Clostridium perfringens α-toxin-ferritin nanoparticle antigen, its preparation method and application
By preparing Clostridium perfringens α-toxin-ferritin nanoparticle antigens, combined with genetic engineering and traditional Chinese medicine adjuvants, the problems of low immunogenicity and safety risks of existing vaccines have been solved, achieving highly efficient humoral and cellular immune stimulation and providing a safe vaccine solution.
Patent Information
- Application Number
- CN202510280104.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-11
- Publication Date
- 2026-05-26
- Estimated Expiration
- 2045-03-11
AI Technical Summary
Existing Clostridium perfringens vaccines have low immunogenicity, large batch-to-batch variability, and safety risks during production. Traditional protein-based antigens have poor immunogenicity and are difficult to effectively prevent Clostridium perfringens infection.
Clostridium perfringens α-toxin-ferritin nanoparticle antigen was prepared. αm2ST protein and FeSC protein particles were constructed using genetic engineering. Nanoparticles were assembled using SpyTag/SpyCatcher technology and combined with traditional Chinese medicine adjuvants to form highly expressed and highly soluble α-toxin-ferritin nanoparticles, which stimulate humoral and cellular immunity.
It effectively stimulates humoral and cellular immune responses, provides a highly immunogenic and safe vaccine solution, reduces side effects, and is suitable for preventing diseases caused by Clostridium perfringens.
Smart Images

Figure CN120098144B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of Clostridium perfringens antigen technology, and in particular to a Clostridium perfringens α-toxin-ferritin nanoparticle antigen, its preparation method, and its application. Background Technology
[0002] *Clostridium perfringens*, also known as *Clostridium wiltii*, is an anaerobic, Gram-positive bacterium found in various environments. It often colonizes the intestines of healthy animals and humans asymptomatically, but can cause diseases such as gas gangrene, necrotizing enterocolitis, and enterotoxemia when the body's immune function is weakened. The pathogenic mechanism of this bacterium is related to at least 15 exotoxins and invasive enzymes it secretes, with α, β, ε, and iota being the main toxicants. Based on exotoxin secretion, *Clostridium perfringens* can be classified into six types: A, G, and Ig. All strains of *Clostridium perfringens* produce α-toxin, which is lethal, hemolytic, and gangrenous, causing diseases such as sudden anemia, enterotoxemia, and leukemia in sheep, severely impacting the development of the livestock economy.
[0003] Previously, antibiotics were added to feed to prevent Clostridium perfringens infection. However, due to drug resistance issues, my country has explicitly banned the use of growth-promoting drugs in feed, except for those containing traditional Chinese medicine ingredients. Therefore, immunization has become one of the effective measures to prevent the disease. Currently, the Clostridium vaccines approved for use in my country are mainly multivalent vaccines, such as the trivalent and quadrivalent inactivated vaccine against sheep enterotoxemia, sudden anthrax, lamb dysentery, and enterotoxemia. These vaccines are mainly composed of toxoids and have drawbacks such as large batch-to-batch variations, low immunogenicity, time-consuming and labor-intensive production, and safety risks during the production process. Therefore, developing a vaccine with high immunogenicity, safety, and controllable quality is crucial.
[0004] One important strategy is to use genetic engineering to express the main toxins of *Clostridium perfringens* and develop subunit vaccines. *Clostridium perfringens* has at least 15 exotoxins and invasive enzymes, with α, β, ε, and iota being the main virulent toxins. Different toxin subunit vaccines are developed based on the prevalence of different subtypes in different regions. However, traditional protein-based antigens have poor immunogenicity and still cannot meet the requirements for the prevention of *Clostridium perfringens* infection. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a Clostridium perfringens α-toxin-ferritin nanoparticle antigen, which can effectively stimulate humoral immunity and cellular immunity, providing a new approach for the development of Clostridium perfringens subunit vaccines.
[0006] The technical problem to be solved by the present invention is to provide a method for preparing Clostridium perfringens α-toxin-ferritin nanoparticle antigen, which can effectively stimulate humoral immunity and cellular immunity, and provides a new idea for the development of Clostridium perfringens subunit vaccines.
[0007] To address the aforementioned technical problems, this invention provides a Clostridium perfringens α-toxin-ferritin nanoparticle antigen, wherein the Clostridium perfringens α-toxin-ferritin nanoparticle antigen is assembled from αm2ST protein and FeSC protein. The αm2ST protein is expressed using an α-protein mutant expression plasmid, and the FeSC protein is expressed using a ferritin expression plasmid. The nucleotide sequence of the α-protein mutant expression plasmid is shown in SEQ ID NO: 1, and the nucleotide sequence of the ferritin expression plasmid is shown in SEQ ID NO: 2.
[0008] In some embodiments, the α-protein mutant expression plasmid is prepared using the following method:
[0009] The nucleotide sequence is shown in SEQ ID NO: 3, α m2 The ST gene was inserted into the pET28a vector to obtain the α protein mutant expression plasmid.
[0010] In some embodiments, the ferritin expression plasmid is prepared by the following method:
[0011] The FeSC gene with the nucleotide sequence shown in SEQ ID NO:4 was inserted into the pET28a vector to obtain the ferritin expression plasmid.
[0012] Accordingly, the present invention also provides a vaccine comprising the Clostridium perfringens α-toxin-ferritin nanoparticle antigen.
[0013] In some embodiments, the vaccine further includes a traditional Chinese medicine aqueous adjuvant, which comprises, by weight, 10 to 15 parts of astragalus polysaccharide, 4 to 10 parts of cinnamon essential oil, and 1000 to 1100 parts of physiological saline.
[0014] In some embodiments, the mass ratio of the Clostridium perfringens α-toxin-ferritin nanoparticle antigen to the traditional Chinese medicine aqueous adjuvant is 1:(1-2).
[0015] Furthermore, the present invention also provides the application of the Clostridium perfringens α-toxin-ferritin nanoparticle antigen in (1) or (2):
[0016] (1) Application in the preparation of specific antibodies against Clostridium perfringens;
[0017] (2) Application in the preparation of vaccines to prevent diseases caused by Clostridium perfringens.
[0018] Finally, to address the aforementioned problems, this invention provides a method for preparing Clostridium perfringens α-toxin-ferritin nanoparticle antigen, comprising the following steps:
[0019] Construct an expression plasmid of the α-protein mutant with the nucleotide sequence shown in SEQ ID NO: 1;
[0020] Construct a ferritin expression plasmid with the nucleotide sequence shown in SEQ ID NO: 2;
[0021] The α protein mutant expression plasmid was expressed to obtain α m2 ST protein;
[0022] The ferritin expression plasmid was used to express FeSC protein;
[0023] The α m2 The ST protein and the FeSC protein were assembled to obtain Clostridium perfringens α-toxin-ferritin nanoparticle antigen.
[0024] In some embodiments, the α-protein mutant expression plasmid is constructed using the following method:
[0025] The α-toxin gene was amplified from Clostridium perfringens strain A;
[0026] The α-toxin gene was cloned into the pET 28a vector to obtain the pET-α plasmid;
[0027] The aspartic acid at position 56 and the histidine at position 68 of the α-toxin gene in the pET-α plasmid were both mutated to glycine to obtain pET-α. m2 plasmids;
[0028] In the pET-α m2 A Spytag molecular docking tag was added to the plasmid to obtain an α protein mutant expression plasmid.
[0029] In some embodiments, the ferritin expression plasmid is constructed using the following method:
[0030] After adding a 6*His sequence to the 5' end of the Ferritin gene sequence and adding a (G4S)3Linker sequence and a SpyCatcher sequence to the 3' end, and optimizing the codons, the gene was cloned into the pET28a vector to obtain the ferritin expression plasmid.
[0031] Implementing this invention has the following beneficial effects:
[0032] The Clostridium perfringens α-toxin-ferritin nanoparticle antigen provided by this invention, wherein the Clostridium perfringens α-toxin-ferritin nanoparticle antigen is disposed on the surface of a substrate, and the Clostridium perfringens α-toxin-ferritin nanoparticle antigen produces unexpected immune effects, effectively stimulating humoral immunity as well as cellular immunity.
[0033] The present invention provides a method for preparing Clostridium perfringens α-toxin-ferritin nanoparticle antigen by fusing SpyTag and SpyCatcher to the ends of α-toxin and ferritin, respectively, adding a 6His purification tag, and expressing them separately. After purification, 6His-α-toxin-SpyTag and iron 6His-protein-SpyCatcher are coupled in vitro using SpyTag and SpyCatcher conjugation technology, successfully preparing a highly expressed and highly soluble α-toxin-ferritin nanoparticle antigen. Attached Figure Description
[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0035] Figure 1 pET-α in Embodiment 1 of the present invention m2 Identification results of ST vector;
[0036] Among them, 1. pET28a plasmid control; 2. pET-α m2 ST plasmid;
[0037] Figure 2 In Embodiment 1 of the present invention, α m2 Expression and identification results of ST and FeSC proteins;
[0038] Where, a.α m2 a. SDS-PAGE identification of ST protein; b. SDS-PAGE identification of FeSC protein; c. α m2 Western blot identification of ST protein; Western blot identification of d.FeSC protein;
[0039] In Figures a and b: M. Protein Marker; 1. Uninduced cell lysate; 2. Cell lysate supernatant after induction; 3. Cell lysate precipitate after induction;
[0040] In Figures c and d: M. Protein Marker; 1. Cell lysis precipitate after induction; 2. Cell lysis supernatant after induction;
[0041] Figure 3 The FeSC protein and α in Example 1 of this invention m2 Figure showing the purification results of ST protein;
[0042] Among them, a. SDS-PAGE image of purified FeSC protein; b. purified α m2 SDS-PAGE image of ST protein;
[0043] In Figures a and b: 1. Unpurified supernatant; 2. Flow-through buffer; 3. Elution buffer with 20 mmol / L imidazole; 4. Elution buffer with 40 mmol / L imidazole; 5-10. Elution buffer with 250 mmol / L imidazole.
[0044] Figure 4 In Embodiment 1 of the present invention, α m2 toxicity analysis of ST protein against HeLa cells;
[0045] Among them, a. CPE image (1. 1 MLD of type A natural toxin; 2. containing 50 μg of α m2 ST protein test group; 3. Containing 25 μg of α m2 ST protein assay group; 4. DMEM (0.5% FBS) medium)
[0046] b. Cytotoxicity test results;
[0047] Figure 5 In Embodiment 1 of the present invention, α m2 ST protein lecithinase activity assay;
[0048] Among them, aA type natural toxin (original multiple); bA type natural toxin (1 MLD); c.α m2 ST protein solution; d. Meat liver and pepsin digestion broth culture medium;
[0049] Figure 6 The results of hemolytic analysis in Example 1 of this invention;
[0050] Among them, a. Hemolytic activity test diagram; b. Hemolysis diagram;
[0051] Figure 7 In Embodiment 1 of the present invention, α m2 Identification results of Fe nanoparticles;
[0052] Where, a.α m2 -Fe docking product SDS-PAGE identification diagram (1.α) m2 1. Fe docking product; 2. FeSC protein; 3. α m2 ST protein);
[0053] b. α under transmission electron microscopym2 -Fe nanoparticles (70000×);
[0054] c.α m2 Dynamic light scattering pattern of Fe nanoparticles;
[0055] Figure 8 This refers to the detection results of IgG antibody titer in Example 1 of the present invention;
[0056] Figure 9 This refers to the results of the IgG subtype antibody level analysis in Example 1 of the present invention;
[0057] Among them, a. IgG1 antibody level; b. IgG2a antibody level; c. IgG1 / IgG2a ratio;
[0058] Figure 10 The neutralizing titer of serum 21 days after the second immunization in Example 1 of this invention;
[0059] Figure 11 This refers to the expression level of IFN-γ in Example 1 of the present invention;
[0060] Figure 12 This is an analysis of T cell subsets in Example 1 of the present invention;
[0061] Figure 13 The antibody level after immunization of sheep in Example 1 of this invention is represented by the ELISA result.
[0062] Figure 14 The neutralization titer of sheep serum after second immunization in Example 1 of this invention. Detailed Implementation
[0063] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. Examples of the embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the invention, and should not be construed as limiting the invention. Furthermore, it should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
[0064] In this invention, "preferred" and "more preferred" are merely descriptions of better implementation methods or embodiments, and should be understood as not constituting a limitation on the scope of protection of this invention. In this invention, the technical features described in an open-ended manner include both closed-ended technical solutions composed of the listed features and open-ended technical solutions that include the listed features. In this invention, numerical ranges are involved; unless otherwise specified, they include the two endpoints of the numerical range.
[0065] To address the aforementioned technical problems, this invention provides a Clostridium perfringens α-toxin-ferritin nanoparticle antigen, wherein the Clostridium perfringens α-toxin-ferritin nanoparticle antigen is assembled from αm2ST protein and FeSC protein. The αm2ST protein is expressed using an α-protein mutant expression plasmid, and the FeSC protein is expressed using a ferritin expression plasmid. The nucleotide sequence of the α-protein mutant expression plasmid is shown in SEQ ID NO: 1, and the nucleotide sequence of the ferritin expression plasmid is shown in SEQ ID NO: 2.
[0066] Clostridium perfringens alpha toxin is the main virulence factor in Clostridium perfringens infection. It is a zinc metalloenzyme composed of 370 amino acids, mainly divided into two domains: a catalytic N-terminus and a membrane-bound C-terminus. Only the latter provides immunoprotection. It is lethal, hemolytic, and gangrenous, severely impacting livestock development. Because this toxin infects animals without characteristic symptoms, vaccination is one of the effective preventative measures. A key aspect of genetically engineered subunit vaccine research is the screening of immunogens. The key to preparing immunogens is to significantly reduce their toxicity while preserving their immunogenicity.
[0067] The SpyTag / SpyCatcher binding system is a protein linkage technology developed based on the discovery that the Streptococcus pyogenes fibronectin FbaB contains a domain with a spontaneous isopeptide bond between lysine and aspartic acid. A short peptide, SpyTag, containing 13 amino acids, was designed to form an amide bond with SpyCatcher within minutes. The peptides can be easily mixed under different pH, temperature, and buffer conditions, exhibiting high reaction yields and resistance to reversal by competing peptides. This system is highly efficient, specific, and versatile.
[0068] This application successfully prepared α m2 Following the preparation of ST and FeSC proteins, Clostridium perfringens α-toxin-ferritin (hereinafter referred to as α-toxin-ferritin) was successfully prepared using SpyTag / SpyCatcher. m2 -Fe) nanoparticle antigen, mouse experiments confirmed α m2 -Fe nanoparticle antigens can effectively stimulate humoral and cellular immunity, providing a new approach for the development of Clostridium perfringens subunit vaccines.
[0069] In some embodiments, the α-protein mutant expression plasmid is prepared using the following method:
[0070] The nucleotide sequence is shown in SEQ ID NO: 3, α m2 The ST gene was inserted into the pET28a vector to obtain the α protein mutant expression plasmid.
[0071] It should be noted that in this application, the aspartic acid at position 56 and the histidine at position 68 of Clostridium perfringens α-toxin type A are both mutated to glycine. Both amino acids at positions 56 and 68 are Zn, which is located in the N-terminal enzyme active site of the α-toxin. 2+ Binding sites: Substitution at D-56 results in complete loss of hemolytic, PLC, and SMase activities while maintaining antigenicity; mutation at H-68 results in complete loss of toxin hemolysis, phospholipase C, sphingomyelinase, and lethal activities. α-expression using a prokaryotic system... m2 ST protein, as demonstrated by experiments, α m2 ST protein showed no phospholipase or lysin activity within the detection range and was not lethal to HeLa cells, indicating that α m2 The ST protein has been successfully attenuated and has good safety profile.
[0072] In some embodiments, the ferritin expression plasmid is prepared by the following method:
[0073] The FeSC gene with the nucleotide sequence shown in SEQ ID NO:4 was inserted into the pET28a vector to obtain the ferritin expression plasmid.
[0074] It should be noted that the applicant previously provided a method for preparing ferritin in Chinese Patent Application No. 202410985783.7, namely "A method for preparing Clostridium perfringens epsilon toxin-ferritin nanoparticle antigen", but found that the ferritin in the above-disclosed scheme is similar to α-ferritin. m2 The docking efficiency of ST is very low. Therefore, the FeSC fusion gene sequence was further optimized in this application. The inventors found that the FeSC gene with the nucleotide sequence shown in SEQ ID NO: 4 can significantly enhance the docking efficiency of ferritin and α. m2 ST's docking efficiency.
[0075] Accordingly, this application also provides a vaccine comprising the Clostridium perfringens α-toxin-ferritin nanoparticle antigen.
[0076] In some embodiments, the vaccine further includes a traditional Chinese medicine aqueous adjuvant, which comprises, by weight: 10-15 parts astragalus polysaccharide, 4-10 parts cinnamon essential oil, and 1000-1100 parts physiological saline. Preferably, the mass ratio of the Clostridium perfringens α-toxin-ferritin nanoparticle antigen to the traditional Chinese medicine aqueous adjuvant is 1:(1-2).
[0077] It should be noted that oil adjuvants are often added for emulsification in the preparation of subunit vaccines to enhance the immune effect. However, oil adjuvants have significant side effects, easily causing severe inflammatory reactions at the injection site and affecting the quality of the vaccine. This application uses a specific composition of traditional Chinese medicine aqueous adjuvant mixed with Clostridium perfringens α-toxin-ferritin nanoparticle antigen, which can improve the immune effect. The traditional Chinese medicine aqueous adjuvant provided in this application includes Astragalus polysaccharide and cinnamon essential oil, which have multiple effects such as anti-inflammatory and immune enhancement. The polysaccharides, saponins, flavonoids and other components can effectively promote the immune response, enhance cellular and humoral immune responses, reduce antigen dosage, prolong the duration of immune protection, and have no significant side effects. Moreover, Astragalus and cinnamon are both common medicinal materials in my country, with large yields and easy access, from which important components such as Astragalus polysaccharide and cinnamon essential oil can be extracted. Vaccines using traditional Chinese medicine aqueous adjuvants have significant advantages in application. They can be easily prepared in the field and can be quickly mixed with other aqueous vaccines for combined immunization, avoiding the complex emulsification process of oil adjuvant vaccines and the destruction of antigens during emulsification.
[0078] Furthermore, this application provides the application of the Clostridium perfringens α-toxin-ferritin nanoparticle antigen in (1) or (2):
[0079] (1) Application in the preparation of specific antibodies against Clostridium perfringens;
[0080] (2) Application in the preparation of drugs for the prevention of diseases caused by Clostridium perfringens.
[0081] Accordingly, the present invention provides a method for preparing Clostridium perfringens α-toxin-ferritin nanoparticle antigen, comprising the following steps:
[0082] Construct an expression plasmid of the α-protein mutant with the nucleotide sequence shown in SEQ ID NO: 1;
[0083] Construct a ferritin expression plasmid with the nucleotide sequence shown in SEQ ID NO: 2;
[0084] The α protein mutant expression plasmid was expressed to obtain α m2 ST protein;
[0085] The ferritin expression plasmid was used to express FeSC protein;
[0086] The α m2 The ST protein and the FeSC protein were assembled to obtain Clostridium perfringens α-toxin-ferritin nanoparticle antigen.
[0087] In some embodiments, the method for constructing the α-protein mutant expression plasmid of Clostridium perfringens type A includes the following steps:
[0088] The α-toxin gene was amplified from Clostridium perfringens strain A;
[0089] The α-toxin gene was cloned into the pET 28a vector to obtain the pET-α plasmid;
[0090] The aspartic acid at position 56 and the histidine at position 68 of the α-toxin gene in the pET-α plasmid were both mutated to glycine to obtain pET-α. m2 plasmids;
[0091] In the pET-α m2 A Spytag molecular docking tag was added to the plasmid to obtain an α protein mutant expression plasmid.
[0092] In some embodiments, the amplification of the α-toxin gene from Clostridium perfringens strain A includes:
[0093] Using genomic DNA of Clostridium perfringens type A as a template, PCR amplification was performed with primers α-F and α-R to obtain the α-toxin gene.
[0094] In some embodiments, cloning the α-toxin gene into the pET 28a vector to obtain the pET-α plasmid includes the following steps:
[0095] Using pET28a plasmid as a template, PCR amplification was performed with primers pET-F and pET-R to obtain the target vector;
[0096] The α-toxin gene was homologously recombinated with the target vector and transformed into DH5α competent cells. After culture, single clones were selected and colony PCR was performed using pET28a universal primers. Positive colonies were cultured and amplified to obtain the pET-α plasmid.
[0097] Specifically, the sequence of primer pET-F is: CAAAGCCCGAAAGGAAGCTGAGTTGGC; the sequence of primer pET-R is: GTGATGATGATGATGATGGCTGCTGCCC.
[0098] In some embodiments, the aspartic acid at position 56 and the histidine at position 68 of the α-toxin gene in the pET-α plasmid are both mutated to glycine to obtain pET-α. m2 Plasmids, including the following steps:
[0099] Using the pET-α plasmid as a template, and primer α m2 -F and primer α m2-R was used for PCR amplification, transformed into DH5α competent cells, and single clones were picked after culture. Colony PCR screening was performed using the pET28a universal primer. Positive colonies were cultured and amplified to obtain pET-α. m2 Plasmid.
[0100] In some embodiments, the pET-α m2 Adding a Spytag molecular docking tag to the plasmid to obtain an expression plasmid for the α-protein mutant of Clostridium perfringens type A includes the following steps:
[0101] With the pET-α m2 Using the plasmid as a template, PCR amplification was performed with primers α-ST-F and α-ST-R. The cells were transformed into DH5α competent cells, and single clones were selected after culture. Colony PCR screening was performed using pET28a universal primers. Positive colonies were cultured and amplified to obtain the α-protein mutant expression plasmid of Clostridium perfringens type A.
[0102] In some embodiments, constructing the ferritin expression plasmid includes:
[0103] After adding a 6*His sequence to the 5' end of the Ferritin gene sequence and adding a (G4S)3Linker sequence and a SpyCatcher sequence to the 3' end, and optimizing the codons, the gene was cloned into the pET28a vector to obtain the ferritin expression plasmid.
[0104] In some embodiments, an α-protein mutant expression plasmid of Clostridium perfringens type A is transformed into BL21(DE3) competent cells, and expression is induced by IPTG to obtain α-protein. m2 ST protein;
[0105] Ferrin expression plasmid was transformed into BL21(DE3) competent cells and expressed by IPTG to obtain FeSC protein.
[0106] In some embodiments, the α m2 After purification, the ST protein and the FeSC protein were mixed in a molar ratio of 1.5:1 to 2.5:1 and incubated in a constant temperature incubator at 35℃ to 38℃ to obtain Clostridium perfringens α-toxin-ferritin nanoparticle antigen.
[0107] The following description is based on specific embodiments.
[0108] Example 1
[0109] This embodiment provides a method for preparing Clostridium perfringens α-toxin-ferritin nanoparticle antigen, including:
[0110] Materials and Methods
[0111] (1) Test materials
[0112] Clostridium perfringens strain C57-55, Clostridium perfringens natural toxin (Note: The concentration of natural toxin A cytotoxic to HeLa cells is 512 MLD 100 μL) -1 HeLa cells and pET-28a vector were all preserved for this experiment; DH5α and BL21(DE3) were purchased from Beijing TransGen Biotech Co., Ltd.; Primescript RT Master Mix (high-fidelity enzyme) was purchased from Baori Biotechnology (Beijing) Co., Ltd.; restriction endonuclease DpnI, T4 polynucleotide kinase, and T4 ligase were purchased from NEB; 180kDa pre-stained protein marker, multi-fragment rapid cloning kit, and SuperPico ECL Master Mix were purchased from Nanjing Novizan Biotechnology Co., Ltd.; plasmid mini-preparation kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; Ni NTA Beads were purchased from Beijing Dining Biotechnology Co., Ltd.; monoclonal mouse anti-6*His antibody was purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd.; mouse Ig subclass enzyme-labeled secondary antibody kit; HRP-labeled goat anti-mouse IgG was purchased from Beijing Zhongyuan Heju Biotechnology Co., Ltd.; flow cytometry antibody was purchased from Cytek Bioscience (Tonbo), USA; erythrocyte lysis buffer and Mouse IFN-gamma ELISA kit were also used. Kits and single-component TMB were purchased from Beijing Solarbio Science & Technology Co., Ltd.; all other reagents were commercially available.
[0113] Balb / C mice aged 6–8 weeks were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.
[0114] The 3-month-old sheep came from the applicant's self-bred and self-raised flock.
[0115] Preparation of Chinese herbal adjuvant: Take 10g of Astragalus polysaccharide and 5ml of cinnamon essential oil, and dissolve them in 1000mL of physiological saline.
[0116] (2) Constructing an expression plasmid for the α-protein mutant of Clostridium perfringens type A.
[0117] Using Clostridium perfringens strain C57-55 as a template, PCR amplification was performed using α-F and α-R (sequences are shown in Table 1), and the target bands were recovered by gel extraction.
[0118] Using pET28a plasmid as a template, amplification was performed using pET-F and pET-R primers. 43 μL of PCR product was taken, 5 μL of rCutSmart bufffer was added, and then 2 μL of DpnI enzyme was added for digestion at 37℃ for 2 h. Agarose gel electrophoresis was performed, and the correct bands were cut and recovered from the gel.
[0119] Homologous recombination was performed using a multi-fragment rapid cloning kit, and the cells were transformed into DH5α competent cells. After incubation at 37°C, single clones were picked and colony PCR was performed using pET28a universal primers. Positive colonies were amplified by incubation at 37°C and then sent to the company for sequencing. The plasmid with correct sequencing was named pET-α.
[0120] Using the correctly sequenced pET-α plasmid as a template, α m2 -F and α m2 Amplification was performed using -R primers, and the ligation and transformation process was the same as above. Positive colonies were sent to the company for sequencing, and the plasmid with correctly sequenced plasmids was named pET-α. m2 .
[0121] Then with pET-α m2 Using the plasmid as a template, amplification was performed using α-ST-F and α-ST-R primers (with added Spytag docking tag sequences) (see Table 1). PCR reaction conditions and digestion were the same as above. The plasmid was recovered by column chromatography, and the recovered product was phosphorylated with PNK enzyme and 10*Buffer for T4 DNA ligase with 10mM ATP at 37℃ for 30 min. The phosphorylated product was then ligated with T4 ligase at 16℃ for 30 min. Transformation and sequencing were performed as above, and the correctly sequenced plasmid was named pET-α. m2 ST.
[0122] Table 1 Primer sequences
[0123]
[0124] Note: underline sequence The sequences in overlapping PCR are complementary sequences; the italicized sequences are Spytag sequences; and the bolded sequences are D56G and H68G point mutation sequences.
[0125] α m2 Construction results of ST toxin mutant prokaryotic expression vector
[0126] pET-α using universal primers pET28a m2 ST was used for PCR, with the pET28a empty plasmid as a control, followed by agarose gel electrophoresis. pET-α m2 After ST plasmid PCR, a target band of approximately 1100 bp appeared as shown in the results. Figure 1 As shown, it is in line with expectations.
[0127] (3) Constructing ferritin expression plasmid
[0128] Based on the Ferritin gene sequence (GenBank No: WP_120857832.1), a 6*His sequence was added to the 5' end of the gene, and a (G4S)3Linker and SpyCatcher sequence were added to the 3' end. After codon optimization, the gene was synthesized by Shanghai Sangon Biotech Co., Ltd., and cloned into the pET28a vector. The correct plasmid name is: pET-FeSC.
[0129] (4) Expression and identification of recombinant proteins
[0130] pET-α m2 ST and pET-FeSC plasmids were transformed into BL21(DE3) competent cells, and expression was induced by IPTG at 28℃. Bacterial cells were collected, and after sonication, the supernatant and precipitate were collected separately. SDS-PAGE electrophoresis was used to detect recombinant protein expression. Western blot was used to identify recombinant protein expression, with the primary antibody being mouse anti-His at a dilution of 1:5000, and the secondary antibody being goat anti-mouse IgG, HRP-labeled (1:2000 dilution). The target proteins were named α... m2 ST, FeSC.
[0131] α m2 Identification results of ST toxin mutant and ferritin prokaryotic expression.
[0132] SDS-PAGE electrophoresis and Western blot results showed that α m2 ST protein was expressed in both the cell supernatant and the precipitate, with a relative molecular mass of approximately 42 kDa, consistent with the expected molecular mass. FeSC protein was expressed in both the cell supernatant and the precipitate, with the majority of expression in the cell supernatant, and a relative molecular mass of approximately 36 kDa, consistent with the expected molecular mass. Specific results are as follows: Figure 2 As shown.
[0133] (5)α m2 Purification of ST protein and FeSC
[0134] The target band, which was soluble and expressed in the bacterial cell lysis supernatant, was purified according to the instructions of the Ni-Beads affinity chromatography kit. After analysis by SDS-PAGE gel electrophoresis, the protein concentration was determined using a protein concentration assay kit and stored at -80℃ for later use.
[0135] Using Ni NTA Beads for α m2 ST protein and FeSC protein were purified separately, and the eluent with higher purity was collected and dialyzed. The final FeSC protein concentration was 1.39 μg·μL. -1 ;α m2The ST protein concentration was 0.353 μg·μL. -1 The specific results are as follows Figure 3 As shown.
[0136] (6)α m2 Toxicity analysis of ST protein
[0137] 6.1, α m2 ST cytotoxicity test
[0138] 1) Cytotoxicity assay methods
[0139] Well-grown HeLa cells were digested with trypsin and counted, and the cell density was adjusted to 1.8 × 10⁶ cells / year using DMEM medium (containing 10% FBS). 5 mL -1 Transfer 100 μL to each well of a 96-well plate and incubate for 12 h at 37°C (5% CO2). Afterward, dilute the type A natural toxin to 10 mL with DMEM medium (containing 0.5% FBS). -1 α m2 ST protein up to 500 μg / ml -1 and 250 μg·ml -1 Replace the original culture medium with 100 μL per well, with 8 replicates per group, and a culture medium control is also included.
[0140] Observe after incubation at 37℃ and 5% CO2 for 24 hours.
[0141] 2) Cytotoxicity assay results
[0142] After adding the various components, HeLa cells were cultured for another 24 hours and observed under a microscope. It was found that cells inoculated with 1 MLD of type A natural toxin showed significant shrinkage and increased intercellular spaces. Figure 4 -a-1); inoculate with 50 μg and 25 μg α m2 ST protein experimental group ( Figure 4 -a-2、 Figure 4 -a-3), (containing 0.5% FBS) DMEM medium ( Figure 4 Cells with -a-4) all grew well, and the number of cytopathic effects was statistically analyzed. Figure 4 -b), indicating α m2 ST protein toxicity has been lost.
[0143] 6.2, α m2 ST lecithinase activity test
[0144] 1) Method for determining lecithinase activity
[0145] Alpha toxin possesses lecithinase activity, specifically hydrolyzing phosphatidylcholine in egg yolk into phosphorycholine and 1,2-diglycerides, producing a white turbidity. According to the reference, undiluted type A natural toxin and diluted type A natural toxin (100 mL / ml) were added dropwise to egg yolk agar plates. -1 ), α m2 ST protein (250 μg·ml) -1 Add 10 μL each of meat, liver, and pepsin digestion broth culture medium and let stand at 37°C for 12 hours. Then observe whether white turbid spots appear at the drop location.
[0146] 2) Results of lecithinase activity assay
[0147] A white turbidity appeared in the area on the egg yolk agar plate where 1 mL of undiluted type A natural toxin and 1 mL of type A natural toxin were added. Figure 5 -a、 Figure 5 -b), while adding α m2 No white turbidity was observed in the areas of ST protein and meat liver pepsin digestion broth culture medium. Figure 5 -c、 Figure 5 -d), indicating α m2 ST protein lecithinase activity has been lost.
[0148] 6.3, α m2 ST hemolytic activity test
[0149] 1) Method for determining hemolytic activity
[0150] According to the method described in the reference, a 1% sheep red blood cell suspension was prepared using physiological saline and dispensed into 2 mL EP tubes, or 800 μL tubes. -1 Add undiluted type A natural toxin and diluted type A natural toxin (10 mL / ml) to a 1% sheep red blood cell suspension. -1 ), α m2 ST protein (250 μg·ml) -1 100 μL of PBS solution and 100 μL of PBS solution were added to each group, with three replicates per group. After mixing, the mixture was incubated in a 37°C water bath for 30 min at 1500 rpm. -1 Centrifuge for 10 min, take the supernatant and place it in a 96-well plate, and measure its absorbance at 540 nm.
[0151] 2) Results of hemolytic activity assay
[0152] According to the literature method for testing hemolytic activity, the supernatant in the addition of 1 MLD of undiluted type A natural toxin and type A natural toxin turned red, indicating hemolysis of red blood cells. m2 The ST protein and the PBS supernatant did not turn red. Figure 6-b). Then, based on the literature formula, the hemolysis percentage for each group was calculated for quantitative analysis. The hemolysis percentages of the original dose and 1 MLD of type A natural toxin were both greater than 95%, while α... m2 The percentage of hemolysis in both ST protein and PBS solution was less than 0, indicating that α m2 ST protein has lost its hemolytic activity.
[0153] (7) Clostridium perfringens α-toxin-ferritin nanoparticle antigen (α-) m2 Preparation and identification of Fe nanoparticle proteins
[0154] 1) Methods for the preparation and identification of nanoparticle antigens
[0155] α m2 ST and FeSC proteins were mixed at a molar ratio of 2:1 and incubated at 37°C for 2 hours. After incubation, the mixture was verified by SDS-PAGE electrophoresis. The docking product was named α. m2 -Fe.
[0156] The docking product was diluted to a concentration of approximately 0.1 μg·mL. -1 Take 10 μL of the docking product dilution solution and add it to the pretreated copper mesh. First, soak it in the dye solution for 1 min, then wash it twice with distilled water. After standing for 5-10 min to air dry, observe it with a transmission electron microscope (Hitachi TEM system).
[0157] The docking product was diluted to a concentration of approximately 0.3 μg·mL. -1 Three repeated measurements were performed using a potentiometer (Nano ZS), with 20 sampling points measured each time, each sampling lasting 5 seconds at a temperature of 25°C. The particle size distribution was analyzed using the automatic attenuation of the laser.
[0158] 2)α m2 Identification results of Fe nanoparticles
[0159] α m2 After incubation of ST and FeSC proteins at 37°C, samples were taken and analyzed by SDS-PAGE electrophoresis. A distinct band was observed at 110 kDa. Figure 7 a). Observation under an electron transmission microscope revealed numerous cage-like spherical particle structures of varying sizes in the field of view. Figure 7 b). Furthermore, dynamic light scattering assays were used to analyze FeSC protein and α... m2 -Particle size analysis of Fe docking products ( Figure 7 c) The results showed that the particle size range of FeSC protein was 11.7–15.7 nm, α m2The particle size range of the -Fe docking products is 32.7–50.7 nm, with the main peak at 37.8 nm, indicating that α m2 ST protein successfully docked with FeSC protein to form α m2 -Fe nanoparticles.
[0160] (8) Immunogenicity analysis
[0161] 8.1 Antigen Treatment and Immunization
[0162] α m2 ST antigen and α m2 -Fe docking products all exhibit α m2 ST antigen protein was homogenized as a standard and diluted to 10 μg / 100 μL. Female Balb / c mice aged 6–8 weeks and weighing approximately 18–20 g were randomly divided into three groups: PBS control group, α... m2 ST Traditional Chinese Medicine Water Adjuvant Group, α m2 -Fe traditional Chinese medicine water adjuvant group, 5 animals in each group. α m2 ST protein and α m2 The -Fe docking product was mixed with an equal volume of traditional Chinese medicine adjuvant and administered subcutaneously to each mouse in each group via dorsal injection, with 100 μL per mouse. A booster immunization was performed 21 days after the initial immunization. Blood was collected from the orbital sinus of mice before immunization and on days 7, 14, 21, 28, 35, and 42 after immunization. Serum was separated and stored at -20°C for later use.
[0163] 8.2 Analysis of IgG antibody and IgG subtype antibody levels in serum after immunization
[0164] 1) Serum antibody assay method
[0165] The level of IgG antibodies in the serum of immunized mice was detected by ELISA. (α...) m2 ST protein was diluted to 1 μg / mL with carbonate buffer. -1 Coat ELISA plates with 100 μL per well and incubate at 4°C for 12–14 h. Wash once with PBST, add 100 μL of blocking buffer (3% casein PBS) to each well and block at 37°C for 2 h. Wash four times with PBST. Dilute mouse serum 100-fold with diluent (3% casein PBST) and add 100 μL to each well, incubate at 37°C for 1 h. Wash four times with PBST. Dilute HRP-labeled goat anti-mouse IgG secondary antibody 1:4000 with diluent and add 100 μL to each well, incubate at 37°C for 1 h. Wash four times with PBST, pat dry, add 100 μL of single-component TMB to each well, incubate at 37°C in the dark for 10–15 min, add 100 μL of 2M H2SO4 to each well to stop the reaction, and read OD within 10 min. 450nm Numerical value.
[0166] IgG subtype antibodies were analyzed using a mouse Ig subclass enzyme-labeled secondary antibody kit (Biodragon). IgG1 and IgG2a antibodies in mouse serum were detected according to the kit instructions, and their OD values were calculated. 450nm ratio.
[0167] 2) ELISA antibody level measurement results
[0168] ELISA testing revealed that antibody levels in mice remained elevated after immunization, α m2 The -Fe group reached a plateau at 28 days (7 days after the second immunization), while the α group... m2 The ST group reached a plateau at 35 days, and α m2 -Fe nanoparticles showed higher ELISA antibody levels than α m2 ST protein group ( Figure 8 ).
[0169] 3) Results of IgG subtype antibody level analysis
[0170] The production of IgG1 and IgG2a antibodies in mouse immune serum was detected using a mouse Ig subclass enzyme-linked secondary antibody kit. The results showed that ( Figure 9 ), α m2 - IgG1 subtype and α after immunization in Fe group m2 There was no significant difference in the ST group, but IgG2a was significantly higher than α after the second immunization. m2 ST group, and α m2 The IgG1 / IgG2a ratio in the -Fe group was between 0.5 and 2.0, lower than that of the α group. m2 The ST group ratio indirectly indicates α m2 -Fe group stimulates the body to produce a tendency for cellular immunity.
[0171] 8.3 Determination of serum neutralizing titer
[0172] 1) Methods for determining neutralizing potency
[0173] α m2 ST antigen and α m2 Serum from patients 21 days post-secondary immunotherapy with the Fe-doped product was serially diluted 16, 32, 64, 81, and 92 times in DMEM medium (containing 0.5% FBS). The diluted serum was then mixed with 2 MLD / 100 μL of type A natural toxin at a 1:1 volume ratio, with toxin and culture medium controls included. The mixture was incubated at 37°C for 60 min, and 100 μL of each solution was added to 96-well plates containing 80%–90% HeLa cells. Cell status was observed after 24 h.
[0174] 2) Serum neutralizing antibody titer assay results
[0175] Serum neutralization assays showed that 21 days after the second immunization, α m2 -Fe nanoparticles, even after a 64-fold dilution of serum, could still neutralize 1 MLD of type A natural toxin. Figure 10 ), significantly higher than α m2 32-fold greater than the ST protein group (P<0.05).
[0176] (9) Cellular immune level analysis
[0177] 9.1 Spleen cell preparation
[0178] Twenty-eight days after the second immunization, mice were stunned with an excessive amount of CO2, then euthanized by cervical dislocation. After soaking in 75% ethanol for 10 minutes, the spleens were aseptically removed and washed in sterile PBS. After washing, the spleens were placed in a 40 μm filter with 1 mL of 1640 medium and ground. Then, 4 mL of 1640 medium was added, and the mixture was transferred to a 15 mL centrifuge tube and centrifuged at 1000 rpm. -1 Centrifuge for 10 min, discard the supernatant, add 2 mL of erythrocyte lysis buffer, lyse at room temperature for 10 min, then centrifuge at 1000 rpm. -1 Centrifuge for 10 min, discard the supernatant, add 5 mL of PBS (2% FBS), and wash once more. Finally, resuspend the cells in 1 mL of RPMI 1640 medium (containing 1% penicillin and streptomycin) and count them. One portion of the cells was used for IFN-γ induction analysis, and the other portion was used for T lymphocyte subset analysis by flow cytometry.
[0179] 9.2 Measurement of IFN-γ levels induced by spleen cells
[0180] 1) Methods for measuring IFN-γ cytokine levels
[0181] Dilute the cell suspension to 5×10⁻⁶ 6 ·mL -1 Transfer to 96-well plates, 100 μL per well (i.e., 5 × 10⁶ cells per well). 5 One hole -1 Take α again. m2 ST protein was added to this 96-well plate, so that each well contained 5 μg of α. m2 ST protein was statically cultured at 37°C with 5% CO2 for 48 hours, and the supernatant was collected. The culture was then incubated at 1000 rpm. -1 Centrifuge for 5 minutes, dilute 2 times, and detect using the Mouse IFN-gamma ELISA Kit according to the instructions.
[0182] 2) Results of IFN-γ cytokine level measurement
[0183] Splenocytes were isolated 21 days after the second immunization and treated with 5 μg / well α-carbohydrate. m2After ST protein stimulation of spleen cells for 48 hours, the supernatant was collected to detect the secretion level of IFN-γ. ELISA results showed that α... m2 The level of IFN-γ cytokines produced by the Fe-containing traditional Chinese medicine adjuvant group was significantly higher than that of α. m2 ST herbal water adjuvant group (P<0.05) indicates that α m2 -Fe-containing herbal adjuvant group induced a stronger cellular immune response in mice. Figure 11 ).
[0184] 9.3 T lymphocyte subset analysis
[0185] 1) T lymphocyte subset analysis method
[0186] Take 10 6 Spleen cell suspensions were subjected to cell viability staining and cell surface molecular staining. First, the cells were washed twice with Fluoride wash buffer, then Ghost Dye™ UV450 and BV500 violetFluor were added. TM Antibodies including 500 anti-mouse CD3, PerCP-Cyanine 5.5 anti-mouse CD4, ApC-Cy7 anti-mouse CD8a, APC anti-mouse CD44, and FITC anti-mouse CD62L were used. The cells were incubated at 4°C in the dark for 30 min, centrifuged, the supernatant was discarded, and the cells were fixed with 0.7% paraformaldehyde. Data were analyzed using an LSR Fretessa flow cytometer and analyzed using FlowJo 10.8.0 software.
[0187] 2) Results of T cell subset analysis
[0188] Flow cytometry was used to detect effector CD4. + and CD8 + The proportion of T cell subsets showed that ( Figure 12 ), α m2 -Effective CD8 of Fe nanoparticles + The percentage of T cell subsets was significantly higher than that of α cells. m2 ST protein in the traditional Chinese medicine adjuvant group (P<0.001), while α m2 ST proteome activates CD4 + The percentage of T cell subsets was significantly higher than that of α cells. m2 -Fe nanoparticles in the traditional Chinese medicine water adjuvant group (P<0.001) indicate that α m2 -Fe nanoparticles stimulated mice to produce a high level of protective cellular immunity, a phenotype consistent with the high levels of IFN-γ secretion.
[0189] (10) Immunogenicity analysis of sheep antigen
[0190] 10.1 Antigen processing and immunization
[0191] α m2 ST antigen and α m2 -Fe docking products all exhibit α m2 ST antigen protein was homogenized as a standard and diluted to 300 μg / 100 μL. Three-month-old sheep were randomly divided into three groups: α m2 ST oil adjuvant group, α m2 -Fe oil adjuvant group, α m2 -Fe Traditional Chinese Medicine Aqueous Adjuvant Group: 3 animals per group. The corresponding antigen product was emulsified with the oil adjuvant at a 1:2 ratio or directly mixed with the traditional Chinese medicine aqueous adjuvant at a 1:1 ratio. 300 μg was administered per animal per group via subcutaneous injection into the back. A booster immunization was performed 21 days after the initial immunization. Blood samples were collected before immunization, and at 21 and 42 days after immunization. Serum was separated and stored at -20°C for later use.
[0192] 10.2 Determination of serum ELISA antibodies and neutralizing titers
[0193] 1) Methods for measuring serum antibodies and neutralizing antibodies
[0194] Serum samples were collected before immunization and on days 21 and 42 post-immunization for ELISA testing. Serum collected on day 21 post-immunization was serially diluted 16, 32, 64… to 8192 times in DMEM medium (containing 0.5% FBS). The diluted serum was then mixed with 2 MLD / 100 μL of a type A natural toxin at a 1:1 volume ratio, with toxin and culture medium controls included. The mixture was incubated at 37°C for 60 min, and 100 μL of each solution was added to 96-well plates containing 80%–90% HeLa cells. Cell status was observed after 24 h.
[0195] 2) Serum antibody and neutralizing antibody test results
[0196] Serum samples were collected before immunization and at 21 and 42 days post-immunization and analyzed using ELISA. Results α m2 -Fe traditional Chinese medicine adjuvant group showed significantly higher ELISA antibody levels after immunization compared to α. m2 -Fe oil adjuvant group, α m2 ST oil adjuvant group.
[0197] See Figure 13 .
[0198] II. Discussion
[0199] Clostridium perfringens often colonizes the intestines of healthy animals and humans asymptomatically, but can cause diseases such as gas gangrene, necrotizing enterocolitis, and enterotoxemia when the body's immune function is weakened. Vaccination is one of the effective measures to prevent this disease, and the key to research on genetically engineered subunit vaccines is the screening of immunogens.
[0200] Clostridium perfringens alpha toxin is the main virulence factor in Clostridium perfringens infection. Primarily located on the chromosome, it is a zinc metalloenzyme composed of 370 amino acids, mainly divided into two domains: a catalytic N-terminus and a membrane-bound C-terminus; only the latter provides immunoprotection. Alpha toxin exhibits both lecithinase and sphingomyelinase activities, hydrolyzing phosphatidylcholine and sphingomyelin on the cell membrane, leading to cell lysis. Therefore, it possesses cytotoxic, hemolytic, and platelet aggregation properties. In practical applications, mutant proteins at single amino acid sites tend to retain residual virulence, but an increase in amino acid mutation sites can alter the protein's spatial structure, reducing immunogenicity. The 56th and 68th amino acids are Zn, the active site of the alpha toxin's N-terminal enzyme. 2+ The binding sites are as follows: Substitution at D-56 results in complete loss of hemolytic, PLC (phospholipase C), and SMase (sphingomyelinase) activity, while maintaining antigenicity; mutation at H-68 results in complete loss of toxin hemolytic, PLC, SMase, and lethal activity. Therefore, both sites were selected for simultaneous mutation. α-expression was performed using a prokaryotic system. m2 ST protein, as confirmed by experiments, α m2 ST protein has lost its lecithinase and lysozyme activities and is not lethal to HeLa cells, indicating that α m2 The ST protein has been successfully attenuated and has good safety profile.
[0201] This application further incorporates SpyTag / SpyCatcher conjugation technology into the construction of ferritin nanoparticle vaccines, and prepares SpyTag-tagged α-toxins (α-toxins). m2 ST) and SpyCatcher-tagged ferritin (FeSC). In vitro, FeSC protein and α m2 After mixing with ST proteins, docking occurs. The docking products, observed under a transmission electron microscope, consist of numerous cage-like spherical particles of varying sizes. Dynamic scattering experiments show that the diameter of the docking products ranges from 32.7 to 50.7 nm, with a main peak at 37.8 nm, which is larger than the average diameter of FeSC proteins. This indicates that FeSC proteins and α... m2 The ST protein successfully docked, forming nanoparticles.
[0202] To evaluate the immunization effect of the docking product, α m2 -Fe nanoparticles and αm2 Mice were subcutaneously immunized with ST protein. First, IgG antibody levels were detected using ELISA, revealing α... m2 The IgG levels generated by the Fe nanoparticle group were consistently higher than those of α. m2 ST protein, and α m2 -Fe nanoparticle group reached a plateau in IgG levels 28 days after immunization, while α m2 ST protein reached a plateau 35 days after initial immunization, indicating that nanoparticles induced faster and higher antibody production in mice; in in vitro neutralization experiments, α m2 -Fe nanoparticles, serum diluted 64-fold 21 days after secondary immunization, α m2 Even after a 32-fold dilution, ST can still neutralize 1 MLD of Clostridium perfringens type A natural toxin. This application found that α... m2 After ST protein and FeSC protein were docked to form nanoparticles for immunization of mice, the neutralizing titer was increased, demonstrating that α m2 -Fe nanoparticle antigens have better immunogenicity than single toxins.
[0203] Secondly, in mice, it is generally believed that the IgG1 response reflects the Th2 CD4 response. + T cell helper activity, IgG2a is produced by Th1 activity, meaning the lower the IgG1 / IgG2a ratio, the stronger the cellular immune bias. Using a mouse Ig subclass enzyme-linked secondary antibody kit to detect IgG1 and IgG2a antibody levels, no significant difference was found in IgG1 antibody levels between the two groups. However, in terms of IgG2a antibody levels, α... m2 -Fe nanoparticles were significantly higher than α m2 In the ST protein group (P<0.001), the IgG1 / IgG2a ratio was lower than that of α. m2 ST proteinome, which indirectly indicates α m2 -Fe nanoparticles stimulated stronger cellular immunity in mice. IFN-γ is a major product of Th1-mediated immune responses, coordinating Th1 effector mechanisms. Generally, a higher proportion of effector CD8... + Cellular activity is closely related to high levels of IFN-γ secretion, effectively promoting the body's protective immune response and facilitating the body's clearance of invading pathogens or tumor cells. In this application, spleen cells were isolated from mice euthanized 28 days after the second immunization and used α... m2 After ST protein stimulation for 48 hours, the secretion level of IFN-γ in spleen cell culture medium was measured, and α was found to be... m2 -Fe nanoparticles showed higher IFN-γ levels than α. m2 ST protein; and flow cytometry analysis revealed that α m2 -Effective CD8 of Fe nanoparticles + Cells were significantly higher than αm2 The ST protein genome also demonstrates that nanoparticles induce stronger cellular immunity in mice. Therefore, the above results directly or indirectly indicate that nanoparticle antigens stimulate both strong cellular and humoral immunity in mice.
[0204] To further explore the feasibility of using nanoparticle antigens as subunit vaccines in animals, this application prepared an oil-adjuvanted vaccine by emulsifying nanoparticle antigens with a conventional oil adjuvant, and prepared an aqueous adjuvanted vaccine by directly mixing nanoparticle antigens with a traditional Chinese medicine aqueous adjuvant. Immunization experiments in sheep demonstrated that α... m2 -Fe nanoparticle antigen, when combined with traditional Chinese medicine water adjuvant, can significantly improve the titers of ELISA antibodies and neutralizing antibodies.
[0205] III. Conclusion
[0206] This application successfully obtained soluble α m2 ST protein and FeSC protein. α-protein was successfully prepared via in vitro docking. m2 -Fe nanoparticle antigen. Validated in a mouse model, α m2 -Fe nanoparticle antigens not only enhanced humoral immunity in mice but also stimulated cellular immunity. Sheep immunization experiments demonstrated that α... m2 -Fe nanoparticle antigens, when combined with traditional Chinese medicine aqueous adjuvants, significantly improve the titers of ELISA antibodies and neutralizing antibodies. This application provides a new approach for the development of Clostridium perfringens subunit vaccines. Aqueous adjuvant vaccines offer significant advantages in application, allowing for convenient field preparation and rapid mixing with other aqueous vaccines for combined immunization, avoiding the complex emulsification process of oil-adjuvant vaccines and the antigen destruction that occurs during emulsification.
[0207] In the description of this specification, the references to terms such as "some embodiments," "illustrative embodiments," "examples," "specific examples," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with an embodiment or example is included in at least one embodiment or example of this application. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.
[0208] The above description is a preferred embodiment of the invention. It should be noted that, for those skilled in the art, several improvements and modifications can be made without departing from the principle of the invention, and these improvements and modifications are also considered to be within the scope of protection of the invention.
Claims
1. A Clostridium perfringens α-toxin-ferritin nanoparticle antigen, characterized in that, The Clostridium perfringens α-toxin-ferritin nanoparticle antigen is assembled from αm2ST protein and FeSC protein. The αm2ST protein is expressed using an α-protein mutant expression plasmid, and the FeSC protein is expressed using a ferritin expression plasmid. The nucleotide sequence of the α-protein mutant expression plasmid is shown in SEQ ID NO: 1, and the nucleotide sequence of the ferritin expression plasmid is shown in SEQ ID NO:
2.
2. The Clostridium perfringens α-toxin-ferritin nanoparticle antigen as described in claim 1, characterized in that, The α protein mutant expression plasmid was prepared using the following method: The nucleotide sequence is shown in SEQ ID NO: 3, α m2 The ST gene was inserted into the pET28a vector to obtain an α protein mutant expression plasmid.
3. The Clostridium perfringens α-toxin-ferritin nanoparticle antigen as described in claim 1, characterized in that, The ferritin expression plasmid was prepared using the following method: The FeSC gene with the nucleotide sequence shown in SEQ ID NO:4 was inserted into the pET28a vector to obtain the ferritin expression plasmid.
4. A vaccine, characterized in that, Includes the Clostridium perfringens α-toxin-ferritin nanoparticle antigen as described in any one of claims 1 to 3.
5. The vaccine as described in claim 4, characterized in that, It also includes a Chinese herbal adjuvant, which, by weight, comprises: 10 to 15 parts of Astragalus polysaccharide, 4 to 10 parts of cinnamon essential oil, and 1000 to 1100 parts of physiological saline.
6. The vaccine as described in claim 5, characterized in that, The mass ratio of the Clostridium perfringens α-toxin-ferritin nanoparticle antigen to the traditional Chinese medicine aqueous adjuvant is 1:(1~2).
7. The application of the Clostridium perfringens α-toxin-ferritin nanoparticle antigen as described in any one of claims 1 to 3 in (1): characterized in that, (1) Application in the preparation of anti-clostridium perfringens specific antibodies.
8. A method for preparing Clostridium perfringens α-toxin-ferritin nanoparticle antigen as described in any one of claims 1 to 3, characterized in that, Includes the following steps: Construct an expression plasmid of the α-protein mutant with the nucleotide sequence shown in SEQ ID NO: 1; Construct a ferritin expression plasmid with the nucleotide sequence shown in SEQ ID NO: 2; The α protein mutant expression plasmid was expressed to obtain α m2 ST protein; The ferritin expression plasmid was used to express FeSC protein; The α m2 The ST protein and the FeSC protein were assembled to obtain Clostridium perfringens α-toxin-ferritin nanoparticle antigen.
9. The method for preparing Clostridium perfringens α-toxin-ferritin nanoparticle antigen as described in claim 8, characterized in that, The expression plasmid for the α protein mutant was constructed using the following method: The α-toxin gene was amplified from Clostridium perfringens strain A; The α-toxin gene was cloned into the pET 28a vector to obtain the pET-α plasmid; The aspartic acid at position 56 and the histidine at position 68 of the α-toxin gene in the pET-α plasmid were both mutated to glycine to obtain pET-α. m2 plasmids; In the pET-α m2 A Spytag molecular docking tag was added to the plasmid to obtain an α protein mutant expression plasmid.
10. The method for preparing Clostridium perfringens α-toxin-ferritin nanoparticle antigen as described in claim 8, characterized in that, The ferritin expression plasmid was constructed using the following method: After adding a 6*His sequence to the 5' end of the Ferritin gene sequence and adding a (G4S)3Linker sequence and a SpyCatcher sequence to the 3' end, and optimizing the codons, the gene was cloned into the pET28a vector to obtain the ferritin expression plasmid.
Citation Information
Patent Citations
A method for preparing Clostridium perfringens epsilon toxin-ferritin nanoparticle antigen
CN118931931B