptability to sowing periods. The bred new wheat varieties are adapted to the climate and ecological conditions of the Sichuan Basin (light intensity, temperature periodic changes, moisture, soil conditions, etc.), and can meet the requirements of the Sichuan rice-wheat double-cropping system for early sowing and early maturity of wheat.

[0055] The breeding method of the present invention has wide adaptability and can be used for molecular marker breeding of other crops and other genes.

[0056] The molecular marker-assisted breeding method for wheat of the present invention can accurately select wheat in the early growth stage, greatly shorten the breeding cycle, and improve the breeding efficiency. Traditional breeding methods may require years of field planting and observation to screen out varieties with excellent traits, while the method of the present invention can perform preliminary screening of target traits at the seedling or seed stage, saving a lot of time and resources.

[0057] Through molecular marker selection, the genotype of wheat individuals can be accurately identified, avoiding the interference of environmental factors on phenotypic selection, and improving the accuracy and reliability of selection. For example, for some traits that are greatly affected by the environment, such as yield, which may fluctuate greatly in different years and regions, molecular markers can directly reflect the presence or absence of genes and are not affected by environmental changes, thereby more accurately predicting the genetic potential of wheat.

[0058] The present invention is a selection method for early generations of wheat through molecular marker screening. The selected wheat can be sown early and has a wide adaptability to sowing periods. It effectively solves the problem of improper connection between the previous and next crops in the rice-wheat double-cropping system under the unique climatic conditions of Sichuan. By extending the wheat growth period and increasing wheat yield, it actively responds to the Tianfu Granary Strategy and ensures national food security.

[0059] In the S01:

[0060] In some embodiments, 188 Sichuan wheat varieties (lines) were identified for vernalization genes and photoperiod genes by molecular markers. The results showed that the vernalization genes of these 188 materials were all vrn-A1+Vrn-D1+Vrn-D2+vrn-B3. For Vrn-B1, 177 wheats were vrn-B1 and 11 wheats were Vrn-B1. These 11 materials are all traditional Sichuan wheat varieties (lines), and the heading period is more sensitive to the sowing period, indicating that they have stronger spring characteristics, a later suitable sowing period, and are not the main type. The photoperiod genes Ppd-B1 and Ppd-A1 are also composed of Ppd-B1b+Ppd-A1b, and only the Ppd-D1 gene is different. The new "early sowing and early maturing" wheat line carries the wild-type variation (recessive allele) Ppd-D1b, which is sensitive to the photoperiod and requires the daylight to change from short to long (after December 22) to form flower primordia and start spikelet differentiation, and then head and flower in early to mid-March. Sichuan traditional wheat carries the mutant (dominant allele) Ppd-D1a, which is not sensitive to the photoperiod and can form flower primordia under the early light conditions of changing from long to short, start spikelet differentiation and head and flower early. Under early sowing conditions, it will head and flower early, resulting in reduced yield. Therefore, the presence or absence of the Ppd-D1b gene determines whether wheat can be sown in early October. The test results of some parental materials can be seen in Figure 1-Figure 3 , Figure 1 These are the results of the molecular markers of vernalization genes in some parental materials; Figure 2 The molecular marker results of the photoperiod PPD-A1 and PPD-B1 genes of some parental materials; Figure 3 The molecular marker results of Ppd-D1 gene of some parental materials are shown in the figure. The serial numbers represent 1. Sichuan Agricultural University 32; 2. Sichuan Agricultural University 19; 3. Neimai 416; 4. 23P54; 5. Hanlu Wheat No. 1; 6. Sichuan Agricultural University 27; 7. Sichuan Agricultural University 48; 8. Sichuan Agricultural University 38; 9. Sichuan Yu 35; 10. 20P136; 11. China Spring; 12. Hanlu Wheat No. 2; 13. Jinfeng Wheat 1001; 14. 20828-11; 15. Sichuan Yu 32; 16. Fan 37123; 17. Sichuan Agricultural University 30; 18. Mianyang 11; 19. 31966; 20. Zhongke Wheat 13; 21. Sichuan Wheat 93; 22. Shu Wheat 2139; 23. Hanlu Wheat No. 3; 24. 23P118.

[0061] It can be understood that only by testing the parents and early segregating generations with the molecular marker of the Ppd-D1 gene, their temperature and light response types and adaptability to early sowing can be distinguished, and selection can be made.

[0062] In some embodiments, a method for obtaining the results of parental molecular marker detection includes: sampling wheat plants at the three-leaf stage, extracting DNA using the CTAB method, and verifying the wheat plants using molecular markers tightly linked to the photoperiod genes Ppd-D1b and Ppd-D1a, wherein the upstream and downstream primers of Ppd-D1b are Ppd-D1F: ACGCCTCCCACTACACTG; Ppd-D1R1: TGTTGGTTCAAACAGAGAGC, and the upstream and downstream primers of Ppd-D1a are Ppd-D1F: ACGCCTCCCACTACACTG; Ppd-D1R2: CACTGGTGGTAGCTGAGATT, performing PCR amplification, separating the amplified products by agarose gel electrophoresis, and observing the banding patterns of the molecular markers. A band at 288 bp indicates that the material contains the Ppd-D1a gene, and a band at 414 bp indicates that the material contains the Ppd-D1b gene.

[0063] Furthermore, a hybrid combination is prepared including one parent containing the photoperiod-sensitive gene Ppd-D1b and the other parent containing the photoperiod-insensitive gene Ppd-D1a.

[0064] Further, the hybrid combination is prepared including two parents both containing the photoperiod-sensitive gene Ppd-D1b. It is understood that this avoids preparing a combination in which both parents do not contain the photoperiod-sensitive gene Ppd-D1b.

[0065] It can be understood that the photoperiod-sensitive gene Ppd-D1b is a recessive gene, and the photoperiod-insensitive gene Ppd-D1a is a dominant gene.

[0066] It can also be understood that when hybridization is performed, parents with different band types are selected, and the reasonable coordination of disease resistance, plant height, plant type, and yield level between the parents is considered at the same time, in order to increase the probability of the appearance of a single plant with multiple ideal trait combinations in its offspring. There are three situations for the selected hybrid combinations, namely: (1) both parents contain the photoperiod insensitive gene (dominant) Ppd-D1a; (2) both parents contain the photoperiod sensitive gene (recessive) Ppd-D1b; (3) one parent contains the photoperiod sensitive gene Ppd-D1b, and the other parent contains the photoperiod insensitive gene Ppd-D1a. The present invention selects the combination of (2) and (3), and can avoid the combination of (1) through molecular detection results, because this combination cannot select the temperature-light response type of wheat suitable for early sowing.

[0067] In some embodiments, the spacing between the parents during sowing is 40 cm-60 cm, for example, 40 cm, 42 cm, 45 cm, 46 cm, 48 cm, 50 cm, 52 cm, 55 cm, 56 cm, 58 cm, 60 cm, etc. Within this range, the competition between wheat individuals is not fierce, and the advantages of wheat individuals can be more fully demonstrated, such as tillering ability, plant height, ear length, and plant type.

[0068] In some embodiments, the different parents include one or more of Chuannong 32, Chuannong 19, Neimai 416, Chuannong 30, and Hanlumai No. 1.

[0069] In some embodiments, the sowing date of the parent containing the Ppd-D1b gene is in early October, which can be around October 10, or can be advanced to around October 1.

[0070] In some embodiments, the sowing period of the parent containing the Ppd-D1a gene is from late October to early November. It can be understood that late October to early November is around October 31st.

[0071] It is understandable that different genotype parents are sown at different times, the main purpose of which is to make their flowering periods coincide, making it easier to prepare hybrid combinations.

[0072] In the S02:

[0073] In some embodiments, F. 1 .

[0074] It is understandable that since Ppd-D1b is a recessive gene, 1 No performance, F 1 The individual expresses the dominant gene Ppd-D1a, which is insensitive to photoperiod. If sown early, it will also ear early, so F 1 In addition, due to the F 1In a heterozygous state, without gene separation, recombination and exchange, the genetic material contained in each individual is basically the same, so F 1 No molecular marker testing or selection is required.

[0075] In said S03:

[0076] In some embodiments, F. 2 .

[0077] Understandable, F. 2 The planting amount should be large.

[0078] Understandably, with F 1 In comparison, F 2 Some gene separation, recombination and exchange have occurred, and there are also large differences between individuals. 2 In the first generation, individuals with recessive homozygous Ppd-D1b account for only 1 / 4 of the entire population, and dominant individuals with Ppd-D1a that are insensitive to photoperiod (including 1 / 4 dominant homozygous individuals and 1 / 2 dominant heterozygous individuals) account for 3 / 4 of the entire population, so F cannot be sown too early. 2 .

[0079] In some embodiments, for a hybrid combination in which one parent contains the photoperiod-sensitive gene Ppd-D1b and the other parent contains the photoperiod-insensitive gene Ppd-D1a, 2 The molecular marker detection is carried out in the first generation. After the wheat three-leaf stage, individual plants are sampled and DNA is extracted. Each wheat plant is numbered during sampling. The molecular marker is used to detect the allelic variation gene of the Ppd-D1 gene of each wheat plant. The method for detecting the allelic variation gene of the Ppd-D1 gene of each wheat plant using molecular markers is the same as the method for obtaining the molecular marker detection results of the parent. 2 Homozygous individuals containing only Ppd-D1b and heterozygous individuals containing both Ppd-D1b and Ppd-D1a were retained, and individuals without Ppd-D1b were eliminated.

[0080] It can be understood that in a hybrid combination where both parents contain the photoperiod-sensitive gene Ppd-D1b, since both are the desired target gene, Ppd-D1b, this type of wheat does not require molecular marker screening.

[0081] In some embodiments, F 2 The seeds were germinated indoors, and the leaf DNA was extracted for Ppd-D1 gene detection. The homozygous individuals containing only Ppd-D1b and the heterozygous individuals containing both Ppd-D1b and Ppd-D1a were transplanted to the field and harvested after maturity. 3 seed.

[0082] In said S04:

[0083] In some embodiments, F. 3 .

[0084] In some embodiments, F 3 The heterozygous F 2 The plants are tested for molecular markers. After the wheat three-leaf stage, individual plants are sampled and DNA is extracted. Each wheat plant is numbered during sampling. The allele variation gene of the Ppd-D1 gene of each wheat plant is detected using molecular markers. The method for detecting the allele variation gene of the Ppd-D1 gene of each wheat plant using molecular markers is the same as the method for obtaining the molecular marker detection results of the parent. 3 Homozygous individuals containing only Ppd-D1b were retained, and individuals without Ppd-D1b and heterozygous individuals containing both Ppd-D1b and Ppd-D1a were eliminated.

[0085] In said S05:

[0086] In some embodiments, F. 4 .

[0087] Understandably, compared to F 3 , F 4 The process of gene separation, recombination and exchange has been more complete, and the individual has basically stabilized and the possibility of further mutation has become smaller, so F 4 The key is selection. Screening is based on disease resistance, tillering ability, plant height, maturity, single plant yield, 1000-grain weight, and ear length.

[0088] In said S06:

[0089] In some embodiments, F. 5 .

[0090] It is understandable that due to the large number of wheat genomes, genes at other loci on the chromosome may still be in a heterozygous state. 5 The selection purification will continue.

[0091] In some embodiments, the performance of each plant's traits, such as plant height, tillering ability, disease resistance, ear length, maturity, 1000-grain weight, and single plant yield, is carefully observed, and single plants with target traits and excellent and uniform performance are selected to obtain F 6 seed.

[0092] In said S07:

[0093] It can be understood that since the strains have been obtained and a large number of seeds have been harvested from the strains, repetitive yield tests can be carried out, and yield identification under different sowing conditions can be carried out simultaneously.

[0094] In some embodiments, the process is repeated for two to three years to obtain new stable high-yielding lines suitable for early planting.

[0095] Application Example 1

[0096] 188 Sichuan wheat varieties (lines) were sown at three sowing dates (October 7, October 22, and November 5). The 188 materials included 102 Sichuan early-sown early-maturing wheat new varieties (lines) and 86 Sichuan traditional wheat varieties (lines). By investigating the heading period, it was found that the heading period of the "early-sown early-maturing" wheat in the three sowing periods could all be headed within the safe heading period of Sichuan wheat, and the number of days to head between the earliest and latest sown wheat was not much different. However, the heading period of Sichuan traditional wheat was advanced with the advance of the sowing period, and it could not head within the safe heading period under the condition of early sowing. The number of days to head between the earliest and latest sown wheat differed by about 40 days. The results of the wheat heading period survey are shown in Table 1, and the number of days of wheat heading period and the difference in the number of days of wheat heading period under different sowing periods are shown in Table 2.

[0097] Table 1 Heading date of some parental materials at different sowing dates

[0098]

[0099]

[0100] Note: In the name column, the a after the wheat name indicates that the wheat contains the light-insensitive gene PPD-D1a, and the b indicates that the wheat contains the light-sensitive gene PPD-D1b.

[0101] Table 2 The difference between the heading date and the heading date of some parents at different sowing dates

[0102]

[0103] Note: The a after the name indicates that the wheat contains the light-insensitive gene Ppd-D1a, and the b indicates that the wheat contains the light-sensitive gene Ppd-D1b

[0104] Vernalization genes and photoperiod genes were identified in these 188 Sichuan wheat varieties (lines). The results showed that the vernalization genes of these 188 materials were all vrn-A1+Vrn-D1+Vrn-D2+vrn-B3, but for Vrn-B1, 177 wheats were vrn-B1 and 11 wheats were Vrn-B1. These 11 materials were all traditional Sichuan wheat, and the heading period was advanced with the advancement of sowing date. The photoperiod genes Ppd-B1 and Ppd-A1 were also composed of Ppd-B1b+Ppd-A1b, and only the Ppd-D1 gene was different. The new "early sowing and early maturing" wheat line carries the wild-type mutation (recessive allele) Ppd-D1b, which is sensitive to photoperiod and requires long-day conditions to head and flower, but cannot head and flower under short-day conditions. Sichuan traditional wheat carries a mutant (dominant allele) Ppd-D1a, which is insensitive to photoperiod and can form flower primordia earlier, heading and flowering earlier. Under early sowing conditions, it will head and flower earlier, resulting in reduced yield. The above results show that the adaptability of wheat parents to early sowing is critical to high and stable yields, and this difference mainly comes from the difference in the Ppd-D1 gene, and has nothing to do with other genes.

[0105] Application Example 2

[0106] Mianyang 11 containing Ppd-D1a was selected for hybridization with 31966 containing Ppd-D1b. The genotype of the F1 produced by the hybridization was Ppd-D1a Ppd-D1b at this locus. Gene separation and recombination occurred in F2. The genotype of wheat at this locus in this generation was three combinations of Ppd-D1aPpd-D1a, Ppd-D1a Ppd-D1b, and Ppd-D1bPpd-D1b. This gene locus conforms to Mendel's law of segregation, and the phenotype of the offspring should be 1:2:1.

[0107] Because we need to 2 Molecular marker selection was performed to select the individual plants containing only the light-sensitive gene Ppd-D1b. In order to ensure that each plant was tested and the individual plants containing the target gene could be accurately identified during selection, the F 2 Planting should be done at low density and in large quantities. 2 When sampling, each individual plant must be numbered and labeled to ensure that the molecular marker test results correspond to the individual plants in the field. Figure 5 Some of the test results are as follows Figure 6 In the figure, 1 is the parent 31966, 2 is the parent Mianyang 11, 3-24 are F 2Among them, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 18, 19, 21 and 22 contained both Ppd-D1a and Ppd-D1b; 5, 16, 17 and 23 only contained Ppd-D1a; 14, 15, 20 and 24 only contained Ppd-D1b. According to the test results, we can only harvest wheat containing Ppd-D1b during harvest to improve the accuracy of selection.

[0108] Figure 6 Middle: M: 2000DL; 1: parent 31966; 2: parent Mianyang 11; 3-24 is F 2 Generation of single plants.

[0109] The above is a detailed introduction to a breeding method for screening early generations of wheat by molecular markers provided in the embodiments of the present application. Specific examples are used herein to illustrate the principles and implementation methods of the present application. The description of the above embodiments is only used to help understand the method of the present application and its core idea. At the same time, for technicians in this field, according to the ideas of the present application, there will be changes in the specific implementation methods and application scopes. In summary, the content of this specification should not be understood as a limitation on the present application.

Claims

1. A breeding method for early wheat generations by molecular marker screening, characterized in that: include: Parent testing and planting: obtain parent molecular marker test results, sow parents, prepare hybrid combinations, and harvest F1 seeds; Planting and selection of F1: Planting F1 and harvesting F2 seeds; Planting and selection of F2: Plant F2, perform molecular marker detection on F2, and screen to obtain F3 seeds; Planting and selection of F3: Plant F3, perform molecular marker detection on F3, and screen to obtain F4 seeds; Planting and selection of F4: Plant F4 and screen to obtain F5 seeds; Planting and selection of F5: Planting F5, further selecting and purifying F5, and screening to obtain F6 seeds; Plant F6 and screen for new lines with stable high yields suitable for early sowing.

2. The method for breeding early generations of wheat by molecular marker screening according to claim 1, characterized in that: The method for obtaining the detection results of parental molecular markers includes: sampling wheat plants at the three-leaf stage, extracting DNA using the CTAB method, and verifying the wheat plants using molecular markers closely linked to the photoperiod genes Ppd-D1b and Ppd-D1a, wherein the upstream and downstream primers of Ppd-D1b are Ppd-D1F: ACGCCTCCCACTACACTG; Ppd-D1R1: TGTTGGTTCAAACAGAGAGC, and the upstream and downstream primers of Ppd-D1a are Ppd-D1F: ACGCCTCCCACTACACTG; Ppd-D1R2: CACTGGTGGTAGCTGAGATT, performing PCR amplification, separating the amplified products by agarose gel electrophoresis, and observing the banding patterns of the molecular markers. A band at 288 bp indicates that the material contains the Ppd-D1a gene, and a band at 414 bp indicates that the material contains the Ppd-D1b gene.

3. The breeding method for early wheat generations by molecular marker screening according to claim 1, characterized in that: The hybrid combination was prepared to include one parent containing the photoperiod-sensitive gene Ppd-D1b and the other parent containing the photoperiod-insensitive gene Ppd-D1a.

4. The breeding method for early wheat generations by molecular marker screening according to claim 1, characterized in that: The hybrid combination was prepared including two parents both containing the photoperiod-sensitive gene Ppd-D1b.

5. The method for breeding early generations of wheat by molecular marker screening according to claim 1, characterized in that: The spacing between the parents when sowing is 40cm-60cm.

6. The breeding method for early wheat generations by molecular marker screening according to claim 1, characterized in that: The different parents include one or more of Chuannong 32, Chuannong 19, Neimai 416, Chuannong 30, and Hanlumai No.

1.

7. The breeding method for early wheat generations by molecular marker screening according to claim 2, characterized in that: The sowing date of the parent containing the Ppd-D1b gene is in early October; and / or The sowing period of the parent containing the Ppd-D1a gene is from late October to early November; and / or Planting F1 in late October each year; and / or Planting F2 in mid-October each year; and / or Planting F3 in early October each year; and / or Plant F4 in early October each year; and / or F5 is planted in early October every year.

8. The method for breeding early generations of wheat by molecular marker screening according to claim 3, characterized in that: For a hybrid combination in which one parent contains the photoperiod-sensitive gene Ppd-D1b and the other parent contains the photoperiod-insensitive gene PpdD1a, molecular marker detection is performed on the F2 generation. After the three-leaf stage of wheat, individual plant sampling is performed to extract DNA. Each wheat plant is numbered during sampling. The allele variation gene of the Ppd-D1 gene of each wheat plant is detected using molecular markers. The method for detecting the allele variation gene of the Ppd-D1 gene of each wheat plant using molecular markers is the same as the method for obtaining the molecular marker detection results of the parents. The F2 retains homozygous individuals containing only Ppd-D1b and heterozygous individuals containing both Ppd-D1b and Ppd-D1a, and eliminates individuals without Ppd-D1b.

9. The method for breeding early generations of wheat by molecular marker screening according to claim 3, characterized in that: The F2 seeds were germinated indoors, and after extracting leaf DNA for Ppd-D1 gene testing, homozygous individuals containing only Ppd-D1b and heterozygous individuals containing both Ppd-D1b and Ppd-D1a were transplanted into the field, and F3 seeds were harvested after maturity.

10. The method for breeding early generations of wheat by molecular marker screening according to claim 1, characterized in that: Molecular marker detection is performed on F3 generation plants from heterozygous F2. After the three-leaf stage of wheat, individual plant sampling is performed to extract DNA. Each wheat plant is numbered during sampling. Molecular markers are used to detect the allelic variation genes of the Ppd-D1 gene of each wheat plant. The method for detecting the allelic variation genes of the Ppd-D1 gene of each wheat plant using molecular markers is the same as the method for obtaining the molecular marker detection results of the parents. F3 retains homozygous individuals containing only Ppd-D1b, and eliminates individuals without Ppd-D1b and heterozygous individuals containing both Ppd-D1b and Ppd-D1a.

Images