Diflubenzuron / SPc / dsCHS multi-component composite pesticide and preparation method thereof

By combining insecticide, SPc and dsCHS in the insecticide, a multi-complex insecticide is formed, which solves the problems of environmental pollution and pest resistance of existing insecticides, and achieves efficient and compatible aphid control effects.

CN120092772AActive Publication Date: 2025-06-06BEIJING GANGDA LVAN ORGANIC AGRI TECH RES CENT
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
CN202510577574.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-07
Publication Date
2025-06-06
Estimated Expiration
2045-05-07

AI Technical Summary

Technical Problem

During the use of existing pesticides, there are problems of environmental pollution and enhanced pest resistance. Moreover, RNAi technology is difficult to achieve better prevention and control effects alone due to dsRNA being easily degraded and has low efficiency in single targets.

Method used

The multi-complex insecticide of syringae/SPc/dsCHS is used. The composite agent is incubated with syringae through the nanocarrier SPc and combined with dsCHS. The RNAi of dsCHS is used to silen the chitin synthetase gene of insects, thereby inhibiting the chitin synthesis of insects and achieving insecticidal effect.

Benefits of technology

The mortality rate of aphids has been significantly improved, from 46.67% to 82.22%. Through the multi-component collaborative delivery strategy, the dual linkage effect of "gene regulation + chemical intervention" has been achieved, which has improved prevention and control efficiency and reduced the impact on non-target insects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120092772A_ABST
    Figure CN120092772A_ABST
Patent Text Reader

Abstract

The invention provides a diflubenzuron / SPc / dsCHS multi-component composite insecticide and a preparation method thereof, the composite insecticide comprises a diflubenzuron / SPc complex and dsCHS, and the mass ratio of the dsCHS to SPc in the diflubenzuron / SPc complex is (0.1-5): 1; the nucleotide sequence of the dsCHS is as shown in SEQ ID NO. 1. CHS in the diflubenzuron / SPc / dsCHS multi-element composite pesticide is a chitin synthetase gene, after the diflubenzuron is treated, CHS gene expression of insects is increased to feed back reduction of chitin, after the dsCHS silences the chitin synthetase gene through RNAi, chitin synthesis of aphids is further destroyed, and the fatality rate of the aphids is increased to 82.22% from 46.67%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of insecticides, and in particular relates to a diflubenzuron / SPc / ds CHS Multi-component compound insecticide and preparation method thereof. Background Art

[0002] Faced with the limitations of traditional synthetic pesticides due to environmental pollution and increased pest resistance, there is an urgent need to reduce the use of chemical pesticides and delay the development of pest resistance. RNAi technology has become a revolutionary direction for green pesticides with its high specificity and low residual potential, but it is limited by the fact that dsRNA is easily degraded in insects and has low efficiency at single targets, making it difficult to achieve a good control effect alone. However, combining chemical pesticides with dsRNA can reduce the use of chemical pesticides while optimizing the control effect and reduce the impact on non-target insects. Among them, diflubenzuron inhibits the synthesis of chitin in the insect cuticle, causing the larvae to be unable to molt normally and eventually die. It relies on the molting process of insects, so compared with neurotoxic insecticides, its insecticidal speed is slower and cannot achieve rapid control of aphid populations. Although diflubenzuron mainly acts on chitin synthesis, high-dose application may have adverse effects on natural enemy insects (such as parasitic wasps and predatory insects). ds CHS It is highly specific and only targets the key genes of target pests without affecting non-target insects, thus improving the compatibility of biological control. Summary of the invention

[0003] In view of this, the present invention aims to overcome the defects in the prior art and proposes a diflubenzuron / SPc / ds CHS Multi-component compound insecticide and preparation method thereof.

[0004] To achieve the above object, the technical solution of the present invention is achieved as follows: The invention provides a diflubenzuron / SPc / ds CHS A multi-component compound insecticide comprising a diflubenzuron / SPc complex and ds CHS , the ds CHS The mass ratio of ds to SPc in the diflubenzuron / SPc complex is 0.1-5:1; CHS The nucleotide sequence is shown in SEQ ID NO.1.

[0005] Furthermore, the diflubenzuron / SPc complex is formed by incubating the nanocarrier SPc and diflubenzuron, and the mass ratio of the nanocarrier SPc to diflubenzuron is 0.5-3:1.

[0006] The present invention also provides a diflubenzuron / SPc / ds CHS The preparation method of the multi-component compound insecticide comprises the following steps: Step 1 is to incubate the nanocarrier SPc with diflubenzuron to obtain a diflubenzuron / SPc complex; Step 2 is to mix the diflubenzuron / SPc complex with ds CHS Incubate to obtain the diflubenzuron / SPc / ds CHS Multi-component compound insecticide.

[0007] Furthermore, the incubation step in step 1 is performed at a temperature of 20-35° C. and for a time of 1-30 minutes.

[0008] Furthermore, the incubation step in step 2 is performed at a temperature of 20-35° C. and for a time of 1-30 minutes.

[0009] The present invention provides a chitin synthesis inhibitor, wherein the inhibitor comprises 1-100% by mass of the diflubenzuron / SPc / ds CHS Multi-component compound insecticide.

[0010] The structure of star-shaped polycation (SPc) with both hydrophobic core and multi-functional hydrophilic shell not only improves the stability of dsRNA, but also realizes the dual linkage effect of "gene regulation + chemical intervention" through multi-component synergistic delivery strategy, significantly improving the prevention and control efficiency and reducing R&D costs. This technology system provides a new paradigm that combines high efficiency, sustainability and environmental friendliness to solve the industrialization problems of RNA pesticides through the multifunctional integration of nanocarriers and the spatiotemporal synergy of multiple active ingredients.

[0011] Compared with the prior art, the present invention has the following advantages: The diflubenzuron / SPc / ds CHS Multi-component insecticide CHS is a chitin synthase gene. After being treated with diflubenzuron, the CHS Gene expression is elevated in response to the reduction of chitin, in ds CHS Silencing the chitin synthase gene through RNAi will further disrupt the chitin synthesis of aphids, increasing their mortality rate from 46.67% to 82.22%. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 is an isothermal calorimetric diagram of the titration of SPc with diflubenzuron according to an embodiment of the present invention; Figure 2 The mortality rate of peach aphid after being treated with the insecticides diflubenzuron and diflubenzuron / SPc described in the embodiments of the present invention: wherein, Figure A is a root suction method, and Figure B is a backboard drip method; Figure 3This is the transcriptome analysis of green peach aphid after being treated with diflubenzuron and diflubenzuron / SPc complex as described in the embodiment of the present invention: wherein, Figure A is the expression of genes, Figures B and C are the gene pathways, and Figure D is the expression level of genes; Figure 4 The ds described in the embodiment of the present invention CHS Isothermal titration calorimetry results of titration of diflubenzuron / SPc: Figure A is the binding effect, and Figure B is the isothermal titration calorimetry result; Figure 5 The diflubenzuron, diflubenzuron / SPc and diflubenzuron / SPc / ds described in the embodiments of the present invention CHS Transmission electron micrographs of: A: Diflubenzuron, B: Diflubenzuron / SPc, C: Diflubenzuron / SPc / ds CHS ; Figure 6 The diflubenzuron / SPc / ds described in Example 1 of the present invention CHS Effects of multiple complexes on green peach aphid: Figure A is CHS Figure 1 shows the gene expression level, and Figure B shows the mortality rate. DETAILED DESCRIPTION

[0013] Unless otherwise defined, the technical terms used in the following examples have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. The test reagents used in the following examples, unless otherwise specified, are all conventional biochemical reagents; the experimental methods, unless otherwise specified, are all conventional methods.

[0014] For the preparation method of SPc, please refer to the article "A Facile-Synthesized Star Polycation Constructed as a Highly Efficient Gene Vector in Pest Management".

[0015] The present invention will be described in detail below with reference to the embodiments.

[0016] Example 1 Drug loading capacity and binding force of nanocarrier (SPc) for diflubenzuron After SPc was mixed and incubated with excess diflubenzuron, the mixed solution was dialyzed using a 20,000 dp dialysis bag to remove diflubenzuron that was not bound to the nanocarrier, to obtain the diflubenzuron / SPc complex, and the drug loading rate of SPc to diflubenzuron was calculated. Then, diflubenzuron and SPc were accurately added according to the drug loading rate, and incubated at room temperature for 15 min to obtain the diflubenzuron / SPc complex.

[0017] Isothermal titration calorimeter (ITC) was used to analyze the interaction between diflubenzuron and SPc. The specific operation was as follows: 250 μL of diflubenzuron (0.1 mM) was used to titrate 2 mL of SPc (0.01 mM) solution, and the isothermal titration microcalorimeter (TANANO) test conditions were set as follows: the detection temperature was 25°C, a total of 19 titrations, 10 μL of each injection, and one injection every 90 s. The titration data was processed using NanoAnalyzeTM software, and the titration data was fitted with the Independent model, and finally the thermodynamic parameters such as Ka, ΔH, and ΔS were obtained.

[0018] Diflubenzuron can spontaneously combine with SPc in aqueous solution to form a diflubenzuron / SPc complex. The drug loading rate measured by freeze-drying method was 31.1%. Isothermal titration calorimetry results showed (eg Figure 1 As shown in Figure 2), diflubenzuron has a higher binding coefficient Ka (M -1 ) is 6.85×10 4 , indicating that there is a strong interaction between the two. The entropy change ΔH is -9654 kcal / mol, and the function change ΔS is -32.3 kcal / mol / deg. According to the Gibbs free energy: ΔG=ΔH-TΔS, the Gibbs free energy ΔG of the interaction reaction between the two substances is calculated to be -23.76 kcal / mol, indicating that diflubenzuron and SPc can spontaneously combine. According to the ΔH and ΔS of the reaction, it can be inferred that the binding effect between diflubenzuron and SPc is mainly hydrogen bonding.

[0019] Example 2 Indoor biological activity determination of diflubenzuron / SPc complex The toxicity of diflubenzuron to green peach aphid was detected by the back plate drip method. Diflubenzuron reagents with concentrations of 5mg / L, 25mg / L, 50mg / L, 100mg / L, 200mg / L, and 500mg / L were prepared with the original drug, and the same concentration of DMSO was used as the control group to calculate the mortality rate within 3 days. Each treatment contained 30 green peach aphids, with a total of three biological replicates.

[0020] The toxicity of the diflubenzuron / SPc multi-complex to aphids was evaluated by the back plate drop method. The following treatments were set: water (control), SPc, diflubenzuron (LC 20 ) and diflubenzuron / SPc. Each treatment was fed to about 30 peach aphids, with 3 replicates in total. The mortality rate within 3 days was observed and recorded.

[0021] The root suction method was used to further evaluate the toxicity of the diflubenzuron / SPc multicomponent complex to aphids. The treatment groups and concentration settings were the same as above, and each group was treated with about 30 peach aphids, with 3 replicates, and the aphid mortality was recorded within 3 days.

[0022] After 3 days of treatment with diflubenzuron, the mortality of 3rd instar peach aphids was determined by toxicity test. The median lethal concentration (LC 50 ) is 92.107 mg / L, and the sublethal concentration (LC 20 ) is 21.866 mg / L (as shown in Table 1).

[0023] Table 1 Toxicity of diflubenzuron to Myzus persicae

[0024] The mortality rate of peach aphids was counted 3 days after the treatment with the diflubenzuron / SPc complex. It was found that the mortality rate of peach aphids caused by the dorsal dripping of diflubenzuron was 20.56%, and the mortality rate of peach aphids caused by the diflubenzuron / SPc complex reached 46.11%, which was 124.32% higher than that caused by the treatment with diflubenzuron alone. The mortality rate of peach aphids caused by the root suction method was 23.89%, and the mortality rate of peach aphids caused by the diflubenzuron / SPc complex reached 41.67%, which was 74.42% higher than that caused by the treatment with diflubenzuron alone. Figure 2 shown.

[0025] Example 3 Analysis of the lethal mechanism of green peach aphids treated with diflubenzuron Thirty peach aphids were treated with water and diflubenzuron, respectively, with three replicates for each treatment. Total RNA of peach aphids was extracted 24 h after treatment. The transcriptome library was constructed using the Illumina HiSeq sequencing platform, and the BLASTX and KEGG databases were used for alignment and annotation; the FPKM value was used to characterize the expression level of each transcript. DESeq was used to analyze the differentially expressed genes (DEGs) between different treatments, and the screening conditions were fold change ≥ 2.0 and FDR < 0.01, in order to further explore the molecular mechanism of the lethal effect of interference on peach aphids.

[0026] Transcriptome analysis revealed that the expression of 625 genes was significantly altered after diflubenzuron / SPc complex treatment compared with that after diflubenzuron treatment. A total of 476 genes were upregulated and 149 genes were downregulated (e.g. Figure 3 KEGG analysis revealed that DEGs can be divided into multiple gene pathways, such as fat digestion and absorption, hormone synthesis and metabolism, and stratum corneum formation (e.g. Figure 3 At the same time, we selected several differentially expressed genes to verify the accuracy of the transcriptome (see Figures B and C in the figure). Figure 3 D in Figure ).

[0027] The main target of diflubenzuron is the chitin synthesis pathway of insects. We found that the diflubenzuron / SPc complex was more effective than diflubenzuron alone in treating peach aphids, and found that the chitin synthetase gene (chitin synthetase, CHS ) was significantly upregulated ( Figure 3Chitin synthase is a key enzyme in the chitin synthesis pathway of insects. It is crucial for the synthesis of insect cuticles and affects a series of metamorphosis such as the formation of new cuticles and the shedding of old cuticles in insects. Therefore, further interference CHS Genes will further hinder the growth and development of peach aphids, affect the life activities of aphids, further affect the molting behavior of aphids, and ultimately lead to their death.

[0028] Example 4 ds CHS With diflubenzuron / SPc / ds CHS Synthesis of multi-component insecticides First, total RNA from each instar of P. persicae was extracted using an RNA extraction kit (Quanshijin, China), and the quality was tested by measuring RNA concentration and 1% agarose gel electrophoresis. Subsequently, RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara, Japan).

[0029] After retrieving the sequence information of CHS (gene number: 111032968) on the NCBI website, the target fragment primers were designed and synthesized (forward primer: TGTTCTTCATGACGTCCCAA, nucleotide sequence as shown in SEQ ID NO.2; backward primer: GTTTTTCCGGGTGTAGCAAA, nucleotide sequence as shown in SEQ ID NO.3). Using green peach aphid-cDNA as a template, the CHS target fragment was amplified by PCR using the above primers, and the amplified product was detected by agarose gel electrophoresis. After the target band was recovered using a gel recovery kit, it was connected to pMD19T-Vector and transformed into Escherichia coli competent cells (DH5α). The transformation product was evenly spread on LB solid medium containing 100 mg / L ampicillin and inverted and cultured overnight at 37°C. The next day, a single colony was picked as a template for PCR verification, and the gene sequencing of the verified positive strains was performed.

[0030] The plasmid of the strain with the correct sequencing result was extracted as a template, and PCR amplification was performed again using CHS primers with T7 sequence, and the amplified product was recovered using gel recovery kit. Finally, ds CHS .

[0031] By SPc and ds CHS Add ds in a mass ratio of 1:1 CHS Incubate with diflubenzuron / SPc at room temperature for 15 min to obtain diflubenzuron / SPc / ds CHS Multi-component insecticide.

[0032] Example 5 Diflubenzuron / SPc / dsCHS Analysis and characterization of the binding mechanism of multi-component insecticides Analysis of the relationship between diflubenzuron / SPc and ds using isothermal titration calorimetry (ITC) CHS The specific operation is as follows: in 2 mL of diflubenzuron / SPc (0.1 mM) solution, 250 μL of 1 mM ds CHS , and record the thermodynamic parameters during the titration process to analyze the binding mechanism of multi-pesticides.

[0033] Isothermal titration calorimetry results show (eg Figure 4 shown), ds CHS Has a lower dissociation coefficient K with diflubenzuron / SPc d (M) is 7.9×10 -6 , indicating that there is a strong interaction between the two. The entropy change ΔH is -10.1 kJ / mol, and the function change ΔS is 64.1 J / mol•K. According to the Gibbs free energy: ΔG=ΔH-TΔS, the Gibbs free energy ΔG of the interaction reaction between the two substances is calculated to be -29.2 kJ / mol, indicating that dsCHS and diflubenzuron / SPc can spontaneously combine. According to the ΔH and ΔS of the reaction, it can be inferred that the binding interaction between dsCHS and diflubenzuron / SPc is mainly electrostatic.

[0034] In addition, high-sensitivity Zeta potential and particle size analyzer were used to measure diflubenzuron, ds CHS , SPc and its different combinations (diflubenzuron / SPc, ds CHS / SPc、Diflubenzuron / SPc / ds CHS The particle morphology was observed by transmission electron microscopy to characterize the structural characteristics of the multi-component insecticide.

[0035] The test conditions are: temperature 25°C, solvent water, three tests, and stabilization time 120 s. At the same time, 10 μL of the above sample solution was taken, placed on a copper grid to dry, and the morphology was photographed and observed using a projection electron microscope.

[0036] The particle size of diflubenzuron in aqueous solution was 1353.99 nm, the particle size of diflubenzuron / SPc complex was reduced to 248.07 nm, and the particle size of diflubenzuron / SPc / ds CHS The particle size of the ternary insecticide is 349.01 nm (as shown in Table 2).

[0037] Table 2 Particle size of different components

[0038] The above results are consistent with the results of transmission electron microscopy. Diflubenzuron is a crystalline block, and Diflubenzuron / SPc is a regular sphere of uniform size (such asFigure 5 as shown).

[0039] Example 6 Diflubenzuron / SPc / ds CHS Activity testing of multi-component insecticides Evaluation of diflubenzuron / SPc / ds by back plate spot method CHS Multicomponents and Diflubenzuron / SPc / ds eGFP (ds GFP The nucleotide sequence of is shown in SEQ ID NO.4) to aphids. Figure 6 As shown, diflubenzuron / SPc / ds CHS The expression level of CHS gene was significantly reduced. eGFP The mortality rate was 46.67%, diflubenzuron / SPc / ds CHS The mortality rate increased to 82.22%.

[0040] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A diflubenzuron / SPc / ds CHS The multi-component compound insecticide is characterized by: The compound insecticide comprises a diflubenzuron / SPc complex and ds CHS , the ds CHS The mass ratio of ds to SPc in the diflubenzuron / SPc complex is 0.1-5:1; CHS The nucleotide sequence is shown in SEQ ID NO.

1.

2. Diflubenzuron / SPc / ds according to claim 1 CHS The multi-component compound insecticide is characterized by: The diflubenzuron / SPc complex is formed by incubating the nanocarrier SPc and diflubenzuron, and the mass ratio of the nanocarrier SPc to diflubenzuron is 0.5-3:

1.

3. Diflubenzuron / SPc / ds according to claim 1 or 2 CHS The preparation method of the multi-component compound insecticide is characterized by: The steps include: Step 1 is to incubate the nanocarrier SPc with diflubenzuron to obtain a diflubenzuron / SPc complex; Step 2 is to mix the diflubenzuron / SPc complex with ds CHS Incubate to obtain the diflubenzuron / SPc / ds CHS Multi-component compound insecticide.

4. Diflubenzuron / SPc / ds according to claim 1 CHS The multi-component compound insecticide is characterized by: The incubation step in step 1 is performed at a temperature of 20-35° C. and for a time of 1-30 minutes.

5. Diflubenzuron / SPc / ds according to claim 1 CHS The multi-component compound insecticide is characterized by: The incubation step in step 2 is performed at a temperature of 20-35° C. and for a time of 1-30 minutes.

6. A chitin synthesis inhibitor, characterized in that: The inhibitor comprises 1-100% by mass of the diflubenzuron / SPc / ds according to claim 1 or 2 CHS Multi-component compound insecticide.

Citation Information

Patent Citations

  • Strong constitutive promoters for heterologous expression of proteins in plants

    CA2872480A1

  • Gall wasp control agents

    CN103596575A

  • Toxoptera citricida chitin synthase gene and dsRNA thereof

    CN105420255A

  • Gene function identification method for toxoptera citricida

    CN105441575A

  • Bacterial strain for degrading chlorbenzuron and application of bacterial strain

    CN116478879A