Antibacterial peptide Clavanin A-1, coding gene and application of antibacterial peptide Clavanin A-1

Abstract

The invention relates to the technical field of biology, in particular to an antibacterial peptide Clavanin A-1, a coding gene and application of the antibacterial peptide Clavanin A-1. The invention provides an antibacterial peptide Clavanin A-1 which has good thermal stability, acid-base stability and endogenous protease degradation resistance, can obviously inhibit the growth of escherichia coli, salmonella and staphylococcus aureus, and has good application prospects in the fields of food, hygienic products, cosmetics, biopesticide, biological feed additives or natural food preservatives and the like. Wide application prospects are realized.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an antimicrobial peptide Clavanin A-1, a coding gene and an application thereof. Background Art

[0002] In animal husbandry, bacterial diseases such as bacterial diarrhea seriously endanger animal health and cause significant losses to animal husbandry. At present, antibiotics are mainly used to treat and prevent them, but the overuse and abuse of antibiotics continue to cause the emergence of drug-resistant strains and resistance, which in turn threatens human health. Antimicrobial peptides (AMPs) are short peptides produced by organisms, usually composed of 6-60 amino acids, with good acid-base stability and thermal stability. The multi-site targeting and rapid killing ability of AMPs do not allow the affected microorganisms to have enough time to acquire resistance to AMPs, which is one of the main mechanisms lacking in traditional antibiotics. In addition, AMPs may only act on eukaryotic cells infected by pathogens, but the fact that they have almost no side effects on healthy eukaryotic cells is also an important advantage. AMPs have aroused great interest in the scientific community due to their antibacterial, antifungal, antiviral and anticancer properties, and have been widely used in food engineering, drug therapy, medical devices and agriculture.

[0003] Clavanin A is a defensin derived from the invertebrate Styela clava. It is an α-helical antimicrobial peptide composed of 23 amino acid residues and shows antimicrobial activity comparable to magainins and cecropins. At present, Clavanin A is only obtained by chemical synthesis. Although chemical synthesis of antimicrobial peptides has a short cycle, small engineering workload, and can arbitrarily combine amino acid residues, it has the problem of racemization and high production cost. Genetic engineering technology mainly uses prokaryotic expression and eukaryotic expression pathways, and has the characteristics of simple operation, easy separation and purification, and low production cost, making it have the potential for large-scale and industrialized production, and has become a research hotspot in recent years. Therefore, it is of great significance to use biological genetic engineering technology to obtain a new antimicrobial peptide Clavanin A-1 with good thermal stability, acid-base stability and strong antimicrobial activity. Summary of the invention

[0004] In view of the shortcomings of the prior art, the present invention provides an antimicrobial peptide Clavanin A-1, a coding gene and its application, and proves that it has an inhibitory effect on Escherichia coli, Salmonella and Staphylococcus aureus, and has good thermal stability, acid-base stability and resistance to endogenous protease degradation.

[0005] To achieve the above object, the present invention provides an antimicrobial peptide Clavanin A-1, characterized in that it is a protein composed of the amino acids shown in SEQ ID NO.1; The antimicrobial peptide Clavanin A-1 protein can withstand a high temperature environment of pH 3-11, 90-95°C and endogenous protease degradation, and can be used in biotechnology fields such as the preparation of food, sanitary products, cosmetics, biological pesticides, biological feed additives or natural food preservatives.

[0006] In a second aspect, the present invention also provides a gene encoding an antimicrobial peptide Clavanin A-1, and further, the nucleotide sequence of the gene is the nucleotide sequence shown in SEQ ID NO. 2; It is well known to those skilled in the art that, since the same amino acid may be determined by a variety of different codons, the nucleotide sequence encoding the above-mentioned protein is not limited to just one type. It can be a nucleotide sequence that can also encode the mutant amino acid sequence of the present invention by mutating one or more nucleotides of the mutant nucleotide sequence shown in SEQ ID NO. 2 to form a synonymous mutation, or a nucleotide sequence that can encode the mutant amino acid sequence of the present invention can be designed based on codon optimization.

[0007] In the third aspect, the recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing the above gene also fall within the protection scope of the present invention.

[0008] In a fourth aspect, a method for preparing an antimicrobial peptide Clavanin A-1 also falls within the scope of protection of the present invention, comprising the following steps: fusing the coding gene of the antimicrobial peptide Clavanin A-1 with a SUMO fragment, constructing a recombinant expression vector, and introducing the recombinant expression vector into a host cell to obtain recombinantly expressed antimicrobial peptide Clavanin A-1.

[0009] Furthermore, the recombinant expression vector is selected from one or more of an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a phage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector; preferably, it is selected from pET-28a(+).

[0010] Furthermore, the recombinant bacteria or transgenic line used for recombinant expression of the antimicrobial peptide Clavanin A-1 is selected from one of Escherichia coli host cells, yeast host cells, Bacillus subtilis host cells, lactic acid bacteria host cells, actinomycete host cells, filamentous fungal host cells, insect cells, and mammalian cells; preferably, selected from BL21 (DE3).

[0011] In a fifth aspect, the present invention also provides the use of the antimicrobial peptide Clavanin A-1 in the preparation of food, sanitary products, cosmetics, biological pesticides, biological feed additives or natural food preservatives.

[0012] Furthermore, the antimicrobial peptide Clavanin A-1 is used to inhibit the growth of one or more bacteria among Escherichia coli, Salmonella and Staphylococcus aureus.

[0013] In a sixth aspect, an antibacterial drug comprising the antibacterial peptide Clavanin A-1 also falls within the protection scope of the present invention.

[0014] Beneficial effects: The present invention provides an antimicrobial peptide Clavanin A-1 with good thermal stability, acid-base stability and resistance to endogenous protease degradation, which can significantly inhibit the growth of Enterobacter, Salmonella and Staphylococcus aureus, and has broad application prospects in the fields of food, sanitary products, cosmetics, biological pesticides, biological feed additives or natural food preservatives. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the electrophoresis diagram for PCR amplification verification of the antimicrobial peptide Clavanin A-1 of the present invention; Figure 2 is the antibacterial activity diagram of Clavanin A-1 in the present invention; Figure 3 This is a pH stability diagram of the antimicrobial peptide Clavanin A-1 of the present invention; Figure 4 This is the thermal stability diagram of the antimicrobial peptide Clavanin A-1 of the present invention; Figure 5 The endogenous protease stability diagram of the antimicrobial peptide Clavanin A-1 of the present invention. DETAILED DESCRIPTION

[0016] In order to make those skilled in the art better understand the technical scheme of the present invention, the present invention is described in detail below in conjunction with specific embodiments. The experimental methods for which specific conditions are not indicated in the following examples are usually carried out under normal conditions or according to the conditions recommended by the manufacturer. The test materials used in the following examples, unless otherwise specified, are purchased from conventional biochemical reagent stores. Unless otherwise specified, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used in the text have the same meaning as those familiar to those skilled in the art. In addition, any method and material similar to or equal to the recorded content can all be applied to the present invention. The preferred implementation methods and materials described in the text are only for demonstration purposes.

[0017] Some experimental materials and reagents used in this invention: Strains and vectors: Escherichia coli BL21 (DE3) was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; pET-28a (+) expression vector was from Wuhan Miaoling Biotechnology Co., Ltd.

[0018] Enzymes and other biochemical reagents: ClonExpress II One Step Cloning Kit was purchased from Nanjing Novozymes Biotechnology Co., Ltd.; Nickel-NTA protein purification resin was purchased from QIAGEN; Pfu-Mix high-fidelity enzyme was purchased from Takara Biotechnology; porcine pepsin, trypsin and chymotrypsin were purchased from Shanghai Yuanye Biotechnology Co., Ltd.; others were domestic reagents (all available from ordinary biochemical reagent companies).

[0019] Culture medium: LB culture medium: Peptone 10 g, Yeast extract 5 g, NaCl 10 g, add distilled water to 1000 mL, pH natural (about 7.0). Solid culture medium is based on this and 2.0% (w / v) agar is added.

[0020] Example 1 Obtaining the gene encoding the antimicrobial peptide Clavanin A-1 The antimicrobial peptide Clavanin A (amino acid sequence as shown in SEQ ID NO.3) was downloaded from the antimicrobial peptide database (https: / / aps.unmc.edu / AP / ), and N14L, S20L, H21L, V22K and F23K of the antimicrobial peptide Clavanin A were mutated to obtain the antimicrobial peptide Clavanin A-1 (amino acid sequence as shown in SEQ ID NO.1). The amino acids of the antimicrobial peptide Clavanin A-1 were codon optimized to obtain the amino acids encoded by the antimicrobial peptide Clavanin A-1 (nucleotide sequence as shown in SEQ ID NO.2). The sequence encoded by Clavanin A-1 was synthesized and ligated to the pMD-19-T cloning vector to obtain the target fragment named Clavanin A-1, which has a length of 72 bp and a GC content of 43.48%.

[0021] Experimental Example 2 Construction and transformation of recombinant antimicrobial peptide Clavanin A-1 expression vector 2.1 Clavanin A-1-pMD-19-T was used as a template for PCR amplification. The amplification reaction system was: Pfu-Mix 12.5 μL, primers Clavanin A-1-F3 and Clavanin A-1-R4 1.5 μL each, plasmid template DNA 0.25 μL, and ddH2O was used to make up to 25 μL. The amplification reaction conditions were: denaturation at 95℃ for 30 sec; then denaturation at 95℃ for 30 sec, annealing at 52℃ for 30 sec, extension at 72℃ for 1 min, 30 cycles; insulation at 72℃ for 10 min, PCR product gel recovery, purification and recovery, and storage at -20℃ for future use.

[0022] Upstream primer Clavanin A-1-F3 (sequence as shown in SEQ ID NO.4): AGATTGGCGGCGCCACATATGTCTTCCAGTTCCTGGGTAAAATC Downstream primer Clavanin A-1-R4 (sequence as shown in SEQ ID NO.5): TGGTGGTGGTGGTGGTGCTCGAGTTATTTTTTCAGCAGGAAACCATG 2.2 SUMO family protein SMT3 (amino acid sequence as shown in SEQ ID NO.6) was downloaded from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), and its amino acid sequence was codon optimized. The sequence of the modified coding gene was synthesized and ligated to the pMD-19-T cloning vector. The obtained target fragment was named SUMO (nucleotide sequence as shown in SEQ ID NO.7), with a length of 303 bp.

[0023] 2.3 SUMO-pMD-19-T was used as a template for PCR amplification. The amplification reaction system was: 12.5 μL Pfu-Mix, 1.5 μL primers SUMO-F1 and SUMO-R2, 0.25 μL plasmid template DNA, and ddH2O was used to make up to 25 μL. The amplification reaction conditions were: denaturation at 95°C for 30 sec; then denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 1 min 30sec, 30 cycles; insulation at 72°C for 10 min, PCR product gel recovery, purification and recovery, and storage at -20°C for future use.

[0024] Upstream primer SUMO-F1 (sequence shown in SEQ ID NO.8): TGGTGCCGCGCGGCAGCCATATGATGAGTGATTCTGAAGTTAATCAA Downstream primer SUMO-R2 (sequence as shown in SEQ ID NO.9): TTACCCAGGAACTGGAAGACATATGTGGCGCCGCCAATCTGTTC 2.4 Using the target fragments recovered in 2.1 and 2.3 as templates, primers SUMO-F1 and Clavanin A-1-R4 were used to amplify the target fragment SUMO-Clavanin A-1 by PCR. The amplification reaction system was: 25.0 μL Pfu-Mix, 2.0 μL primers SUMO-F1 and Clavanin A-1-R4, 0.5 μL template SUMO and Clavanin A, and ddH 2 O was added to 50 μL. Amplification reaction conditions were as follows: 94°C for 5 min; 94°C for 30 sec, 63°C-49°C for 30 sec, 72°C for 1 min 30sec, for a total of 28 cycles, with the annealing temperature decreasing by 0.5°C in each cycle; 94°C for 30 sec, 49°C for 30 sec, 72°C for 1 min 30sec, for a total of 7 cycles; finally, 72°C for 10 min; 4°C for 10 min, the PCR product was recovered by gel purification and stored at -20°C for future use.

[0025] 2.5 The expression vector pET-28a(+) was digested with restriction endonucleases (NdeI and XhoI), and the digestion products of SUMO-Clavanin A-1 and pET-28a(+) after gel recovery and purification were connected with the recombinant enzyme of ClonExpress II One Step Cloning Kit to obtain the recombinant plasmid SUMO-Clavanin A-1-pET-28a(+) containing SUMO-Clavanin A-1; the nucleotide sequence of the recombinant SUMO-Clavanin A-1 is shown in SEQ ID NO.10; 2.6 The recombinant plasmid SUMO-Clavanin A-1-pET-28a(+) was transformed into Escherichia coli BL21(DE3) by heat shock to obtain the recombinant strain BL21(DE3) / SUMO containing SUMO-Clavanin A-1 -Clavanin A-1.

[0026] Experimental Example 3 Preparation of recombinant antimicrobial peptide Clavanin A-1 3.1 The recombinant strain BL21(DE3) / SUMO-Clavanin A-1 obtained in Example 2 was inoculated into LB (containing 50 μg / mL kanamycin) culture medium at an inoculum size of 2.0%, and activated by shaking in a shaker at 37°C and 200 rpm / min for 12-16 h.

[0027] 3.2 Inoculate the activated bacterial solution in 3.1 into fresh LB (containing 50 μg / mL kanamycin) culture medium at a 2.0% inoculum volume and culture in a shaker at 37°C and 200 rpm / min for about 3-4 h (OD 600nm After the culture medium was incubated at 16 °C for 20 h, IPTG was added at a final concentration of 0.6 mM for induction, and shaking culture was continued at 16 °C and 150 rpm / min in a shaker for about 20 h to induce the production of recombinant protein.

[0028] 3.3 Centrifuge at 4°C and 8000 rpm / min for 10 min to collect the cells. Suspend the cells with an appropriate amount of pH=7.0 citric acid-phosphate buffer and disrupt the cells by ultrasonic in a low-temperature water bath. Centrifuge the above intracellular concentrated crude enzyme solution at 13000 rpm / min for 15 min, aspirate the supernatant and affinity purify the target protein with Nickel-NTA Agarose and 0-500 mM imidazole.

[0029] The SDS-PAGE results of the purified protein are as follows Figure 1 As shown, M is a protein marker, and A-1 is a recombinant fusion antimicrobial peptide Clavanin A-1. The results show that the recombinant fusion antimicrobial peptide Clavanin A-1 has been expressed and purified, and the product is a single band.

[0030] Experimental Example 4 Investigation of the antibacterial activity of recombinant antimicrobial peptide Clavanin A-1 The antibacterial activity of the recombinant antimicrobial peptide Clavanin A-1 was determined using the inhibition zone method. The specific method is as follows: (1) Escherichia coli K88, Escherichia coli K99, Salmonella choleraesuis, Salmonella enteritidis, and Staphylococcus aureus were inoculated into 20 mL of liquid culture medium and cultured overnight at 37°C and 200 rpm / min in a shaking incubator. (2) 200 μL of the overnight cultured bacteria were inoculated into 20 mL of sterile culture medium and cultured at 37°C and 200 rpm / min for 0.5-1 h until the OD 600 was 0. nm At around 0.1, the bacterial cell concentration reaches about 1 × 10 8CFU / mL, which is the logarithmic growth phase or the pre-logarithmic growth phase; (3) Dip a small amount of bacterial solution with a sterile cotton swab and spread it on the LB solid culture medium; (4) Use tweezers to pick up a sterilized Oxford cup and place it evenly on the plate with the indicator bacteria, then pipette 50 μL of the recombinant antimicrobial peptide Clavanin A-1 sample into the Oxford cup, and use sterile water as a control; (5) After loading, place the plate horizontally in a 37°C incubator for 12 h to observe whether an inhibition zone is formed.

[0031] The results showed that the recombinant antimicrobial peptide Clavanin A-1 had inhibitory effects on Escherichia coli, Staphylococcus aureus and Salmonella ( Figure 2 ), while the control group sterile water had no inhibition zone, and the inhibition zone sizes of 40 μg / mL recombinant antimicrobial peptide Clavanin A-1 against Escherichia coli K88, Escherichia coli K99, Salmonella choleraesuis, Salmonella enteritidis and Staphylococcus aureus reached 12.00 mm, 14.00 mm, 15.00 mm, 13.00 mm and 20.00 mm, respectively.

[0032] Determination of the minimum inhibitory concentration (MIC) of the recombinant antimicrobial peptide Clavanin A-1: ​​The specific method for determining MIC is the micro-dilution method: the indicator bacteria are cultured in LB liquid medium until the logarithmic growth phase, and each bacterial cell is collected and diluted to a bacterial cell concentration of 1 × 10 8 CFU / mL for standby use. This step is the preparation of bacterial suspension; the purified antimicrobial peptide Clavanin A-1 solution is mixed with LB liquid culture medium in equal amounts in the first column of the 96-well plate until the starting concentration of the antimicrobial peptide sample is 200 μg / mL, and then continuously diluted twice in the subsequent columns to form a concentration gradient. An equal amount of diluted bacterial suspension is added to the samples of the concentration gradient of the 96-well plate, and incubated in a 37°C incubator for 16 h. After incubation, the turbidity of each well is observed by naked eye. The minimum concentration that can make the well clear is the MIC of the antimicrobial peptide Clavanin A-1 against each bacteria. The results are shown in Table 1. The recombinant antimicrobial peptide Clavanin A-1 has good inhibitory activity against all three bacteria. The recombinant antimicrobial peptide Clavanin A-1 has stronger inhibitory activity against Gram-positive bacteria, and the MIC against Staphylococcus aureus is 4.6875 μg / mL.

[0033] Table 1 Minimum inhibitory concentration of recombinant antimicrobial peptide Clavanin A-1 for different bacteria

[0034] Example 4 Stability determination of recombinant antimicrobial peptide Clavanin A-1 at different pH values The recombinant antimicrobial peptide Clavanin A-1 samples were placed in different buffer solutions with pH values ​​of 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 and 11.0 for 2 hours. The samples treated with different pH values ​​were used as test samples, and the untreated samples were used as controls to determine the bactericidal rate of Staphylococcus aureus (see Figure 3 The specific method for determining the bactericidal rate of Staphylococcus aureus is as follows: after Staphylococcus aureus is cultured to the logarithmic growth phase, the cells are collected by centrifugation at 10,000 rpm / min for 3 minutes, the cells are resuspended in an equal amount of 0.1 M PBS buffer, centrifuged, and the supernatant is removed. The above steps are repeated 3 times, and finally the cells are diluted with PBS buffer to a concentration of 1 × 10 8 CFU / mL bacterial suspension for later use; the antimicrobial peptide samples treated with different pH values ​​were mixed with the diluted Staphylococcus aureus suspension and lysed at 37°C for 1 hour, and the number of live bacteria in the lysed bacterial solution was counted using the dilution coating plate method; the untreated samples were used as the control, and the bactericidal rate of Staphylococcus aureus by the samples treated with different pH values ​​for 2 hours was calculated; bactericidal rate (%) = number of live bacteria in the treatment group / total number of colonies in the control group * 100%.

[0035] like Figure 3 As shown in the figure, the bactericidal rate of the recombinant antimicrobial peptide Clavanin A-1 against Staphylococcus aureus had almost no significant change after being treated with different pH values. After 2 hours of treatment at each pH value, the bactericidal rate against Staphylococcus aureus could still reach more than 87%, indicating that the recombinant antimicrobial peptide Clavanin A-1 has good acid-base tolerance.

[0036] Example 5 Investigation of the thermal stability of the recombinant antimicrobial peptide Clavanin A-1 The recombinant antimicrobial peptide Clavanin A-1 samples were heated at 25°C, 37°C, 50°C, 70°C, 90°C and 95°C for 30 min, and the heat-treated samples were used as test samples, and the unheat-treated samples were used as controls to determine the bactericidal rate of Staphylococcus aureus (see Figure 4 ).

[0037] like Figure 4 As shown in the data, the bactericidal rate of the recombinant antimicrobial peptide Clavanin A-1 against Staphylococcus aureus had almost no significant change after treatment at different temperatures. After treatment at high temperatures of 90°C and 95°C for 30 min, the bactericidal rates against Staphylococcus aureus remained at 88.64% and 87.54%, respectively, indicating that the recombinant antimicrobial peptide Clavanin A-1 has good thermal stability and can withstand high-temperature treatment in industrial processing.

[0038] Example 6 Investigation of the endogenous protease stability of the recombinant antimicrobial peptide Clavanin A-1 The recombinant antimicrobial peptide Clavanin A-1 samples were treated in a buffer solution containing 737.5 U / mL porcine pepsin, 760.0 U / mL trypsin, and 95.6 U / mL chymotrypsin for 4 hours. The samples treated with proteases were used as test samples, and the untreated samples were used as controls to determine the bactericidal rate of Staphylococcus aureus (see Figure 5 ).

[0039] like Figure 5 As shown, after being treated with 737.5 U / mL of porcine pepsin for 4 hours, the bactericidal rate of the recombinant antimicrobial peptide Clavanin A-1 against Staphylococcus aureus was 90.21%; after being treated with 760.0 U / mL of trypsin and 95.6 U / mL of chymotrypsin for 4 hours, the bactericidal rate against Staphylococcus aureus was still maintained above 90%, indicating that endogenous proteases in the porcine gastrointestinal tract have no effect on the bactericidal rate of the recombinant antimicrobial peptide Clavanin A-1.

[0040] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Under the guidance of the present invention, those skilled in the art can make a variety of similar expressions without violating the purpose and claims of the present invention, and such changes all fall within the protection scope of the present invention.

Claims

1. An antimicrobial peptide Clavanin A-1, characterized in that: It is a protein composed of the amino acids shown in SEQ ID NO.

1.

2. The coding gene of the antimicrobial peptide Clavanin A-1 according to claim 1, characterized in that: The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

2.

3. A recombinant vector, expression cassette, transgenic line or recombinant bacterium containing the gene according to claim 2 or 3.

4. A method for preparing an antimicrobial peptide Clavanin A-1, characterized in that: The coding gene according to claim 2 is fused with a SUMO fragment to construct a recombinant expression vector, which is introduced into a host cell to obtain the recombinantly expressed antimicrobial peptide Clavanin A-1.

5. The method according to claim 4, characterized in that The recombinant expression vector is selected from one or more of an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a bacteriophage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector.

6. The method according to claim 4, characterized in that The host cell is selected from one of Escherichia coli host cells, yeast host cells, Bacillus subtilis host cells, lactic acid bacteria host cells, actinomycete host cells, filamentous fungal host cells, insect cells and mammalian cells.

7. The method according to claim 4, characterized in that The recombinant expression vector is selected from pET-28a(+), and / or The host cell is selected from BL21 (DE3).

8. Use of the antimicrobial peptide Clavanin A-1 according to claim 1 in the preparation of foods, sanitary products, cosmetics, biological pesticides, biological feed additives or natural food preservatives.

9. The use according to claim 7, characterized in that: Used to inhibit the growth of one or more bacteria among Escherichia coli, Salmonella and Staphylococcus aureus.

10. An antibacterial drug, characterized in that: The invention comprises the antimicrobial peptide Clavanin A-1 as claimed in claim 1.

Images