LECT2 inhibitor and application thereof in intervention of NETs formation and preparation of medicine for preventing and treating alcoholic hepatitis

By developing LECT2 inhibitors to interfere with the formation of NETs, ​​the problem of lack of effective targets for the treatment of alcoholic hepatitis has been solved, and liver damage and inflammation has been significantly alleviated, providing a new method to prevent and treat alcoholic hepatitis.

CN120093776APending Publication Date: 2025-06-06THE FIRST AFFILIATED HOSPITAL OF ANHUI MEDICAL UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510298921.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The prior art lacks effective therapeutic targets to prevent and treat alcoholic hepatitis, and the abnormal release of NETs aggravates liver damage.

Method used

LECT2 inhibitors are developed to prepare drugs to prevent and treat alcoholic hepatitis by interfering with the formation of NETs. The specific method is to use LECT2 shRNA to transfect AAV-293 cells to prepare adeno-associated viruses that specifically inhibit the expression of LECT2 in the liver, thereby reducing the formation of NETs in the liver.

Benefits of technology

By inhibiting LECT2, reducing the production of NETs and significantly reducing liver damage and inflammation, new targets are provided to prevent and treat alcoholic hepatitis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120093776A_ABST
    Figure CN120093776A_ABST
Patent Text Reader

Abstract

The invention relates to an LECT2 inhibitor and application of the LECT2 inhibitor in intervention of NETs formation and preparation of drugs for preventing and treating alcoholic hepatitis (AH), and provides application of the LECT2 inhibitor in preparation of drugs for intervention of NETs formation and further prevention and treatment of AH, and a foundation is laid for new drug screening. The LECT2 is positively correlated with the disease severity of AH, and the LECT2 inhibitor plays a role in preparing a medicine for intervening the generation of NETs so as to prevent and treat the progress of AH. An LECT2 inhibitor is AAV-shLECT2, the LECT2 shRNA is transfected into AAV-293 cells, the adeno-associated virus for inhibiting liver expression of LECT2 is prepared, liver expression and LECT2 secretion are inhibited by injecting the virus, then formation of NETs in the liver is reduced, and finally the effect of preventing and treating AH progress is achieved. LECT2 is combined with a neutrophile granulocyte receptor PHB2, so that generation of NETs in neutrophile granulocytes is increased, then liver injury is aggravated, and the generation of the NETs in the neutrophile granulocytes can be reduced by knocking down LECT2, so that AH development is prevented and treated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to a LECT2 inhibitor and an application thereof in intervening in NETs formation and preparing a drug for preventing and treating alcoholic hepatitis. Background Art

[0002] As an important part of social culture, drinking is widely prevalent around the world, transcending regional, racial and economic restrictions. Alcoholic liver disease (ALD) is a common disease caused by toxic liver damage due to excessive drinking and is the leading cause of alcohol-related death. Alcoholic hepatitis (AH) is the core link in the continuous progression of ALD. It is a group of clinical pathological syndromes caused by massive hepatocyte necrosis in a short period of time on the basis of long-term and heavy drinking. It is mainly manifested by massive neutrophil infiltration in the liver and significant liver damage, including increased serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyltransferase (GGT) or serum total bilirubin, and may be accompanied by fever and increased peripheral blood neutrophils. The 28-day mortality rate of AH patients is as high as 14% to 24%, and the 5-year mortality rate is 56%. Although abstinence from alcohol is a basic preventive and therapeutic measure for AH patients, liver inflammation and fibrosis may persist after abstinence from alcohol, and there is currently a lack of effective therapeutic targets in clinical practice.

[0003] Neutrophil extracellular traps (NETs) are a fibrous network structure that is produced by activated neutrophils when the body is stimulated by pathogenic microorganisms such as bacteria and viruses. They have the function of capturing and removing various microorganisms. NETs participate in host defense responses and are an important part of the inflammatory process, but excessive release of NETs is involved in a variety of disease processes, such as autoimmune diseases, diabetes, and tumors. NETs play a vital role in the progression of AH. Neutrophil infiltration in the liver and abnormal increase in NETs are one of the important pathological processes of AH. Abnormal NETs will further aggravate liver damage and lead to the progression of AH. Prohibitin 2 (PHB2) is a protein present in neutrophils. It stabilizes mitochondria in neutrophils and inhibits the generation of NETs by forming a PHB1 / PHB2 complex with its homologous family PHB1.

[0004] Leukocyte cell-derived chemotaxin 2 (LECT2) is a 16kDa secretory protein named after it was originally identified as a chemokine for neutrophils. Recently, multiple evidences have shown that LECT2 is involved in many pathological conditions, such as sepsis, diabetes, systemic amyloidosis, hepatocarcinogenesis, nonalcoholic fatty liver disease (NAFLD), expansion / activation of hematopoietic stem cells, and promotion of liver fibrosis. CN201910794668.0 discloses the use of LECT2 as a serum marker for liver fibrosis and cirrhosis. Its main mechanism is that LECT2 binds to the vascular endothelial cell receptor Tie1, promotes the dissociation of Tie1 / Tie2, leads to an increase in Tie2 / Tie2 homodimers, and then activates the downstream MAPK / PPAR / MMP / VE-cadherin signaling pathway, regulates vascular endothelial cell migration and angiogenesis, and thus promotes the process of liver fibrosis. However, the role of LECT2 in the treatment of alcoholic hepatitis has not been reported yet. Those skilled in the art are eager to explore the application of LECT2 inhibitors in inhibiting NETs formation and preparing drugs for preventing and treating alcoholic hepatitis. Summary of the invention

[0005] In view of this, the present invention provides a LECT2 inhibitor and its use in intervening in NETs formation and preparing a drug for preventing and treating alcoholic hepatitis.

[0006] NETs are a network structure released by neutrophils with multiple biological activities.

[0007] Application of LECT2 inhibitors in the preparation of drugs for intervening in NETs formation.

[0008] Application of LECT2 inhibitors in the preparation of drugs for preventing and treating alcoholic hepatitis.

[0009] Specifically, the above-mentioned LECT2 inhibitor is LECT2 shRNA, and its sequence is: GATCCGCTAACATATGTGCCAGCAAATCTTTGTGCTTAAGATTTGCTGGCACATATGTTAGCTTTTTTC (positive chain); AATTCAAAAAAGCTAACATATGTGCCAGCAAATCTTAAGCACAAAGATTTGCTGGCACATATGTTAGCG (reverse chain).

[0010] Furthermore, the LECT2 shRNA is transfected into AAV-293 cells to prepare an adeno-associated virus that specifically inhibits intrahepatic LECT2 expression. The specific preparation method is as follows: (1) AAV-293 cells are revived and subcultured, and transfection is started after the cell density reaches a confluence of 90%; (2) a LECT2 inhibitory sequence is constructed; (3) pAAV-RC, pHelper and shLECT2 are co-transfected into AAV-293 cells; (4) the AAV-293 cells in (3) are treated with a universal nuclease and column purified to obtain an adeno-associated virus that specifically inhibits LECT2 expression.

[0011] Beneficial effects of the present invention: The present invention provides the use of LECT2 and its inhibitors in the preparation of drugs for intervening in NETs generation and preventing and treating AH, providing a basis for new drug screening. 1. The use of a reagent for detecting serum LECT2 protein levels in the preparation of AH progression diagnostic reagents; 2. The above reagents can be used for grading and judging the clinical progression of AH patients, and LECT2 is significantly positively correlated with the severity of AH; 3. The role of LECT2 inhibitors in the preparation of drugs for intervening in NETs generation and preventing and treating AH progression. 4. The LECT2 inhibitor is AAV-shLECT2, whose sequence is: GATCCGCTAACATATGTGCCAGCAAATCTTTGTGCTTAAGATTTGCTGGCACATATGTTAGCTTTTTTC (positive chain); AATTCAAAAAAGCTAACATATGTGCCAGCAAATCTTAAGCACAAAGATTTGCTGGCACATATGTTAGCG (reverse chain); 5. The above LECT2 shRNA was transfected into AAV-293 cells to produce an adeno-associated virus that inhibits the expression and secretion of LECT2 in the liver. The virus was injected to inhibit the expression and secretion of LECT2 in the liver, thereby reducing the formation of NETs in the liver, and ultimately preventing and treating the progression of AH. The specific mechanism of LECT2 promoting AH was explored: LECT2 binds to the neutrophil receptor PHB2, resulting in increased NETs production in neutrophils, thereby promoting liver damage. Knocking down LECT2 can reduce NETs production in neutrophils and prevent and treat the progression of AH.

[0012] Compared with the prior art, the present invention has the following advantages: At present, the role of LECT2 in the development of alcoholic hepatitis has not been reported. The application of the LECT2 inhibitor disclosed in the present invention in inhibiting NETs formation and preparing drugs for preventing and treating alcoholic hepatitis, first, LECT2, as a cytokine, can be used as a serological marker for diagnosing AH and determining the severity of AH. Second, LECT2 regulates NETs generation and promotes AH, which can provide a new target for clinical intervention in the progression of AH. It is clear that LECT2 increases NETs generation by binding to the neutrophil receptor PHB2 and promotes the progression of AH. It is clear that LECT2 inhibitors can play a key role in preventing and treating the progression of AH by intervening in NETs generation and slowing down liver damage. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The present invention is described in detail below with reference to the accompanying drawings. Figure 1 is a timeline of the feeding and treatment cycles of the AH model and AH control model mice in Example 1, Figure 2 The changes in LECT2 content and liver damage and inflammation in AH model mice and AH control model mice were compared in Example 1. Figure 2 A is the public RNA-seq data (GSE220520, GSE132103, GSE179398) showing that there is a significant increase in LECT2 expression levels in alcohol-fed mice; Figure 2 B is the level of LECT2 in mouse serum; Figure 2 C is the content of LECT2 in mouse liver tissue; Figure 2 D is HE staining, LECT2 immunohistochemical staining, Oil red staining, TUNEL staining and Sirius red staining of mouse liver tissue; Figure 2 E is the quantification of the oil red staining positive area in mouse liver tissue; Figure 2 F is the number of TUNEL-positive cells in mouse liver tissue; Figure 2 G is the Sirius red staining area in mouse liver tissue; Figure 2 H is the triglyceride (TG) content in mouse liver tissue; Figure 2 I is the ALT content in mouse serum; Figure 2 J is the content of AH-related inflammatory factors in mouse liver tissue. Figure 3 In Example 2, knockout of LECT2 in the AH mouse model alleviated liver damage and inflammation, while overexpression of LECT2 aggravated liver damage and inflammation. Figure 3 A-3H is an AH model constructed by Lect2-KO mice and wild-type mice. Figure 3 A is HE staining, LECT2 immunohistochemical staining, Oil Red staining and TUNEL staining of mouse liver tissue; Figure 3 B is the LECT2 content in mouse serum and liver; Figure 3C is the detection of LECT2 content in liver tissue using WB; Figure 3 D is the quantification of the oil red staining positive area in mouse liver tissue; Figure 3 E is the number of TUNEL-positive cells in mouse liver tissue; Figure 3 F is the TG content in mouse liver tissue; Figure 3 G is the ALT content in mouse serum; Figure 3 H is the content of proinflammatory cytokines and chemokines (TNF-α, IL6, CXCL2, and CCL3) in the liver; Figure 3 IP was used to inject AAV9-LECT2 into wild-type mice to cause LECT2 overexpression (experimental group) and AAV9-V (control group), and the AH model was constructed. Figure 3 I is HE staining, LECT2 immunohistochemical staining, Oil Red staining, and TUNEL staining of liver tissues of LECT2-overexpressing mice; Figure 3 J is the LECT2 content in serum and liver of LECT2-overexpressing mice; Figure 3 K is the detection of LECT2 content in liver tissue using WB; Figure 3 L is the quantification of the oil red staining positive area; Figure 3 M is the quantification of TUNEL-positive cells; Figure 3 N is the serum TG content; Figure 3 O is the serum ALT content; Figure 3 P is the content of proinflammatory cytokines (TNF-α, IL6, CXCL2, and CCL3) in the liver. Figure 4 This is a diagram of Example 3 showing that LECT2 promotes the generation of NETs in the AH mouse model and aggravates liver damage. Figure 4 AC is a proteomic analysis of Lect2-KO mice and wild-type mice, showing 850 differentially expressed proteins (566 upregulated and 284 downregulated) in Lect2-KO mice compared with wild-type mice, and further clustering and enrichment analysis highlighted the unique proteomic features of Lect2-KO mice; Figure 4 DE is the proteomic analysis of Lect2-KO mice, which found that LECT2 was significantly positively correlated with NETs; Figure 4 FH is used to detect the expression of NETs in serum and liver tissue of AH patients. Figure 4 F is that the MPO-DNA content in the serum of AH patients that reflects the generation of NETs is significantly increased; Figure 4 G is that the increased MPO-DNA and LECT2 are significantly positively correlated; Figure 4 H is an immunofluorescence staining image of NETs generation in liver tissue of AH patients; Figure 4 IK is to construct AH model and control model in wild-type mice respectively; Figure 4I is that the MPO-DNA content in the serum of AH mice that reflects the generation of NETs is significantly increased; Figure 4 J is that Cit-H3 in response to NETs production in liver tissue of AH mice increased significantly; Figure 4 K is an immunofluorescence staining image of NETs generation in liver tissue of AH mice; Figure 4 LN is an AH model constructed by Lect2-KO mice and wild-type mice; 4L is that the MPO-DNA content generated by NETs in the serum of Lect2KO mice is significantly reduced; Figure 4 M is that Cit-H3 in the liver tissue of AH mice that reflects NETs production was significantly reduced; Figure 4 N is the immunofluorescence staining image of NETs generation in liver tissue of AH mice; Figure 4 OQ was to inject AAV9-LECT2 into wild-type mice to cause LECT2 overexpression (experimental group) and AAV9-V (control group), and construct the AH model; Figure 4 O is that the content of MPO-DNA generated by NETs in the serum of LECT2-overexpressing mice was significantly increased; Figure 4 P is that Cit-H3 in response to NETs production in liver tissues of LECT2-overexpressing mice increased significantly; Figure 4 Q is the immunofluorescence staining image of NETs generation in liver tissue of LECT2 overexpressing mice. Figure 5 This is the timeline of the mouse feeding and handling cycle in 1.3 of Example 4. Figure 6 This is a graph showing a significant reduction in liver damage and NETs generation in mice treated with AAV9-Lect2 shRNA in Example 4. Figure 6 AC is that the LECT2 content in liver tissue and serum of mice treated with AAV9-Lect2 shRNA was significantly reduced; Figure 6 A is HE staining, LECT2 immunohistochemical staining, Oil Red staining and TUNEL staining of mouse liver tissue; Figure 6 B is the LECT2 content in mouse serum and liver; Figure 6 C is the detection of LECT2 content in liver tissue using WB; Figure 6 DH is that the liver injury degree and AH-related inflammatory factors were significantly reduced in mice treated with AAV9-Lect2 shRNA; Figure 6 D is the quantification of the oil red staining positive area in mouse liver tissue; Figure 6 E is the number of TUNEL-positive cells in mouse liver tissue; Figure 6 F is the TG content in mouse liver tissue; Figure 6 G is the ALT content in mouse serum; Figure 6 H is the content of AH-related inflammatory factors (TNF-α, IL6, CXCL2, and CCL3) in the liver; Figure 6IK is that the production of NETs in mice treated with AAV9-Lect2 shRNA was significantly reduced; Figure 6 I is an immunofluorescence staining image of NETs generation in mouse liver tissue; Figure 6 J is that the content of MPO-DNA in mouse serum that reflects NETs generation is significantly reduced; Figure 6 K is a significant decrease in Cit-H3 in mouse liver tissue reflecting NETs production. Figure 7 Example 5 shows that the expression level of LECT2 in AH patients is increased and positively correlated with the severity of AH. Figure 7 AB analyzed the data from public databases and found that the expression level of LECT2 was increased in AH patients, and the expression was specifically increased in hepatocytes; Figure 7 CG is a significant increase in the degree of liver damage in AH patients, manifested by the increase of ALT, AST, ALP, GGT and TG; Figure 7 HI is the significant increase in the absolute value of white blood cells and neutrophils in AH patients; Figure 7 J is that the serum LECT2 content in AH patients is significantly increased; Figure 7 K is that there is a significant positive correlation between LECT2 and liver injury markers (ALT and AST) in AH patients; Figure 7 L is that LECT2 is positively correlated with AH severity scoring systems (mDF, MELD-Na; ABIC) in AH patients; Figure 7 M is a comparison of the accuracy of LECT2 and various AH severity scoring systems in predicting AH mortality. It was found that the accuracy of LECT2 in predicting the mortality of AH patients is better than other AH severity scoring systems. Figure 8 Example 6 LECT2 promotes NETs production through PHB2 and aggravates alcoholic liver damage. Figure 8 A is mass spectrometry (MS) analysis confirming that PHB2 is a potential target of LECT2 in promoting NETs generation; Figure 8 B is a co-immunoprecipitation (CO-IP) experiment that confirms the mutual binding of LECT2 and PHB2; Figure 8 C is the protein purification and immunoprecipitation experiments verifying the direct binding of LECT2 to PHB2; Figure 8 D is the co-localization of LECT2 and PHB2 in neutrophils and human promyelocytic leukemia (HL60) cells. Fig. 9 Example 6 LECT2 promotes NETs generation through PHB2 and aggravates alcoholic liver damage. Fig. 9 AB shows that after adding exogenous LECT2 to neutrophils, the generation of NETs increased significantly; Fig. 9 CD is the use of siRNA to specifically knock down PHB2 in dHL60 cells, showing that PHB2 is significantly reduced; Fig. 9 EF: After adding rLECT2 to HL60 cells (DMF-dHL60) in which PHB2 was knocked out by PHB2-siRNA1, NETs production no longer increased; Fig. 9 GH shows that the addition of rLECT2 to HL60 cells (DMF-dHL60) in which PHB2 was knocked out by PHB2-siRNA2 no longer increased the generation of NETs. Fig.10 This is a schematic diagram of Example 6 showing that LECT2 promotes NETs generation through PHB2 and knocking down LECT2 can alleviate alcohol-induced liver damage. DETAILED DESCRIPTION Example 1

[0014] LECT2 content and liver damage were significantly increased in the AH (alcoholic hepatitis) mouse model.

[0015] 1.1 Experimental Materials - Experimental Animals and Feeds: The mice used in the experiment were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. Clean-grade C57BL / 6 mice, male, 8-10 weeks old, weighing 20-22 g. Liquid feed was ordered from Nantong Trophy Co., Ltd., and Lieber-DeCarli alcohol liquid feed and matching control liquid feed were prepared. The liquid feed formula is shown in Table 1: Table 1 Liquid feed formula 1.2 Experimental methods: (1) The classic AH mouse model induced by liquid feed feeding (mouse model of chronic and bingeethanol feeding, the NIAAA model) Figure 1), 12 male C57BL / 6 mice aged 8-10 weeks and weighing 20-22g were selected and randomly divided into two groups, with 6 mice in each group. First, the two groups of mice were deprived of solid feed and sterile water, and only provided with sufficient control liquid feed for 5 days. The feed was changed at 5 pm every day to make the mice accustomed to eating liquid feed. In order to ensure the same energy intake of the experimental and control groups, the control group was also modeled for 15 days, but one day later than the experimental group. On the 6th day, the experimental group was replaced with Lieber-DeCarli alcohol liquid feed, and the control group continued to use control liquid feed; on the 7th day, the experimental group continued to add sufficient Lieber-DeCarli alcohol liquid feed, and the amount of control liquid feed in the control group should be consistent with the amount of mice in the experimental group on the 6th day, which lasted until the 15th day of each group. At 7 am on the 16th day of each group, the experimental group used 31.5% alcohol solution and the control group used 45% dextrin solution, and the mice were gavaged at a ratio of 20μl / g, and the mice were killed 9 hours after gavage. Before killing, mice were anesthetized, and 800 μL of blood was collected from the eyeballs to extract serum, which was then stored in a -80°C refrigerator for later use. Mouse liver tissues were collected, and part of the liver tissues were used for oil red staining and frozen in liquid nitrogen for later use. Part of the liver tissues were fixed with neutral formalin and paraffin sections were made for HE staining, immunohistochemical staining, and TUNEL staining. (2) Immunohistochemical staining, RT-qPCR, and Westron Blot were used to detect the content of LECT2 in mouse liver tissues. (3) HE staining, oil red staining, TUNEL staining, and Sirius red staining were used to detect liver damage, fatty degeneration, apoptosis, and liver fibrosis in mouse liver tissues. (4) Biochemical detection was used to analyze the content of ALT and TG in mouse serum. (5) RT-qPCR was used to analyze the content of neutrophil-related inflammatory mediators in mouse liver tissues.

[0016] 2 Results: The LECT2 content in the AH mouse model increased, and liver damage and inflammation were aggravated: (1) Analysis of publicly available RNA-seq data (GSE220520, GSE132103, GSE179398) showed that the expression level of LECT2 was significantly increased in mice fed with alcohol ( Figure 2 A); (2) LECT2 levels in serum and liver of AH mice were significantly increased compared with pair-fed (PF) mice (control group) ( Figure 2 BD); (3) HE staining, immunohistochemical staining, oil red staining and TUNEL staining confirmed that AH mice showed more severe liver damage, fatty degeneration and apoptosis induced by alcohol ( Figure 2 DG); (4) Serum ALT and TG levels were significantly increased in AH mice, indicating more severe liver damage ( Figure 2HI); (5) AH-related inflammatory mediators such as CXCL family chemokines, CC motif chemokine ligand 3 (CCL3), interleukin 1β (IL-1β), tumor necrosis factor-α (TNF-α) and interleukin 6 (IL-6) were significantly increased in AH mice ( Figure 2 J) There is a significant increase in LECT2 and aggravated liver damage and inflammation in AH-reactive mice, indicating that LECT2 plays a key role in the pathogenesis of AH. Example 2

[0017] In the AH mouse model, liver damage and inflammation were alleviated after LECT2 knockout, while liver damage and inflammation were aggravated after LECT2 overexpression.

[0018] 1.1 Experimental Materials: The classic AH mouse model (mouse model of chronic and binge ethanol feeding, the NIAAA model) was induced by liquid feed. The liquid feed and C57BL / 6 mice were the same as those in Example 1.

[0019] 1.2 Experimental methods: (1) AH models were constructed for Lect2-KO and wild-type mice at the same time, and mouse liver tissue and serum samples were collected. Part of the liver tissue was used for oil red staining, proteomic analysis and frozen in liquid nitrogen for later use; part of the liver tissue was fixed with neutral formalin and paraffin sections were made for HE staining, immunohistochemistry staining and TUNEL staining; the LECT2 content in mouse liver tissue was detected by immunohistochemistry staining, RT-qPCR and Western Blot; HE staining, Oil red staining and TUNEL staining were used to detect liver damage, fatty degeneration and cell apoptosis in mouse liver tissue; biochemical detection method was used to analyze the ALT and TG levels in mouse serum; RT-qPCR was used to analyze the content of neutrophil-related inflammatory mediators in mouse liver tissue. (2) Wild-type mice were injected with AAV9-LECT2 to cause LECT2 overexpression (experimental group) and AAV9-V (control group), and the AH model was established. Liver tissue and serum samples were collected from mice. Some liver tissues were used for oil red staining and frozen in liquid nitrogen for later use; some liver tissues were fixed with neutral formalin and paraffin sections were made for HE staining, immunohistochemistry staining and TUNEL staining; the LECT2 content in mouse liver tissue was detected by immunohistochemistry staining, RT-qPCR and Western Blot; liver damage, fatty degeneration and cell apoptosis in mouse liver tissue were detected by HE staining, oil red staining and TUNEL staining; the ALT and TG levels in mouse serum were analyzed by biochemical detection method; and the content of neutrophil-related inflammatory mediators in mouse liver tissue was analyzed by RT-qPCR.

[0020] 2. Results: 2.1 LECT2 knockout reduced liver damage and inflammation in the AH mouse model: (1) No LECT2 expression was detected in the liver tissue and blood of mice after LECT2 knockout ( Figure 3 AC); (2) LECT2 knockout reduced liver damage and inflammation in AH mice ( Figure 3 DH).

[0021] 2.2 Overexpression of LECT2 in the AH mouse model aggravates liver damage and inflammation: (1) Overexpression of LECT2 increased the level of LECT2 in the liver tissue and blood of mice ( Figure 3 IK); (2) Overexpression of LECT2 exacerbated liver damage and inflammation in AH mice ( Figure 3 LP). Example 3

[0022] LECT2 leads to increased production of NETs after alcohol stimulation.

[0023] 1. Experimental methods: (1) Proteomics analysis of Lect2-KO mice and wild-type mice was performed to identify the unique proteomic characteristics of Lect2-KO mice; (2) The level of myeloperoxidase (MPO)-DNA in the serum of AH patients, which reflects the production of NETs, ​​was detected, and NETs in the liver tissue of AH patients were immunofluorescently stained; (3) AH models and control models were established in wild-type mice, and liver tissue and serum samples were collected to detect MPO-DNA in response to NETs and citrullinated histone H3. (4) AH models were constructed in Lect2-KO and wild-type mice at the same time, and liver tissue and serum samples were collected to detect MPO-DNA, Cit-H3 and NETs immunofluorescence staining in response to NETs; (5) Wild-type mice were injected with AAV9-LECT2 to cause LECT2 overexpression (experimental group) and AAV9-V (control group), and AH models were constructed. Liver tissue and serum samples were collected to detect MPO-DNA, Cit-H3 and NETs immunofluorescence staining in response to NETs.

[0024] 2. Results: 2.1 Proteomic analysis showed that Lect2-KO mice were significantly different from wild-type mice, revealing 850 differentially expressed proteins in Lect2-KO mice (566 upregulated and 284 downregulated). Further cluster analysis revealed the unique proteomic characteristics of Lect2-KO mice ( Figure 4AC). Gene set enrichment analysis of proteomic results revealed a strong association between NETs formation and LECT2 ( Figure 4 D). At the same time, the expression of NETs-related proteins (VDAC1, VDAC2, HDAC1 and PPIF) in Lect2-KO mice was significantly reduced ( Figure 4 E).

[0025] 2.2 Detection of MPO-DNA levels in the serum of AH patients that reflect NETs production. Compared with the control group, the serum MPO-DNA level of AH patients was higher, and there was a significant positive correlation between serum LECT2 and MPO-DNA ( Figure 4 FG, and increased NETs production was found in liver tissue of AH patients ( Figure 4 H) 2.3 In the AH mouse model, NETs formation was significantly increased in AH mice, as shown by the increase in NETs immunofluorescence staining, MPO-DNA and Cit-H3 ( Figure 4 In contrast, Lect2-KO mice showed a significant reduction in NET formation ( Figure 4 LN, while Lect2 overexpressing mice showed a significant increase in NETs formation ( Figure 4 These data highlight the critical role of LECT2 in the formation of NETs. Example 4

[0026] AH was treated by injecting LECT2 shRNA to knock down LECT2, and it was found that knocking down LECT2 could improve NETs formation and liver damage in AH mice.

[0027] 1. Experimental methods: 1.1 Adeno-associated virus packaging: (1) Subculture AAV-293 cells into 100 mm dishes for transfection and place in a 37°C, 5% CO 2and 95% relative humidity in an incubator; (2) Transfection: After confirming that the AAV-293 cell density has reached 90% confluence, transfection was started. The components of the transfection complex required for transfection of a 100 mm dish are as follows: ① pAAV-RC plasmid (10 μg), ② pHelper plasmid (20 μg), ③ shuttle plasmid (10 μg), ④ LipofiterTM (120 μL); (3) Medium change: 6 h after transfection, replace with fresh complete medium containing 10% fetal bovine serum (FBS); (4) Cell collection: 72 h after transfection, gently scrape the cells containing AAV particles with a cell scraper and collect them in a 15 mL centrifuge tube. Centrifuge at 150 g for 3 min to collect the cells, remove the culture supernatant, wash once with PBS, and finally resuspend the cells in 300 μL PBS; (5) Cell disruption: Prepare a 37°C constant temperature water bath and liquid nitrogen, and repeatedly freeze and thaw the centrifuge tube containing cells in liquid nitrogen and a 37°C water bath three times. 4°C, 2000g, 5 min, remove cell debris, and collect the lysis supernatant containing AAV particles.

[0028] 1.2 Adeno-associated virus purification: (1) Treatment with universal nuclease: Add 0.1 μL of Benonase enzyme to every 1 mL of crude virus extract, and incubate in a 37°C water bath for 1 hour to remove the cell genome and residual plasmid DNA in the virus solution. Centrifuge at 600 g, 4°C for 10 minutes, and take the supernatant; (2) Column purification (purify according to Biomiga Adeno-associated virus purification kit V1469-01): (3) Add 4 mL of AAV virus sample liquid obtained by column purification to an ultrafiltration tube, and centrifuge at 1400 g for 30 minutes to obtain 1 mL of AAV. Collect the purified virus and store it at -80°C; 1.3 Knockdown of LECT2 for therapeutic exploration: A classic AH mouse model was constructed. Liquid feed and C57BL / 6 mice were the same as in Example 1. On the 5th day of adaptation to liquid feed, which was the day before Lieber-DeCarli alcohol liquid feed, the specific process was as shown in the attached Figure 6 , the expression of LECT2 was reduced by tail vein injection of adeno-associated virus AAV9-shLECT2 ( Figure 5 ), and compared the liver damage degree of the control group (injected with AAV9-scr) and the experimental group (injected with AAV9-shLECT2). LECT2shRNA, its sequence is: GATCCGCTAACATATGTGCCAGCAAATCTTTGTGCTTAAGATTTGCTGGCACATATGTTAGCTTTTTTC (positive chain); AATTCAAAAAAGCTAACATATGTGCCAGCAAATCTTAAGCACAAAGATTTGCTGGCACATATGTTAGCG (reverse chain).

[0029] 2. Results: In mice treated with AAV9-Lect2 shRNA, LECT2 expression was significantly reduced, indicating that LECT2 was effectively knocked down ( Figure 6 AC). LECT2 knockdown can significantly alleviate ethanol-induced liver injury, steatosis and inflammation, as shown by reduced liver injury in liver tissue, reduced serum TG and ALT levels, and reduced levels of AH-related inflammatory mediators (TNF-a, IL-6, CXCL2, CCL3) ( Figure 6 DH). In addition, LECT2 knockdown significantly alleviated ethanol-induced NETs production, thereby alleviating alcohol-induced liver damage ( Figure 6 IK). Example 5

[0030] The expression level of LECT2 is increased in AH patients and positively correlated with the disease severity of AH.

[0031] 1. Experimental methods: (1) Analyze the public database data related to AH patients to find the association between LECT2 and AH; (2) Collect serum and liver tissue specimens from AH patients and healthy controls to detect the expression level of LECT2 and indicators reflecting liver damage and inflammation.

[0032] 2. Results 2.1 The publicly available single-cell RNA sequencing (GSE255772) and global RNA sequencing (GSE143318) datasets were analyzed, and the results showed that the expression level of LECT2 in AH patients was increased and was mainly expressed in hepatocytes ( Figure 7 AB).

[0033] 2.2 Serum testing of AH patients and healthy controls revealed that the level of liver damage in AH patients was significantly higher than that in the control group, including increased levels of biochemical markers such as alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), γ-glutamyltransferase (GGT), and triglyceride (TG) ( Figure 8 CG). In addition, circulating white blood cells (WBC) and neutrophils are increased in AH patients ( Figure 7 HI). The detection of LECT2 levels found that the liver and circulating LECT2 levels in AH patients were significantly higher than those in the control group ( Figure 7 J).

[0034] 2.3 Analysis of the correlation between LECT2 and liver injury markers revealed that LECT2 was positively correlated with ALT and AST ( Figure 7 K). In addition, LECT2 was positively correlated with various AH severity scoring systems (mDF, MELD-Na, ABIC) ( Figure 7 L). Analysis of the relationship between LECT2 and the 90-day mortality of AH patients found that LECT2 was more accurate in predicting the mortality of AH patients than other AH severity scoring systems ( Figure 7 M). Example 6

[0035] LECT2 promotes NETs production and aggravates alcoholic liver injury through PHB2.

[0036] 1. Experimental methods: 1.1 (1) Mass spectrometry (MS) was used to identify potential targets of LECT2 in promoting NETs formation; (2) Co-immunoprecipitation (CO-IP) experiments and protein purification and immunoprecipitation experiments were used to confirm the interaction between LECT2 and PHB2. (3) rLECT2 was added to neutrophils and human promyelocytic leukemia (HL60) cells and incubated, and the co-localization of PHB2 and LECT2 was detected.

[0037] 1.2 After adding exogenous LECT2 (rLECT2) to neutrophils, the generation of NETs was detected, including immunofluorescence staining of NETs and ROS levels.

[0038] 1.3 Two PHB2 knockdown cell lines were generated using PHB2-siRNA1 and PHB2-siRNA2 in differentiated human acute promyelocytic leukemia (dHL60) cells. After adding rLECT2, the generation of NETs was detected, including immunofluorescence staining of NETs and ROS levels.

[0039] 2. Experimental results 2.1 Clarify the interaction between LECT2 and PHB2: First, MS confirmed that PHB2 is the target of LECT2 in promoting NETs formation ( Figure 8 A), and then co-immunoprecipitation (CO-IP) experiments confirmed the interaction between LECT2 and PHB2 ( Figure 8 B) Protein purification and immunoprecipitation experiments confirmed the direct binding of LECT2 to PHB2 ( Figure 8 C). Confocal microscopy showed co-localization of PHB2 and rLECT in neutrophils and human promyelocytic leukemia (HL60) cells, indicating an interaction between rLECT2 and PHB2 ( Figure 8 D).

[0040] 2.2 After adding rLECT2 to neutrophils, NETs generation increased significantly, including significant NETs immunofluorescence staining images ( Fig. 9 A) and a significant increase in ROS levels ( Fig. 9B).

[0041] 2.3 After knocking out PHB2, NETs generation was reduced and liver damage was alleviated: PHB2-siRNA1 and PHB2-siRNA2 were used to generate two PHB2 knockdown cell lines in differentiated human acute promyelocytic leukemia (dHL60) cells, and the detection found that the PHB2 content was significantly reduced ( Fig. 9 CD); After adding rLECT2 to PHB2-siRNA1, the generation of NETs decreased and the content of ROS decreased significantly ( Fig. 9 EF); After adding rLECT2 to PHB2-siRNA2, the generation of NETs decreased and the content of ROS decreased significantly ( Fig. 9 GH).

[0042] 2.4 The liver expresses LECT2 under the stimulation of alcohol. LECT2 binds to the neutrophil receptor PHB2, leading to increased production of NETs in neutrophils, which in turn aggravates liver damage. Therapeutic intervention of LECT2 by Lect2 shRNA can improve alcohol-induced liver damage ( Fig.10 ).

Claims

1. Application of LECT2 inhibitors in the preparation of drugs for intervening in the formation of neutrophil extracellular traps.

2. Application of LECT2 inhibitors in the preparation of drugs for preventing and treating alcoholic hepatitis.

3. Use of the LECT2 inhibitor according to claim 2 in the preparation of a medicament for preventing and treating alcoholic hepatitis, characterized in that: The LECT2 inhibitor is LECT2 shRNA, and its sequence is: GATCCGCTAACATATGTGCCAGCAAATCTTTGTGCTTAAGATTTGCTGGCACATATGTTAGCTTTTTTC positive chain; AATTCAAAAAAGCTAACATATGTGCCAGCAAATCTTAAGCACAAAGATTTGCTGGCACATATGTTAGCG reverse chain.

4. A LECT2 inhibitor, characterized in that The LECT2 inhibitor is LECT2 shRNA.

5. A method for preparing an adeno-associated virus that specifically inhibits the expression of LECT2 in the liver using the LECT2 inhibitor according to claim 4, characterized in that: The LECT2 shRNA is transfected into AAV-293 cells to prepare an adeno-associated virus that specifically inhibits the expression of LECT2 in the liver. The specific preparation method is as follows: (1) AAV-293 cells are revived and subcultured, and transfection is started after the cell density reaches a confluence rate of 90%; (2) A LECT2 inhibitory sequence is constructed, and the inhibitory sequence is GATCCGCTAACATATGTGCCAGCAAATCTTTGTGCTTAAGATTTGCTGGCACATATGTTAGCTTTTTTC (positive chain); AATTCAAAAAAGCTAACATATGTGCCAGCAAATCTTAAGCACAAAGATTTGCTGGCACATATGTTAGCG (reverse chain); (3) pAAV-RC, pHelper and shLECT2 are co-transfected into AAV-293 cells; (4) The AAV-293 cells in (3) are treated with omnipotent nuclease and column purified to obtain an adeno-associated virus that specifically inhibits the expression of LECT2.

Citation Information

Patent Citations

  • Biological markers, therapeutic targets and applications of liver fibrosis

    CN110646615B

  • Pharmaceutical composition for treating hepatic fibrosis by targeting blood vessels and application method thereof

    CN116510013A

  • Application of LECT2 as diagnosis and treatment target of hepatic ischemia reperfusion injury

    CN119552955A