Clostridium perfringens alpha toxin-ferritin nanoparticle antigen as well as preparation method and application thereof
Nanoparticle antigens were prepared by genetically engineered the αm2ST protein that expresses Clostridium perfringens and ferritin FeSC protein, and combined with traditional Chinese medicine adjuvants, which solved the problems of low immunogenicity and safety risks of existing vaccines, and achieved efficient immune stimulation and safe production.
Patent Information
- Application Number
- CN202510280104.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-11
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-03-11
AI Technical Summary
The existing Clostridium perfringen vaccine has problems such as low immunogenicity, safety risks and poor quality controllability, and it is difficult to effectively prevent the disease.
Nanoparticle antigens were prepared by genetic engineering expressing the αm2ST protein of C. perfringens and ferritin FeSC protein assembled and combined with Chinese medicine adjuvants to stimulate the body's immune response.
This method can effectively stimulate humoral and cellular immunity, improve the immunogenicity and safety of the vaccine, and reduce safety risks and costs in the production process.
Smart Images

Figure CN120098144A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of Clostridium perfringens antigens, and in particular to a Clostridium perfringens alpha toxin-ferritin nanoparticle antigen and a preparation method and application thereof. Background Art
[0002] Clostridium perfringens, also known as Clostridium weiyi, is an anaerobic Gram-positive bacterium that exists in various environments and often settles in the intestines of healthy animals and humans in an asymptomatic manner. When the body's immune function declines, it can cause diseases such as gas gangrene, necrotizing enteritis and enterotoxemia. The pathogenic mechanism of this bacterium is related to the at least 15 exotoxins and invasive enzymes it secretes, with α (alpha), β (beta), ε (epsilon) and ι (iota) being the main pathogenic toxins. And according to the secretion of exotoxins, Clostridium perfringens can be divided into six types AG. Among them, all strains of Clostridium perfringens will produce α toxin, which is lethal, hemolytic and gangrenous, causing diseases such as sheep anthrax, sheep rapid disease and sheep enterotoxemia, which seriously affects the development of animal husbandry economy.
[0003] Previously, antibiotics were added to feed to prevent Clostridium perfringens infection, but due to drug resistance issues, my country has explicitly banned the use of growth-promoting drugs other than traditional Chinese medicine ingredients in feed, so vaccination has become one of the effective measures to prevent the disease. At present, the clostridial vaccines approved for use in my country are mainly multivalent vaccines, such as sheep blight, sudden anthrax, lamb dysentery, and enterotoxemia triple quadruple inactivated vaccines. Such vaccines are mainly composed of toxins, with large batch differences, low immunogenicity, time-consuming and labor-intensive, and safety risks in the production process. Therefore, it is crucial to develop a vaccine with high immunogenicity, safety, and controllable quality.
[0004] Among them, it is an important strategy to express the main toxins of Clostridium perfringens through genetic engineering to make subunit vaccines. At least 15 exotoxins of Clostridium perfringens are related to invasive enzymes, and α (alpha), β (beta), ε (epsilon) and ι (iota) are the main pathogenic toxins. Different toxin subunit vaccines are developed based on the prevalence of subtypes in different regions. However, traditional protein-based antigens have poor immunogenicity and still cannot meet the prevention of Clostridium perfringens disease. Summary of the invention
[0005] The technical problem to be solved by the present invention is to provide a Clostridium perfringens alpha toxin-ferritin nanoparticle antigen, which can effectively stimulate the body's humoral immunity and cellular immunity, and provide a new idea for the development of Clostridium perfringens subunit vaccine.
[0006] The technical problem to be solved by the present invention is to provide a method for preparing Clostridium perfringens alpha toxin-ferritin nanoparticle antigen, which can effectively stimulate the body's humoral immunity and cellular immunity, and provide a new idea for the development of Clostridium perfringens subunit vaccine.
[0007] In order to solve the above technical problems, the present invention provides a Clostridium perfringens alpha toxin-ferritin nanoparticle antigen, wherein the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen is composed of αm 2 ST protein and FeSC protein are assembled, and the αm 2 The ST protein is obtained by expressing an α protein mutant expression plasmid, and the FeSC protein is obtained by expressing a ferritin expression plasmid. The nucleotide sequence of the α protein mutant expression plasmid is shown in SEQ ID NO: 1, and the nucleotide sequence of the ferritin expression plasmid is shown in SEQ ID NO: 2.
[0008] In some embodiments, the α protein mutant expression plasmid is prepared by the following method:
[0009] The nucleotide sequence is α shown in SEQ ID NO: 3 m2 The ST gene was inserted into the pET28a vector to obtain the α protein mutant expression plasmid.
[0010] In some embodiments, the ferritin expression plasmid is prepared by the following method:
[0011] The FeSC gene with the nucleotide sequence shown in SEQ ID NO: 4 was inserted into the pET28a vector to obtain a ferritin expression plasmid.
[0012] Accordingly, the present invention also provides a vaccine, comprising the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen.
[0013] In some embodiments, the vaccine further includes a Chinese herbal medicine aqueous adjuvant, which includes, by weight: 10 to 15 parts of astragalus polysaccharide, 4 to 10 parts of cinnamon essential oil, and 1000 to 1100 parts of physiological saline.
[0014] In some embodiments, the mass ratio of the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen to the traditional Chinese medicine water adjuvant is 1:(1-2).
[0015] Furthermore, the present invention also provides the use of the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen in (1) or (2):
[0016] (1) Application in the preparation of anti-Clostridium perfringens specific antibodies;
[0017] (2) Application in the preparation of vaccines for preventing diseases caused by Clostridium perfringens.
[0018] Finally, in order to solve the above problems, the present invention provides a method for preparing Clostridium perfringens alpha toxin-ferritin nanoparticle antigen, comprising the following steps:
[0019] Constructing an α protein mutant expression plasmid with a nucleotide sequence as shown in SEQ ID NO: 1;
[0020] constructing a ferritin expression plasmid with a nucleotide sequence as shown in SEQ ID NO: 2;
[0021] The α protein mutant expression plasmid is expressed to obtain α m2 ST protein;
[0022] The ferritin expression plasmid is expressed to obtain FeSC protein;
[0023] The α m2 The ST protein and the FeSC protein are assembled to obtain the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen.
[0024] In some embodiments, the α protein mutant expression plasmid is constructed by the following method:
[0025] The alpha toxin gene was amplified from the type A strain of Clostridium perfringens;
[0026] The α toxin gene is cloned into the pET 28a vector to obtain the pET-α plasmid;
[0027] The aspartic acid at position 56 and the histidine at position 68 of the α toxin gene in the pET-α plasmid were mutated into glycine to obtain pET-α m2 Plasmids;
[0028] In the pET-α m2 A Spytag molecular docking tag was added to the plasmid to obtain an α protein mutant expression plasmid.
[0029] In some embodiments, the ferritin expression plasmid is constructed using the following method:
[0030] Add a 6*His sequence to the 5' end of the Ferritin gene sequence and a (G 4 S) 3 The Linker sequence and SpyCatcher sequence were codon optimized and cloned into the pET28a vector to obtain the ferritin expression plasmid.
[0031] The implementation of the present invention has the following beneficial effects:
[0032] The Clostridium perfringens alpha toxin-ferritin nanoparticle antigen provided by the present invention is arranged on the surface of a substrate. The Clostridium perfringens alpha toxin-ferritin nanoparticle antigen produces an unexpected immune effect, which can effectively stimulate humoral immunity while also effectively stimulating cellular immunity.
[0033] The present invention provides a method for preparing a Clostridium perfringens alpha toxin-ferritin nanoparticle antigen, which comprises fusing SpyTag and SpyCatcher to the ends of alpha toxin and ferritin, respectively, adding a 6His purification tag and expressing them separately, and after purification, docking 6His-alpha toxin-SpyTag and ferritin 6His-protein-SpyCatcher in vitro through SpyTag and SpyCatcher coupling technology, thereby successfully preparing a highly expressed and highly soluble alpha toxin-ferritin nanoparticle antigen. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.
[0035] Figure 1 is pET-α in Example 1 of the present invention m2 Identification results of ST vectors;
[0036] Among them, 1. pET28a plasmid control; 2. pET-α m2 ST plasmid;
[0037] Figure 2 is α in Example 1 of the present invention m2 Expression and identification results of ST protein and FeSC protein;
[0038] Among them, a.α m2 ST protein SDS-PAGE identification; b. FeSC protein SDS-PAGE identification; c. α m2 Western blot identification of ST protein; d. Western blot identification of FeSC protein;
[0039] In Figures a and b: M. Protein Marker; 1. Uninduced bacterial lysate; 2. Supernatant of induced bacterial lysis; 3. Precipitate of induced bacterial lysis;
[0040] In Figure c and Figure d: M. Protein Marker; 1. Precipitate from bacterial lysis after induction; 2. Supernatant from bacterial lysis after induction;
[0041] Figure 3 The FeSC protein and α m2 Figure 1. ST protein purification results.
[0042] Among them, a. SDS-PAGE image of purified FeSC protein; b. purified α m2 SDS-PAGE image of ST protein;
[0043] In Figures a and b: 1. Supernatant before purification; 2. Flow-through; 3. 20mmol / L imidazole eluate; 4. 40mmol / L imidazole eluate; 5-10. 250mmol / L imidazole eluate;
[0044] Figure 4 is α in Example 1 of the present invention m2 Analysis of the toxicity of ST protein to Hela cells;
[0045] Among them, a. CPE picture (1. 1MLD of type A natural toxin; 2. 50μg of α m2 ST protein test group; 3. Containing 25 μg of α m2 ST protein test group; 4. DMEM (0.5% FBS) culture medium)
[0046] b. Cytotoxicity test results;
[0047] Figure 5 is α in Example 1 of the present invention m2 ST protein phosphatase activity assay;
[0048] Among them, aA type natural toxin (original times); bA type natural toxin (1MLD); c.α m2 ST protein solution; d. Meat liver and peptic ulcer digestion broth medium;
[0049] Figure 6 The hemolytic analysis results in Example 1 of the present invention;
[0050] Among them, a. Hemolytic activity test diagram; b. Hemolysis schematic diagram;
[0051] Figure 7 is α in Example 1 of the present invention m2 -Identification results of Fe nanoparticles;
[0052] Among them, a.α m2 -Fe docking product SDS-PAGE identification diagram (1.α m2 -Fe docking product; 2.FeSC protein; 3.α m2 ST protein);
[0053] b. α under transmission electron microscopym2 -Fe nanoparticles (70000×);
[0054] c.α m2 -Dynamic light scattering pattern of Fe nanoparticles;
[0055] Figure 8 The IgG antibody titer test result in Example 1 of the present invention;
[0056] Fig. 9 The results of the IgG subtype antibody level analysis in Example 1 of the present invention;
[0057] Among them, a. IgG1 antibody level; b. IgG2a antibody level; c. IgG1 / IgG2a ratio;
[0058] Fig.10 is the neutralization titer of the serum 21 days after the second immunization in Example 1 of the present invention;
[0059] Fig.11 is the expression level of IFN-γ in Example 1 of the present invention;
[0060] Fig.12 This is the T cell subset analysis in Example 1 of the present invention;
[0061] Fig.13 The ELISA antibody level after sheep immunization in Example 1 of the present invention;
[0062] Fig.14 It is the neutralization titer of the sheep serum after the second immunization in Example 1 of the present invention. DETAILED DESCRIPTION
[0063] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. Examples of the embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals throughout represent the same or similar elements or elements with the same or similar functions. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention. In addition, it should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.
[0064] In the present invention, "preferred" and "better" are only used to describe implementation methods or embodiments with better effects, and it should be understood that they do not constitute a limitation on the scope of protection of the present invention. In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features. In the present invention, when involving numerical ranges, unless otherwise specified, the two endpoints of the numerical range are included.
[0065] In order to solve the above technical problems, the present invention provides a Clostridium perfringens alpha toxin-ferritin nanoparticle antigen, wherein the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen is composed of αm 2 ST protein and FeSC protein are assembled, and the αm 2 The ST protein is obtained by expressing an α protein mutant expression plasmid, and the FeSC protein is obtained by expressing a ferritin expression plasmid. The nucleotide sequence of the α protein mutant expression plasmid is shown in SEQ ID NO: 1, and the nucleotide sequence of the ferritin expression plasmid is shown in SEQ ID NO: 2.
[0066] The alpha toxin of Clostridium perfringens is the main virulence factor in the infection process of Clostridium perfringens. It is a zinc metalloenzyme composed of 370 amino acids, which is mainly divided into two domains: the catalytic N-terminus and the membrane-bound C-terminus. Only the latter has immune protection. It is lethal, hemolytic and gangrenous, which seriously affects the development of animal husbandry. Since the toxin has no characteristic symptoms when infecting animals, vaccination is one of the effective measures to prevent the disease. The key to the research of genetic engineering subunit vaccines is the screening of immunogens. How to greatly reduce its toxicity while retaining immunogenicity is the key to preparing immunogens.
[0067] The SpyTag / SpyCatcher binding system is a protein connection technology. It was discovered that the fibronectin FbaB of Streptococcus pyogenes contains a domain with a spontaneous isopeptide bond between lysine and aspartic acid. Therefore, a short peptide SpyTag containing 13 amino acids was designed. It can form an amide bond with SpyCatcher within minutes. It can be simply mixed together under different pH, temperature and buffer conditions, has a high reaction yield, and will not be reversed by competing peptides. It is highly efficient, specific and universal.
[0068] This application successfully prepared α m2 After the ST protein and FeSC protein were synthesized, the α-toxin-ferritin of Clostridium perfringens was successfully prepared by SpyTag / SpyCatcher (hereinafter referred to as α-toxin-ferritin of Clostridium perfringens). m2 -Fe) nanoparticle antigen, mouse experiments confirmed α m2 -Fe nanoparticle antigens can effectively stimulate the body's humoral immunity and cellular immunity, providing new ideas for the development of Clostridium perfringens subunit vaccines.
[0069] In some embodiments, the α protein mutant expression plasmid is prepared by the following method:
[0070] The nucleotide sequence is α shown in SEQ ID NO: 3 m2The ST gene was inserted into the pET28a vector to obtain the α protein mutant expression plasmid.
[0071] It should be noted that the present application mutates the aspartic acid at position 56 and the histidine at position 68 of the alpha toxin of Clostridium perfringens type A into glycine. The two amino acids at positions 56 and 68 are both Zn in the N-terminal enzyme active center of the alpha toxin. 2+ Binding site, where substitution of D-56 leads to complete loss of hemolysis, PLC and SMase activities, while maintaining antigenicity; mutation of H-68 leads to complete loss of toxin hemolysis, phospholipase C, sphingomyelinase and lethal activities. m2 ST protein, proved by experiments, α m2 ST protein has no phosphatidylcholine and lysozyme activity within the detection range, and is not lethal to Hela cells, indicating that α m2 The ST protein has been successfully attenuated and has good safety.
[0072] In some embodiments, the ferritin expression plasmid is prepared by the following method:
[0073] The FeSC gene with the nucleotide sequence shown in SEQ ID NO: 4 was inserted into the pET28a vector to obtain a ferritin expression plasmid.
[0074] It should be noted that the applicant has provided a method for preparing ferritin in the Chinese patent application number: 202410985783.7, namely, "A method for preparing Clostridium perfringens epsilon toxin-ferritin nanoparticle antigen", but it was found that the ferritin in the above-mentioned public scheme is different from α m2 The docking efficiency of ST is very low. Therefore, in the present application, the FeSC fusion gene sequence is further optimized. The inventors found that the FeSC gene with a nucleotide sequence such as SEQ ID NO: 4 can significantly improve the binding of ferritin to α m2 Docking efficiency of ST.
[0075] Accordingly, the present application also provides a vaccine, comprising the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen.
[0076] In some embodiments, the vaccine further comprises a Chinese medicine water adjuvant, which comprises, by weight: 10 to 15 parts of astragalus polysaccharide, 4 to 10 parts of cinnamon essential oil, and 1000 to 1100 parts of normal saline. Preferably, the mass ratio of the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen to the Chinese medicine water adjuvant is 1:(1 to 2).
[0077] It should be noted that in the preparation of subunit vaccines, oil adjuvants are often added for emulsification to enhance the immune effect. However, oil adjuvants have large side effects and are prone to cause severe inflammatory reactions at the injection site, affecting the use of meat. The present application uses a Chinese medicine water adjuvant with a specific composition and is mixed with Clostridium perfringens α-toxin-ferritin nanoparticle antigen to improve the immune effect. The Chinese medicine water adjuvant provided in the present application includes astragalus polysaccharides and cinnamon essential oil, which have multiple functions such as anti-inflammatory and immunity enhancement. Components such as polysaccharides, saponins, and flavonoids can effectively promote immune responses, enhance cellular and humoral immune responses, reduce antigen dosage, and prolong immune protection time without significant side effects. Moreover, astragalus and cinnamon are both common medicinal materials in my country, with large yields and good materials. Important components such as astragalus polysaccharides and cinnamon essential oil can be extracted. The use of Chinese medicine water adjuvant vaccines has significant advantages in application. It can be easily prepared in the field, and is easy to quickly mix with other water-based vaccines for joint immunization, avoiding the complex emulsification process of oil adjuvant vaccines and the destruction of antigens during the emulsification process.
[0078] Furthermore, the present application provides the use of the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen in (1) or (2):
[0079] (1) Application in the preparation of anti-Clostridium perfringens specific antibodies;
[0080] (2) Use in the preparation of drugs for preventing diseases caused by Clostridium perfringens.
[0081] Accordingly, the present invention provides a method for preparing Clostridium perfringens alpha toxin-ferritin nanoparticle antigen, comprising the following steps:
[0082] Constructing an α protein mutant expression plasmid with a nucleotide sequence as shown in SEQ ID NO: 1;
[0083] constructing a ferritin expression plasmid with a nucleotide sequence as shown in SEQ ID NO: 2;
[0084] The α protein mutant expression plasmid is expressed to obtain α m2 ST protein;
[0085] The ferritin expression plasmid is expressed to obtain FeSC protein;
[0086] The α m2 The ST protein and the FeSC protein are assembled to obtain the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen.
[0087] In some embodiments, the method for constructing the expression plasmid of the α protein mutant of Clostridium perfringens type A comprises the following steps:
[0088] The alpha toxin gene was amplified from the type A strain of Clostridium perfringens;
[0089] The α toxin gene is cloned into the pET 28a vector to obtain the pET-α plasmid;
[0090] The aspartic acid at position 56 and the histidine at position 68 of the α toxin gene in the pET-α plasmid were mutated into glycine to obtain pET-α m2 Plasmids;
[0091] In the pET-α m2 A Spytag molecular docking tag was added to the plasmid to obtain an α protein mutant expression plasmid.
[0092] In some embodiments, the amplifying the alpha toxin gene from the type A Clostridium perfringens strain comprises:
[0093] The genomic DNA of Clostridium perfringens type A was used as a template and PCR amplification was performed with primers α-F and α-R to obtain the α-toxin gene.
[0094] In some embodiments, the cloning of the alpha toxin gene into the pET 28a vector to obtain the pET-alpha plasmid comprises the following steps:
[0095] Using pET28a plasmid as template, PCR amplification was performed with primers pET-F and pET-R to obtain the target vector;
[0096] The α toxin gene and the target vector are homologously recombined and transformed into DH5α competent cells. After culture, single clones are picked and colony PCR screening is performed using pET28a universal primers. Positive colonies are cultured and amplified to obtain pET-α plasmids.
[0097] Specifically, the sequence of primer pET-F is: CAAAGCCCGAAAGGAAGCTGAGTTGGC; the sequence of primer pET-R is: GTGATGATGATGATGATGGCTGCTGCCC.
[0098] In some embodiments, the aspartic acid at position 56 and the histidine at position 68 of the α toxin gene in the pET-α plasmid are mutated to glycine to obtain pET-α m2 Plasmid, comprising the following steps:
[0099] The pET-α plasmid was used as a template and primers α m2 -F and primer α m2-R was amplified by PCR, transformed into DH5α competent cells, and single clones were picked after culture. Colony PCR screening was performed using pET28a universal primers. The positive colonies were cultured and amplified to obtain pET-α m2 Plasmid.
[0100] In some embodiments, the pET-α m2 Adding a Spytag molecular docking tag to the plasmid to obtain an α protein mutant expression plasmid of type A Clostridium perfringens includes the following steps:
[0101] The pET-α m2 The plasmid was used as a template, PCR amplification was performed with primers α-ST-F and α-ST-R, and the plasmid was transformed into DH5α competent cells. After culture, a single clone was picked and colony PCR screening was performed with pET28a universal primers. After culturing and amplifying the positive colonies, the α protein mutant expression plasmid of type A Clostridium perfringens was obtained.
[0102] In some embodiments, constructing a ferritin expression plasmid comprises:
[0103] Add a 6*His sequence to the 5' end of the Ferritin gene sequence and a (G 4 S) 3 The Linker sequence and SpyCatcher sequence were codon optimized and cloned into the pET28a vector to obtain the ferritin expression plasmid.
[0104] In some embodiments, the α protein mutant expression plasmid of type A Clostridium perfringens is transformed into BL21 (DE3) competent cells, and the expression is induced by IPTG to obtain α m2 ST protein;
[0105] The ferritin expression plasmid was transformed into BL21 (DE3) competent cells and induced with IPTG to obtain FeSC protein.
[0106] In some embodiments, the α m2 After purification, the ST protein and the FeSC protein are mixed in a molar ratio of 1.5:1 to 2.5:1, and allowed to stand in a constant temperature box at 35° C. to 38° C. to obtain Clostridium perfringens alpha toxin-ferritin nanoparticle antigen.
[0107] The following describes the invention in conjunction with specific embodiments.
[0108] Example 1
[0109] This embodiment provides a method for preparing Clostridium perfringens alpha toxin-ferritin nanoparticle antigen, comprising:
[0110] Materials and Methods
[0111] (1) Test materials
[0112] Type A Clostridium perfringens strain C57-55, Type A Clostridium perfringens natural toxin (Note: The concentration of type A natural toxin toxicity to Hela cells is 512MLD 100μL -1 ), Hela cells, and pET-28a vectors were all preserved in this experiment; DH5α and BL21 (DE3) were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; Primescript RT Master Mix (high-fidelity enzyme) was purchased from Baoriyi Biotechnology (Beijing) Co., Ltd.; restriction endonucleases DpnI and T 4 Polynucleotide kinase, T 4 Ligase was purchased from NEB; 180 kDa prestained protein marker, multi-fragment rapid cloning kit, and SuperPico ECL Master Mix were purchased from Nanjing Novozymes Biotechnology Co., Ltd.; plasmid mini-preparation and midi kit were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Ni NTA Beads were purchased from Beijing Dinning Biotechnology Co., Ltd.; monoclonal mouse anti-6*His antibody was purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd.; mouse Ig subclass enzyme-labeled secondary antibody kit; HRP-labeled goat anti-mouse IgG was purchased from Beijing Zhongyuan Heju Biotechnology Co., Ltd.; flow cytometry antibodies were purchased from Cytek Bioscience (Tonbo), USA; red blood cell lysate, Mouse IFN-gamma ELISA Kit, and single-component TMB were all purchased from Beijing Solebao Technology Co., Ltd.; others were commercial reagents.
[0113] Balb / C mice aged 6 to 8 weeks were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.
[0114] The 3-month-old sheep come from the applicant's self-breeding and self-feeding group.
[0115] Preparation of Chinese medicine water adjuvant: Take 10 g of astragalus polysaccharide and 5 ml of cinnamon essential oil, add 1000 mL of normal saline to dissolve.
[0116] (2) Construction of expression plasmid for α-protein mutant of Clostridium perfringens type A
[0117] Using the type A Clostridium perfringens C57-55 strain as a template, α-F and α-R (sequences shown in Table 1) were used for PCR amplification, and the obtained target bands were recovered by gel recovery;
[0118] Using pET28a plasmid as template, use pET-F and pET-R primers for amplification, take 43 μL PCR product, add 5 μL rCutSmart bufffer, and then add 2 μL DpnI enzyme to digest at 37°C for 2h, perform agarose gel electrophoresis, cut the correct band and recover the gel.
[0119] Use the Multi-Fragment Rapid Cloning Kit for homologous recombination and transform into DH5α competent cells. Pick single clones after culturing at 37°C, and use pET28a universal primers for colony PCR screening. After the positive colonies are cultured and amplified at 37°C, they are sent to the company for sequencing. The correctly sequenced plasmid is named pET-α.
[0120] The pET-α plasmid with correct sequencing was used as template. m2 -F and α m2 -R primers were used for amplification, and the ligation and transformation process was the same as above. The positive colonies were sent to the company for sequencing, and the plasmid with the correct sequencing was named pET-α m2 .
[0121] pET-α m2 Plasmid was used as template and amplified using α-ST-F and α-ST-R primers (with Spytag docking tag sequence added) (see Table 1). PCR reaction conditions and digestion treatment were the same as above, column recovery, and the recovered product was added with PNK enzyme and 10*Buffer for T 4 DNA ligase with 10mM ATP was added at 37℃ for 30min for phosphorylation. 4 Ligase, 16℃30min for ligation. Transformation and sequencing were the same as above, and the plasmid with correct sequencing was named pET-α m2 ST.
[0122] Table 1 Primer sequences
[0123]
[0124] Note: Underscore Sequence It is the overlapPCR complementary sequence; the italic sequence is the Spytag sequence; the bold sequence is the D56G and H68G point mutation sequence.
[0125] α m2 Results of prokaryotic expression vector construction of ST toxin mutants
[0126] Use pET28a universal primers to pET-α m2 PCR was performed by ST, and agarose gel electrophoresis was performed using the pET28a empty plasmid as a control. m2 After PCR of ST plasmid, a target band of about 1100 bp appeared. Figure 1 As shown, it is consistent with expectations.
[0127] (3) Construction of ferritin expression plasmid
[0128] Referring to the Ferritin gene sequence (GenBank No: WP_120857832.1), a 6*His sequence was added to the 5' end of the gene and a (G 4 S) 3 Linker sequence and SpyCatcher sequence. After codon optimization, it was sent to Shanghai Sangon Biotechnology Co., Ltd. for synthesis and cloned into pET28a vector. The correct plasmid was named: pET-FeSC.
[0129] (4) Expression and identification of recombinant proteins
[0130] pET-α m2 ST and pET-FeSC plasmids were transformed into BL21 (DE3) competent cells, induced with IPTG at 28 ° C, and the cells were collected. After ultrasonic disruption, the supernatant and precipitate were collected respectively, and the expression of recombinant protein was detected by SDS-PAGE electrophoresis. The expression of recombinant protein was identified by Western blot, in which the primary antibody was mouse anti-His with a dilution of 1:5000, and the secondary antibody was goat anti-mouse IgG, HRP labeled (1:2000 dilution). The target proteins were named α m2 ST, FeSC.
[0131] α m2 Results of prokaryotic expression and identification of ST toxin mutants and ferritin
[0132] The results of SDS-PAGE electrophoresis and Western blot showed that α m2 ST protein was expressed in both the bacterial supernatant and the precipitate, with a relative molecular mass of approximately 42 kDa, which was consistent with the expected molecular mass; FeSC protein was expressed in both the bacterial supernatant and the precipitate, with the expression level in the bacterial supernatant being the highest, with a relative molecular mass of approximately 36 kDa, which was consistent with the expected molecular mass. The specific results are as follows: Figure 2 shown.
[0133] (5)α m2 Purification of ST protein and FeSC
[0134] The soluble target band in the supernatant of bacterial lysis was purified according to the instruction manual of the Ni-Beads affinity chromatography medium kit, and the protein concentration was determined using a protein concentration determination kit after SDS-PAGE gel electrophoresis analysis, and stored at -80°C for future use.
[0135] Ni NTA Beads were used to detect α m2 ST protein and FeSC protein were purified separately, and the eluate with higher purity was collected for dialysis. The final FeSC protein concentration was 1.39 μg·μL -1 ; α m2 The ST protein concentration was 0.353 μg·μL -1 , the specific results are as follows Figure 3 shown.
[0136] (6)α m2 Toxicity analysis of ST protein
[0137] 6.1, α m2 ST cytotoxicity assay
[0138] 1) Cytotoxicity assay
[0139] The well-growing Hela cells were trypsinized and counted, and the cell density was adjusted to 1.8×10 5 mL -1 , transferred to a 96-well plate, 100 μL per well, and placed in a constant temperature incubator (37°C, 5% CO 2 ) for 12 h. Then, the natural toxin type A was diluted to 10 MLD ml with DMEM medium (containing 0.5% FBS). -1 , α m2 ST protein to 500 μg ml -1 and 250 μg ml -1 , 100 μL of culture medium was added to each well to replace the original culture medium. Eight replicates were set up for each group, and a culture medium control was also set up.
[0140] 37°C, 5% CO 2 Observe after 24 h of culture.
[0141] 2) Cytotoxicity assay results
[0142] After adding each component, Hela cells were cultured for 24 hours and observed under a microscope. It was found that the cells in the group inoculated with 1 MLD of type A natural toxin showed obvious shrinkage and the intercellular space increased ( Figure 4 -a-1); inoculation of 50μg and 25μgα m2 The experimental group of ST protein ( Figure 4 -a-2, Figure 4 -a-3), DMEM medium (containing 0.5% FBS) Figure 4 -a-4) cells grew well, and the number of cytopathic effects was counted ( Figure 4 -b), indicating α m2 The toxicity of ST protein has been lost.
[0143] 6.2, α m2 ST lecithinase activity test
[0144] 1) Lecithinase activity assay
[0145] α-toxin has phosphatidylcholine activity, which can specifically hydrolyze phosphatidylcholine in egg yolk into phosphatidylcholine and 1,2-diglyceride, producing white turbidity. Reference: Add the original A-type natural toxin, the diluted A-type natural toxin (100 MLD ml -1 ), α m2 ST protein (250 μg ml -1 ), 10 μL of meat, liver and peptic ulcer digestion broth culture medium, let it stand at 37℃ for 12h, and then observe whether white turbid spots appear at the place where the drops were added.
[0146] 2) Lecithinase activity assay results
[0147] The area on the egg yolk agar plate where the original A-type natural toxin and 1MLD A-type natural toxin were dropped appeared white turbidity ( Figure 5 -a, Figure 5 -b), and adding α m2 No white turbid spots appeared in the area of ST protein and meat liver and peptic ulcer digestion broth medium ( Figure 5 -c, Figure 5 -d), indicating α m2 The phosphatase activity of ST protein has been lost.
[0148] 6.3, α m2 ST hemolytic activity test
[0149] 1) Hemolytic activity assay
[0150] According to the method in the literature, 1% sheep red blood cell suspension was prepared with normal saline and dispensed into 2 mL EP tubes and 800 μL tubes. -1 . Add the original type A natural toxin, diluted type A natural toxin (10MLDml -1 ), α m2 ST protein (250 μg ml -1 ), 100 μL of PBS solution each, three replicates per group, mixed well, and cultured in a 37°C water bath for 30 min at 1500 r·min -1 After centrifugation for 10 min, the supernatant was placed in a 96-well plate and the absorbance was measured at 540 nm.
[0151] 2) Hemolytic activity assay results
[0152] According to the literature method, the hemolytic activity was tested. It can be seen that the supernatant of the original type A natural toxin and 1MLD type A natural toxin turned red, that is, the red blood cells were hemolyzed, and α m2 ST protein and PBS solution supernatant did not turn red ( Figure 6 -b). Then the hemolysis percentage of each group was calculated according to the literature formula for quantitative analysis. The hemolysis percentage of type A natural toxin at the original and 1 MLD levels was greater than 95%, while that of type α m2 The hemolysis percentages of ST protein and PBS solution were both less than 0, indicating that α m2 The hemolytic activity of ST protein has been lost.
[0153] (7) Clostridium perfringens α-toxin-ferritin nanoparticle antigen (α m2 -Fe nanoparticle protein) preparation and identification
[0154] 1) Nanoparticle antigen preparation and identification methods
[0155] α m2 ST protein and FeSC protein were mixed in a molar ratio of 2:1 and incubated in a 37°C incubator for 2 h. After incubation, SDS-PAGE electrophoresis was used for verification. The docking product was named α m2 -Fe.
[0156] The docking product was diluted to a concentration of approximately 0.1 μg mL -1 , 10 μL of the docking product dilution was added to the pre-treated copper grid, first soaked with the dye solution for 1 min, then washed twice with distilled water, left to air-dry for 5 to 10 min, and observed with a transmission electron microscope (Hitachi TEM system).
[0157] The docking product was diluted to a concentration of approximately 0.3 μg mL -1 The measurement was repeated three times using a potentiometer (Nano ZS), with 20 acquisition points each time, 5 seconds each time, and a temperature of 25°C. The automatic attenuation of the laser was used to analyze the size distribution of the particles.
[0158] 2) α m2 -Identification results of Fe nanoparticles
[0159] α m2 After the ST protein and FeSC protein were incubated at 37°C, samples were taken and tested by SDS-PAGE electrophoresis. It was found that there was an obvious band at 110 kDa ( Figure 7 a). By observing under an electron transmission microscope, a large number of cage-like spherical particle structures of different sizes can be seen in the field of view ( Figure 7 b) and dynamic light scattering was used to test the FeSC protein and α m2-Fe docking product for particle size analysis ( Figure 7 c), the results showed that the particle size of FeSC protein ranged from 11.7 to 15.7 nm, α m2 The particle size range of the -Fe docking product is 32.7-50.7 nm, with the main peak at 37.8 nm, which indicates that α m2 ST protein successfully docked with FeSC protein to form α m2 -Fe nanoparticles.
[0160] (8) Immunogenicity analysis
[0161] 8.1 Antigen processing and immunization
[0162] α m2 ST antigen and α m2 -Fe docking products are all α m2 ST antigen protein was used as the standard for homogenization and diluted to 10 μg / 100 μL. Female Balb / c mice aged 6 to 8 weeks and weighing about 18-20 g were randomly divided into 3 groups: PBS control group, α m2 ST Chinese medicine water adjuvant group, α m2 -Fe Chinese medicine water adjuvant group, 5 mice in each group. m2 ST protein and α m2 -Fe docking products were mixed with Chinese medicine water adjuvant in equal volumes and injected subcutaneously on the back, with 100 μL per mouse in each group. Booster immunization was performed 21 days after the first immunization, and blood was collected from the orbital venous sinus of mice before immunization and on days 7, 14, 21, 28, 35 and 42 after immunization, and the serum was separated and stored at -20°C for later use.
[0163] 8.2 Analysis of IgG antibody and IgG subtype antibody levels in serum after immunization
[0164] 1) Serum antibody determination method
[0165] The IgG antibody level in the serum of immunized mice was detected by ELISA. m2 ST protein was diluted to 1 μg mL in carbonate buffer -1, coated with ELISA plate, 100 μL per well, incubated at 4°C for 12-14h; washed once with PBST, added 100 μL blocking solution (3% casein PBS) to each well and blocked at 37°C for 2h; washed 4 times with PBST, diluted mouse serum 100 times with diluent (3% casein PBST), added 100 μL to each well, incubated at 37°C for 1h; washed 4 times with PBST, HRP-labeled goat anti-mouse IgG secondary antibody was diluted 1:4000 with diluent, added 100 μL to each well, incubated at 37°C for 1h; washed 4 times with PBST, patted dry, added single-component TMB, 100 μL to each well, incubated at 37°C in the dark for 10-15min, added 2M H 2 SO 4 Stop the reaction and read the OD within 10 min. 450nm Numeric value.
[0166] The mouse Ig subclass enzyme-labeled secondary antibody kit (Biodragon) was used to analyze IgG subtype antibodies. IgG1 and IgG2a antibodies in mouse serum were detected according to the kit instructions, and the OD values of the two were calculated. 450nm ratio.
[0167] 2) ELISA antibody level test results
[0168] ELISA test found that the antibody level of mice continued to increase after immunization. m2 The -Fe group reached a plateau at 28 days (7 days after the second immunization), while the α m2 The ST group reached a plateau at 35 days, and α m2 -The ELISA antibody level in the Fe nanoparticle group was higher than that in the α m2 ST protein group ( Figure 8 ).
[0169] 3) IgG subtype antibody level analysis results
[0170] The mouse Ig subclass enzyme-labeled secondary antibody kit was used to detect the production of IgG1 and IgG2a antibodies in mouse immune serum. The results showed that ( Fig. 9 ), α m2 -IgG1 subtype and α m2 There was no significant difference in the ST group, but IgG2a was significantly higher than α after the second immunization. m2 ST group, and α m2 The ratio of IgG1 / IgG2a in the -Fc group was between 0.5 and 2.0, which was lower than that in the α m2 The ST group ratio indirectly indicates that α m2 The -Fe group stimulates the body to produce cellular immune tendencies.
[0171] 8.3. Determination of serum neutralization titer
[0172] 1) Neutralization titer determination method
[0173] α m2 ST antigen and α m2 -Fe docking product 21 days after the second immunization, serum was diluted to 16, 32, 64, 81, and 92 times with DMEM medium (containing 0.5% FBS). Then the diluted serum and 2MLD / 100μL type A natural toxin were mixed in a volume of 1:1, and toxin and culture medium controls were set up. Incubate at 37℃ for 60min, take 100μL and add it to 96-well plates with 80% to 90% Hela cells, and observe the cell status after 24h.
[0174] 2) Serum neutralizing antibody titer determination results
[0175] According to the serum neutralization test, 21 days after the second immunization, α m2 -Fe nanoparticles group serum can still neutralize 1MLD of type A natural toxin after dilution 64 times ( Fig.10 ), significantly higher than α m2 32 times that of the ST protein group (P<0.05).
[0176] (9) Analysis of cellular immunity level
[0177] 9.1 Preparation of splenocytes
[0178] 28 days after the second immunization, mice were treated with overdose of CO 2 Stun the animals, then dislocate the neck and kill them. Soak them in 75% alcohol for 10 minutes, remove the spleen aseptically, and wash it in sterile PBS. After washing, place the spleen in a 40μm filter and add 1mL 1640 culture medium. Grind it, add 4mL 1640 culture medium, transfer it to a 15mL centrifuge tube, and centrifuge it at 1000r / min. -1 Centrifuge for 10 min, discard the supernatant, add 2 mL of red blood cell lysis buffer and lyse for 10 min at room temperature, then spin at 1000 r / min. -1 Centrifuge for 10 min, discard the supernatant, add 5 mL PBS (2% FBS), and repeat the washing once. Finally, add 1 mL RPMI 1640 medium (containing 1% penicillin-streptomycin) to resuspend the cells and count them. One part of the cells was used for IFN-γ induction analysis, and the other part of the cells was used for T lymphocyte subset analysis by flow cytometry.
[0179] 9.2 Determination of IFN-γ levels induced by splenocytes
[0180] 1) IFN-γ cytokine level determination method
[0181] Dilute the cell suspension to 5×10 6 mL -1, transferred to a 96-well plate, 100 μL per well (i.e., 5×10 cells per well) 5 Holes -1 ). Then take α m2 ST protein was added to the 96-well plate so that each well contained 5 μg of α m2 ST protein, place the cell culture in a 37°C 5% CO incubator. 2 Static culture for 48 h, collect the supernatant, 1000 r·min -1 Centrifuge for 5 minutes, dilute 2-fold, and detect using Mouse IFN-gamma ELISA Kit according to the instructions.
[0182] 2) IFN-γ cytokine level measurement results
[0183] 21 days after the second immunization, spleen cells were isolated and treated with 5 μg / well α m2 After stimulating spleen cells with ST protein for 48 hours, the supernatant was collected to detect the secretion level of IFN-γ. The results of ELISA showed that α m2 -Fe Chinese medicine adjuvant group produced significantly higher levels of IFN-γ cytokines than α m2 ST Chinese medicine water adjuvant group (P<0.05), indicating that α m2 -Fe Chinese medicine adjuvant group induced a stronger cellular immune response in mice ( Fig.11 ).
[0184] 9.3 T lymphocyte subset analysis
[0185] 1) T lymphocyte subset analysis method
[0186] Take 10 6 The spleen cell suspension was stained for cell viability and cell surface molecule staining. First, it was washed twice with Flow Buffer, and then Ghost DyeTM UV450, BV500 violetFluor TM 500anti-mouse CD3, PerCP-Cyanine 5.5anti-mouse CD4, ApC-Cy7 anti-mouse CD8a, APC anti-mouse CD44, FITC anti-mouse CD62L and other antibodies were used. The cells were incubated at 4°C in the dark for 30 min, centrifuged and the supernatant was discarded, and the cells were fixed with 0.7% paraformaldehyde. The cells were detected by LSRFortessa flow cytometer, and the data were analyzed by FlowJo 10.8.0software.
[0187] 2) T cell subset analysis results
[0188] Flow cytometry was used to detect effector CD4 +and CD8 + The results showed that ( Fig.12 ), α m2 -Fe nanoparticles group effector CD8 + The percentage of T cell subsets was significantly higher than that of α m2 ST protein Chinese medicine water adjuvant group (P<0.001), while α m2 ST protein group activated CD4 + The percentage of T cell subsets was significantly higher than that of α m2 -Fe nanoparticles Chinese medicine water adjuvant group (P<0.001), indicating that α m2 The -Fe nanoparticle group stimulated mice to produce higher levels of protective cellular immunity, a phenotype consistent with the result that they secreted higher levels of IFN-γ.
[0189] (10) Analysis of immunogenicity of sheep antigens
[0190] 10.1 Antigen processing and immunization
[0191] α m2 ST antigen and α m2 -Fe docking products are all α m2 The ST antigen protein was used as the standard for homogenization and diluted to 300 μg / 100 μL. Three-month-old sheep were randomly divided into three groups: α m2 ST oil adjuvant group, α m2 -Fe oil adjuvant group, α m2 -Fe Chinese medicine water adjuvant group, 3 in each group. The corresponding antigen product was mixed with oil adjuvant at a ratio of 1:2 for emulsification or directly mixed with Chinese medicine water adjuvant at a ratio of 1:1, and 300 μg was injected subcutaneously in the back. Boosting immunization was performed 21 days after the first immunization. Blood was collected before immunization, 21 days after immunization, and 42 days after immunization, and serum was separated and stored at -20°C for later use.
[0192] 10.2 Determination of serum ELISA antibodies and neutralization titers
[0193] 1) Serum antibody and neutralizing antibody determination method
[0194] The serum was taken before immunization, 21 days after immunization and 42 days after immunization for detection by ELISA method. The serum was taken 21 days after the second immunization and diluted to 16, 32, 64..., 8192 times with DMEM medium (containing 0.5% FBS). Then the diluted serum and 2MLD / 100μLA type natural toxin were mixed in a volume of 1:1, and toxin and culture medium controls were set up. Incubate at 37℃ for 60 minutes, take 100μL and add it to 96-well plates grown to 80% to 90% Hela cells, and observe the cell status after 24 hours.
[0195] 2) Serum antibody and neutralizing antibody test results
[0196] Serum was collected before immunization, 21 days after immunization, and 42 days after immunization and tested by ELISA. m2 The ELISA antibody of the -Fe Chinese medicine water adjuvant group after immunization was significantly higher than that of the α m2 -Fe oil adjuvant group, α m2 ST oil adjuvant group.
[0197] See Fig.13 .
[0198] Discussion
[0199] Clostridium perfringens often settles in the intestines of healthy animals and humans in an asymptomatic manner, and can cause diseases such as gas gangrene, necrotizing enterocolitis and enterotoxemia when the body's immune function is reduced. Vaccination is one of the effective measures to prevent the disease, and the key to the research of genetically engineered subunit vaccines is the screening of immunogens.
[0200] The alpha toxin of Clostridium perfringens is the main virulence factor in the infection process of Clostridium perfringens. It is mainly located on the chromosome and is a zinc metalloenzyme composed of 370 amino acids. It is mainly divided into two domains: the catalytic N-terminus and the membrane-bound C-terminus. Only the latter has an immune protective effect. The alpha toxin has both phosphatidylcholine activity and sphingomyelinase activity. It can hydrolyze phosphatidylcholine and sphingomyelin on the cell membrane, leading to cell lysis. It has the characteristics of cytotoxicity, hemolytic activity and platelet aggregation. In actual application, mutant proteins at single amino acid sites are prone to residual toxicity, but as the number of amino acid mutation sites increases, the spatial structure of the protein is prone to change, which reduces the immunogenicity. The two amino acids at positions 56 and 68 are both Zn in the N-terminal enzyme active center of the alpha toxin. 2+ Binding site, among which, the substitution of D-56 leads to the complete loss of hemolysis, PLC (phospholipase C) and SMase (sphingomyelinase) activities, and can maintain antigenicity; the mutation of H-68 leads to the complete loss of hemolysis, PLC, SMase and lethal activities of the toxin, so these two sites were selected for mutation at the same time. m2 ST protein, confirmed by experiments, α m2 ST protein has lost its phosphatidylcholine and lysozyme activities and is not lethal to Hela cells, indicating that α m2 The ST protein has been successfully attenuated and has good safety.
[0201] This application continues to introduce SpyTag / SpyCatcher coupling technology into the construction of ferritin nanoparticle vaccines, and prepares α-toxin (α m2ST) and SpyCatcher-tagged ferritin (FeSC). m2 After the ST proteins were mixed, docking occurred. A large number of cage-like spherical particle structures of different sizes were observed in the docking products under a transmission electron microscope. Dynamic scattering experiments showed that the diameter of the docking products ranged from 32.7 to 50.7 nm, with a main peak of 37.8 nm, which was larger than the average diameter of FeSC protein. This indicated that FeSC protein and α m2 The ST protein was successfully docked to form nanoparticles.
[0202] To evaluate the immune effect of the docking product, α m2 -Fe nanoparticles and α m2 Mice were subcutaneously immunized with ST protein. First, the IgG antibody level was detected by ELISA method, and it was found that α m2 -Fe nanoparticle group produced IgG levels consistently higher than α m2 ST protein, and α m2 The IgG level of the -Fe nanoparticle group reached a plateau 28 days after the first immunization, while the α m2 ST protein reached a plateau 35 days after the first immunization, indicating that nanoparticles induced mice to produce antibodies faster and at higher levels; in the in vitro neutralization test, α m2 -Fe nanoparticle group 21 days after the second immunization, the serum was diluted 64 times, α m2 ST can also neutralize 1MLD of natural toxin of Clostridium perfringens type A after dilution 32 times. m2 After ST protein and FeSC protein were docked to form nanoparticles to immunize mice, the neutralization titer was improved, proving that α m2 -Fe nanoparticle antigens are more immunogenic than single toxins.
[0203] Second, in mice, it is generally believed that IgG1 responses reflect Th2 CD4 + T cell auxiliary activity, IgG2a is produced by Th1 activity, that is, the lower the IgG1 / IgG2a ratio, the stronger the cellular immune preference. The mouse Ig subclass enzyme-labeled secondary antibody kit was used to detect the levels of IgG1 and IgG2a antibodies, and it was found that there was no significant difference in the IgG1 antibody level between the two groups, but from the perspective of IgG2a antibody level, α m2 -Fe nanoparticle group was significantly higher than α m2 In the ST protein group (P<0.001), the IgG1 / IgG2a ratio was lower than that in the α m2 ST protein group, which indirectly indicates that α m2 -Fe nanoparticles stimulated mice to produce stronger cellular immunity. IFN-γ is the main product of Th1-mediated immune response and coordinates Th1 effector mechanism. Generally speaking, a higher proportion of effector CD8+ The cells are closely related to the secretion of higher levels of IFN-γ, which effectively promotes the body's protective immune response and helps the body to eliminate invading pathogens or tumor cells. In this application, the mice were euthanized 28 days after the second immunization and spleen cells were isolated and α m2 After 48 h of ST protein stimulation, the secretion level of IFN-γ in the spleen cell culture medium was detected and it was found that α m2 -IFN-γ level in the Fe nanoparticle group was higher than that in the α m2 ST protein; and, flow cytometry analysis revealed that α m2 -Fe nanoparticles group effector CD8 + Cells were significantly higher than α m2 ST protein group, which also proves that nanoparticles induce stronger cellular immunity in mice. Therefore, the above results directly or indirectly indicate that nanoparticle antigens stimulate the body to produce stronger cellular immunity and humoral immunity in mice.
[0204] In order to further explore the feasibility of using nanoparticle antigens as subunit vaccines in animals, the present invention prepared oil adjuvant vaccines by emulsifying nanoparticle antigens with conventional oil adjuvants and directly mixed them with traditional Chinese medicine water adjuvants to prepare water adjuvant vaccines. The in vivo immunization test in sheep proved that α m2 -Fe nanoparticle antigen plus Chinese medicine water adjuvant can significantly increase the ELISA antibody and neutralizing antibody titers.
[0205] Conclusion
[0206] This application successfully obtained soluble α m2 ST protein and FeSC protein. Through in vitro docking, α m2 -Fe nanoparticle antigen. Validated in mouse model, α m2 -Fe nanoparticle antigen not only improves the humoral immunity level of mice, but also stimulates the cellular immunity level of mice. Sheep immunity test proves that α m2 -Fe nanoparticle antigens can significantly increase the titer of ELISA antibodies and neutralizing antibodies after adding Chinese medicine water adjuvant. This application provides a new idea for the development of subunit vaccines for Clostridium perfringens. Water adjuvant vaccines have significant advantages in application. They can be easily prepared in the field and can be quickly mixed with other water-based vaccines for combined immunization, avoiding the complex emulsification process of oil adjuvant vaccines and the destruction of antigens during the emulsification process.
[0207] In the description of this specification, the description with reference to the terms "some embodiments", "illustrative embodiments", "examples", "specific examples", or "some examples" means that the specific features, structures, materials or characteristics described in conjunction with the embodiments or examples are included in at least one embodiment or example of the present application. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner.
[0208] The above is a preferred embodiment of the invention. It should be pointed out that a person skilled in the art can make several improvements and modifications without departing from the principle of the invention. These improvements and modifications are also considered to be within the scope of protection of the invention.
Claims
1. A Clostridium perfringens alpha toxin-ferritin nanoparticle antigen, characterized in that: The Clostridium perfringens alpha toxin-ferritin nanoparticle antigen is assembled from alpha m2ST protein and FeSC protein, the alpha m2ST protein is expressed using an alpha protein mutant expression plasmid, the FeSC protein is expressed using a ferritin expression plasmid, the nucleotide sequence of the alpha protein mutant expression plasmid is shown in SEQ ID NO: 1, and the nucleotide sequence of the ferritin expression plasmid is shown in SEQ ID NO:
2.
2. The Clostridium perfringens alpha toxin-ferritin nanoparticle antigen according to claim 1, characterized in that: The α protein mutant expression plasmid is prepared by the following method: The nucleotide sequence is α shown in SEQ ID NO: 3 m2 The ST gene was inserted into the pET28a vector to obtain the α protein mutant expression plasmid.
3. The Clostridium perfringens alpha toxin-ferritin nanoparticle antigen according to claim 1, characterized in that: The ferritin expression plasmid was prepared by the following method: The FeSC gene with the nucleotide sequence shown in SEQ ID NO: 4 was inserted into the pET28a vector to obtain a ferritin expression plasmid.
4. A vaccine, characterized in that It comprises the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen as described in any one of claims 1 to 3.
5. The vaccine according to claim 4, characterized in that It also includes a Chinese medicine water adjuvant, which includes, by weight: 10 to 15 parts of astragalus polysaccharide, 4 to 10 parts of cinnamon essential oil, and 1000 to 1100 parts of physiological saline.
6. The vaccine according to claim 5, characterized in that The mass ratio of the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen to the traditional Chinese medicine water adjuvant is 1:(1-2).
7. Use of the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen according to any one of claims 1 to 3 in (1) or (2), characterized in that: (1) Application in the preparation of anti-Clostridium perfringens specific antibodies; (2) Application in the preparation of vaccines for preventing diseases caused by Clostridium perfringens.
8. A method for preparing the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen according to any one of claims 1 to 3, characterized in that: The following steps are involved: Constructing an α protein mutant expression plasmid with a nucleotide sequence as shown in SEQ ID NO: 1; constructing a ferritin expression plasmid with a nucleotide sequence as shown in SEQ ID NO: 2; The α protein mutant expression plasmid is expressed to obtain α m2 ST protein; The ferritin expression plasmid is expressed to obtain FeSC protein; The α m2 The ST protein and the FeSC protein are assembled to obtain the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen.
9. The method for preparing the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen according to claim 8, characterized in that: The α protein mutant expression plasmid was constructed by the following method: The alpha toxin gene was amplified from the type A strain of Clostridium perfringens; The α toxin gene is cloned into the pET 28a vector to obtain the pET-α plasmid; The aspartic acid at position 56 and the histidine at position 68 of the α toxin gene in the pET-α plasmid were mutated into glycine to obtain pET-α m2 Plasmids; In the pET-α m2 A Spytag molecular docking tag was added to the plasmid to obtain an α protein mutant expression plasmid.
10. The method for preparing the Clostridium perfringens alpha toxin-ferritin nanoparticle antigen according to claim 8, characterized in that: The ferritin expression plasmid was constructed using the following method: A 6*His sequence was added to the 5' end of the Ferritin gene sequence, and a (G4S)3Linker sequence and a SpyCatcher sequence were added to the 3' end. After codon optimization, the sequence was cloned into a pET28a vector to obtain a ferritin expression plasmid.
Citation Information
Patent Citations
A-type clostridium perfringens populus skin lipoid inactivated vaccine and preparation method thereof
CN101695568A
Clostridium perfringen alpha toxin genetic engineering vaccine and application thereof
CN103861094A
Fusion protein vaccine for inhibiting clostridium perfringens infection
CN105999252A
Clostridium perfringens Alpha-toxin recombination subunit vaccine and production method thereof
CN108904791A
Clostridium perfringens genetic engineering subunit vaccine as well as preparation method and application thereof
CN111808202A