Genetically engineered bacterium for efficiently synthesizing gamma-aminobutyric acid from beginning by taking cheap carbon source as substrate without plasmids, method and application

By gene editing on E. coli MG1655, a plasmid-free GABA production strain was constructed, which solved the problems of poor plasmid stability and high antibiotic cost in the prior art, and achieved the effect of efficient synthesis of GABA, and achieved a high industrial application level with yield and sugar acid conversion rate.

CN120098883AActive Publication Date: 2025-06-06TIANJIN UNIV OF SCI & TECH

Patent Information

Application Number
CN202510592031.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-09
Publication Date
2025-06-06
Estimated Expiration
2045-05-09

AI Technical Summary

Technical Problem

Existing GABA production strains rely on exogenous plasmids to express glutamate decarboxylase genes, which have problems such as poor plasmid stability, high cost of antibiotic use, and complex genetic background, which is not conducive to industrial production.

Method used

Based on wild-type E. coli MG1655, a plasmid-free GABA production strain was constructed through CRISPR/Cas9-mediated gene editing technology, overexpressing the T7 RNA polymerase gene from phage, deleting the GABA transaminase gene, overexpressing the GABA transporterase gene and glutamate decarboxylase gene, and dynamically regulating the expression of 2-ketoglutarate dehydrogenase and N-acetyltransferase genes.

Benefits of technology

It has achieved an efficient metabolic network of glucose and xylose flowing to GABA in E. coli, providing innovative ideas for GABA fermentation and production, with a yield of 35.4 g/L and a sugar acid conversion rate of 16.3%, which is the highest output reported in existing reports and has good industrial application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120098883A_ABST
    Figure CN120098883A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of genetic engineering, and discloses a plasmid-free genetically engineered bacterium for efficiently synthesizing gamma-aminobutyric acid from beginning by taking a cheap carbon source as a substrate, a method and application of the genetically engineered bacterium. The genetically engineered bacterium is obtained by overexpressing a T7RNA polymerase gene on the basis of a wild type E.coli MG1655; the gene gabT and the gene puuE are deleted; performing overexpression on the genes of gadC, gadbm, gdh, gltA, pyc and ppc; and the expression of sucA and argA genes in a GABA channel produced by escherichia coli is dynamically regulated and controlled by using a growth coupled promoter. The genetic manipulation of the engineering bacterium is carried out on a genome, plasmid residues, antibiotics and inducers are not used, the production performance is stable, and the fermentation process is simple. The engineering bacteria are used for fermenting for 38 hours under a staged pH value control process, the yield of gamma-aminobutyric acid can reach 35.4 g / L, and the engineering bacteria have a relatively good industrial application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular to a genetic engineering bacterium, method and application thereof, which is free of plasmid and can efficiently synthesize gamma-aminobutyric acid from scratch using a cheap carbon source as a substrate. Background Art

[0002] γ-Aminobutyric acid (GABA) is a non-protein amino acid that is widely present in nature, especially playing an important role as a neurotransmitter in the central nervous system of mammals. GABA inhibits the overexcitation of neurons and maintains the balance of the nervous system. It has multiple physiological functions such as anti-anxiety, anti-depression, and sleep promotion. In addition, GABA also has a wide range of application value in the fields of food, medicine, and health products. For example, in the food industry, GABA is used as a functional food additive with the effects of lowering blood pressure and improving sleep quality; in the medical field, GABA and its derivatives are used to treat neurological diseases such as epilepsy, anxiety, and insomnia. With the increasing market demand for GABA, the development of efficient and low-cost GABA production processes has become a hot topic in current research.

[0003] The production methods of GABA mainly include chemical synthesis, plant extraction and microbial fermentation. Chemical synthesis is the earliest method used in GABA production, which mainly synthesizes GABA under high temperature and high pressure conditions by chemical reagents. However, the chemical synthesis method has problems such as harsh reaction conditions, serious environmental pollution, and many by-products, which limits its industrial application. The plant extraction method is to extract natural GABA from plants rich in GABA. Although this method is environmentally friendly and the product is natural, it is limited by the source of raw materials and extraction efficiency, and it is difficult to meet the needs of large-scale production. In contrast, the microbial fermentation method has the advantages of a wide source of raw materials, low production cost, and environmental friendliness, and is an ideal method for realizing the industrial production of GABA.

[0004] The core of microbial fermentation method for producing GABA is to use glutamate decarboxylase (GAD) in microorganisms to convert glutamate into GABA. Glutamate decarboxylase is an enzyme that depends on pyridoxal phosphate (PLP) and is widely present in microorganisms such as lactic acid bacteria, Escherichia coli, and yeast. In recent years, with the rapid development of metabolic engineering and synthetic biology, genetic engineering of microorganisms to increase GABA production has become a hot topic. For example, in 2005, Park et al. successfully increased GABA production to 10.2 g / L by overexpressing the glutamate decarboxylase gene from lactic acid bacteria in Escherichia coli (Applied Microbiology and Biotechnology, 2005, 68(6): 765-770.). In 2012, Li et al. further increased GABA production to 25.8 g / L by knocking out the GABA transporter gene in Escherichia coli and overexpressing the glutamate decarboxylase gene (Metabolic Engineering, 2012, 14(6): 560-568.). These studies show that the production efficiency of GABA can be significantly improved by optimizing the metabolic pathways of microorganisms through genetic engineering.

[0005] However, most GABA production strains currently rely on exogenous plasmids to express the glutamate decarboxylase gene, which has problems such as poor plasmid stability, high cost of antibiotic use, and complex genetic background, which is not conducive to industrial production. In order to solve these problems, researchers have begun to explore methods for constructing plasmid-free genetic engineering strains in recent years. For example, in 2018, Zhang et al. constructed a plasmid-free GABA production strain by integrating the glutamate decarboxylase gene into the Escherichia coli chromosome, and the GABA production reached 18.5 g / L (Biotechnology for Biofuels, 2018, 11: 238.). In addition, using gene editing technologies such as CRISPR-Cas9, researchers can precisely regulate the metabolic pathways of microorganisms to further improve GABA production and sugar-acid conversion rate. For example, in 2020, Wang et al. used CRISPR-Cas9 technology to knock out the byproduct synthesis gene in Escherichia coli and overexpressed the glutamate decarboxylase gene, increasing the GABA production to 27.8 g / L (Microbial Cell Factories, 2020, 19: 123.).

[0006] Although genetic engineering technology has made significant progress in the construction of GABA-producing strains, most current research is still limited to laboratory scale and cannot meet the needs of industrial production. The main problems include: (1) The metabolic flux of the GABA synthesis pathway is unevenly distributed, resulting in the accumulation of intermediate metabolites and the generation of by-products; (2) The activity of glutamate decarboxylase is greatly affected by factors such as pH and temperature, which limits the efficient synthesis of GABA; (3) During industrial production, the genetic stability and production activity of the strain are difficult to maintain. Therefore, the development of a plasmid-free, inexpensive carbon source-based, and highly efficient de novo GABA-synthesis genetic engineering strain has important scientific significance and application value.

[0007] Through searching, no patent publication documents related to the patent application of the present invention have been found. Summary of the invention

[0008] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a plasmid-free genetically engineered bacterium, method and application thereof for efficiently synthesizing γ-aminobutyric acid from scratch using cheap carbon sources such as glucose as substrate.

[0009] The technical solution adopted by the present invention to solve its technical problem is:

[0010] A plasmid-free genetically engineered bacterium that can efficiently synthesize γ-aminobutyric acid from scratch using a cheap carbon source as a substrate. The genetically engineered bacterium is based on wild-type Escherichia coli E. coli MG1655, overexpresses the phage-derived T7 RNA polymerase gene T7 RNAP, and is driven by a xylose promoter P xylF Control; GABA transaminase genes gabT and puuE were deleted; the endogenous GABA transporter protease gene gadC of Escherichia coli was overexpressed; the glutamate decarboxylase gene gad from Bacillus megaterium was overexpressed bm ; Overexpression of the glutamate dehydrogenase gene gdh (cgl2079) from Corynebacterium glutamicum; Overexpression of the endogenous citrate synthase gene gltA from Escherichia coli; Overexpression of the pyruvate carboxylase gene pyc (cgl0689) from Corynebacterium glutamicum; Overexpression of the endogenous phosphoenolpyruvate carboxylase gene ppc from Escherichia coli; Use of three growth-coupled promoters, namely P rpst , P rpsl , P rrnc The 2-ketoglutarate dehydrogenase gene sucA and the amino acid N-acetyltransferase gene argA in the GABA production pathway of Escherichia coli are dynamically regulated respectively.

[0011] Furthermore, some genes have been registered in Gene Bank, and those skilled in the art can obtain these genes by PCR. For example, the gabT gene is Gene ID 948067, the puuE gene is Gene ID 945446, the gadC gene is Gene ID 946057, and the gad bm The gene is KT895523.1, the gdh gene is Gene ID 1020031, the gltA gene is Gene ID 945323, the pyc gene is Gene ID 1019553, the ppc gene is Gene ID 948457, the sucA gene is Gene ID 945303, and the argA gene is Gene ID 947289;

[0012] The sequence of the T7 RNA polymerase gene is SEQ ID NO.1; the xylose promoter P xylF The sequence of the three growth-coupled promoters is SEQ ID NO.2; rpst The sequence is SEQ ID NO.3, P rpsl The sequence is SEQ ID NO.4, P rrnc The sequence is SEQ ID NO.5.

[0013] The method for constructing the genetically engineered bacteria as described above is to use CRISPR / Cas9-mediated gene editing technology to carry out targeted modification of the E. coli MG1655 genome.

[0014] Furthermore, the specific steps are as follows:

[0015] (1) The RNA polymerase gene T7RNAP from bacteriophage T7 was integrated into the lacI-lacZ site of the E. coli MG1655 genome, and the xylose promoter P xylF control;

[0016] (2) Knockout of the GABA aminotransferase gene gabT;

[0017] (3) Knockout of the GABA aminotransferase gene puuE;

[0018] (4) Integrate the endogenous GABA transporter protease gene gadC of Escherichia coli into the pseudogene site yjgX, and trc Promoter control;

[0019] (5) Integrate the endogenous glutamate decarboxylase gene gad from Bacillus megaterium at the pseudogene site yciQ bm , by P T7 Promoter control;

[0020] (6) The glutamate dehydrogenase gene gdh (cgl2079) from Corynebacterium glutamicum was integrated into the pseudogene site mbhA, driven by the strong promoter P trc control;

[0021] (7) The endogenous citrate synthase gene gltA from Escherichia coli was integrated into the pseudogene site ylbE, and P trc Promoter control;

[0022] (8) The pyruvate carboxylase gene pyc (cgl0689) from Corynebacterium glutamicum was integrated into the pseudogene site yghE. trc Promoter control;

[0023] (9) Integrate the endogenous phosphoenolpyruvate carboxylase gene ppc from Escherichia coli into the pseudogene site gapC;

[0024] (10) Using three growth-coupled promoters P rpst , P rpsl , P rrnc Replace the natural promoter of 2-oxoglutarate dehydrogenase gene sucA;

[0025] (11) Using three growth-coupled promoters P rpst , P rpsl , P rrnc Replaces the native promoter of the amino acid N-acetyltransferase gene argA.

[0026] The application of the genetically engineered bacteria as described above in the production of γ-aminobutyric acid.

[0027] The method for producing gamma-aminobutyric acid by fermentation using the genetically engineered bacteria as described above increases the yield of gamma-aminobutyric acid through a staged pH fermentation control process.

[0028] Furthermore, the method is carried out by a fermentation culture method, wherein the fermentation culture includes shake flask fermentation or fermentation tank fermentation, and the specific operation steps are as follows:

[0029] During shake flask fermentation, the genetically engineered bacteria were first inoculated from a solid slant into a triangular flask containing a seed culture medium, and cultured at 37°C and 220 r / min for 12 h. Then, the seed culture was inoculated with 10-15% of the inoculation amount into a triangular flask containing a fermentation culture medium for fermentation culture, and cultured at 37°C and 220 r / min for 24 h. During the fermentation process, ammonia water was added to maintain the pH between 6.5 to ensure the normal growth of the bacteria, and a 60% mass concentration of glucose solution was added in time to maintain the normal fermentation process.

[0030] During fermentation in a fermenter, the bacterial liquid of the genetically engineered bacteria is taken and evenly coated on an activated slant, and then subcultured; the strain on the activated slant is inoculated into a seed culture medium, and cultured at 37°C for 8-10 hours, and ammonia water is added during the culture process to maintain the pH value at 7.0-7.2; the seed liquid is inoculated into the fermentation culture medium at an inoculation rate of 15-20%, and fermentation culture is started; the initial pH value of the fermentation is controlled at 7.0-7.2, and ammonia water is added after 6-8 hours of fermentation to maintain the pH value at 6.3-6.5; when the glucose in the culture medium is consumed, a glucose solution with a mass concentration of 80% is added to maintain the final mass concentration of residual sugar at 0.1-0.5%; the temperature is controlled at 37°C during the entire fermentation process, the dissolved oxygen value is controlled at 15%-30%, the fermentation cycle is 38 hours, and gamma-aminobutyric acid is obtained.

[0031] Furthermore, the slant culture medium used in the solid slant and activated slant is: glucose 1-2 g / L, peptone 10-15 g / L, beef extract 10-15 g / L, yeast powder 5-8 g / L, NaCl 2.5-5 g / L, agar 20 g / L;

[0032] Alternatively, the seed culture medium is: glucose 25-30 g / L, KH 2 PO 4 1.2-1.5 g / L, MgSO 4 0.5-1.0 g / L, yeast powder 5-8 g / L, FeSO 4 10-12 mg / L, MnSO 4 10-12 mg / L, peptone 3-5g / L, VB 1 ,VB 3 ,VB 5 ,VB 12 、V H Each 1.3-2.5 mg / L; pH 7.0-7.5, 121℃, high pressure steam sterilization for 20 min;

[0033] Alternatively, the fermentation medium is: glucose 20-25 g / L, xylose 5-10 g / L, KH 2 PO 4 2.5-5.0 g / L, MgSO 4 7H 2 O 1.2-2.0 g / L, yeast powder 4-8 g / L, FeSO 4 20-24 mg / L, MnSO 4 10-12 mg / L, sodium citrate 2-3g / L, peptone 5-8g / L, VB 1 ,VB 3 ,VB5 ,VB 12 、V H 2-4 mg / L each, VB 6 50 mg / L; pH 7.0-7.5, 121°C, high pressure steam sterilization for 20 min.

[0034] The advantages and positive effects achieved by the present invention are:

[0035] 1. The present invention designs a reasonable metabolic modification strategy. By deleting the endogenous GABA aminotransferase genes gabT and puuE, the branch metabolism of GABA decomposition into succinic semialdehyde is blocked; the GABA transporter gene gadC is overexpressed to increase the transmembrane transport rate of GABA and reduce product feedback inhibition; the glutamate decarboxylase gene gad derived from Bacillus megaterium is overexpressed to inhibit the production of succinic semialdehyde. bm , the enzyme has high enzyme activity in a near-neutral pH environment; overexpression of the glutamate dehydrogenase gene gdh from Corynebacterium glutamicum strengthens the supply of precursor glutamate; overexpression of the citrate synthase gene gltA from Escherichia coli enhances the TCA cycle flux; overexpression of the pyruvate carboxylase gene pyc from Corynebacterium glutamicum replenishes oxaloacetate through pyruvate carboxylation, maintains the homeostasis of TCA cycle intermediates and drives the synthesis of 2-ketoglutarate; dynamic regulation of the 2-ketoglutarate dehydrogenase gene sucA and the N-acetyltransferase gene argA, so that the expression of the above genes is coupled with growth, normal expression during the bacterial growth period, and weakened expression during the product synthesis period, reducing the metabolic diversion of 2-ketoglutarate and glutamate. The above combined metabolic transformation strategy realizes an efficient metabolic network of glucose and xylose flowing to GABA in Escherichia coli, providing an innovative idea for the construction of Escherichia coli GABA fermentation production bacteria.

[0036] 2. The present invention finely regulates the enzyme expression intensity of key metabolic nodes in the GABA anabolic network, for example, using the T7 RNA polymerase-T7 promoter system to control the expression of glutamate decarboxylase, using the Trc promoter to control the expression of GABA transporter, glutamate dehydrogenase, citrate synthase and pyruvate carboxylase; using a growth-coupled promoter to control the expression of 2-ketoglutarate dehydrogenase and N-acetyltransferase; these expression controls achieve metabolic balance, ensure the normal growth of the bacteria, and direct more carbon metabolism to the synthesis of the target product, thereby increasing the utilization rate of carbon atoms.

[0037] 3. The gene manipulation involved in constructing the γ-aminobutyric acid engineering bacteria of the present invention is all performed on the genome, there is no plasmid residue, no antibiotics and inducers are used, the production performance is stable, and the fermentation process is simple. Using the γ-aminobutyric acid engineering strain, fermentation is carried out for 38 hours under appropriate fermentation conditions. Without adding the substrate glutamate during the fermentation process, relying only on cheap carbon sources such as glucose as the starting substrate, the γ-aminobutyric acid production can reach 35.4 g / L, and the sugar-acid conversion rate reaches 16.3%, which is the highest yield of γ-aminobutyric acid synthesized from scratch by Escherichia coli reported so far, and has good industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a diagram of the metabolic transformation strategy of the γ-aminobutyric acid genetically engineered bacteria of the present invention;

[0039] Figure 2 The electrophoresis diagram for constructing and verifying the integration fragment of T7RNAP gene in the present invention; wherein, M—1kb DNA Marker; 1—upstream homology arm; 2—downstream homology arm; 3—target gene; 4—overlapping fragment; 5—original bacteria PCR fragment; 6—positive single colony PCR identification fragment;

[0040] Figure 3 The electrophoresis diagram for constructing and verifying the gabT gene knockout fragment in the present invention; wherein, M—1kb DNA Marker; 1—upstream homology arm; 2—downstream homology arm; 3—overlapping fragment; 4—original bacteria PCR fragment; 5—positive single colony PCR identification fragment;

[0041] Figure 4 The electrophoresis diagram for constructing and verifying the puuE gene knockout fragment in the present invention; wherein, M—1kb DNA Marker; 1—upstream homology arm; 2—downstream homology arm; 3—overlapping fragment; 4—original bacteria PCR fragment; 5—positive single colony PCR identification fragment;

[0042] Figure 5 In the present invention, yjgX:: P trc - Construction and verification electrophoresis of gadC gene integration fragment; where M is 1 kb DNA Marker; 1 is upstream homology arm; 2 is downstream homology arm; 3 is target gene; 4 is overlapping fragment; 5 is original bacteria PCR fragment; 6 is positive single colony PCR identification fragment;

[0043] Figure 6 is yciQ::P in the present invention T7 -gad bmIntegration fragment construction and verification electrophoresis diagram; where M—1kb DNA Marker; 1—upstream homology arm; 2—downstream homology arm; 3—target gene; 4—overlapping fragment; 5—original bacteria PCR fragment; 6—positive single colony PCR identification fragment;

[0044] Figure 7 is mbhA::P in the present invention trc -gdh integration fragment construction and verification electrophoresis diagram; where M—1kb DNA Marker; 1—upstream homology arm; 2—target gene; 3—downstream homology arm; 4—overlapping fragment; 5—original bacteria PCR fragment; 6—positive single colony PCR identification fragment;

[0045] Figure 8 ylbE::P trc - Construction and verification electrophoresis of gltA integration fragment; where M is 1 kb DNA Marker; 1 is upstream homology arm; 2 is target gene; 3 is downstream homology arm; 4 is overlapping fragment; 5 is original bacteria PCR fragment; 6 is positive single colony PCR identification fragment;

[0046] Fig. 9 is yghE::P in the present invention trc -pyc integration fragment construction and verification electrophoresis diagram; where M—1kb DNA Marker; 1—upstream homology arm; 2—target gene; 3—downstream homology arm; 4—overlapping fragment; 5—original bacteria PCR fragment; 6—positive single colony PCR identification fragment;

[0047] Fig.10 In the present invention, gapC::P trc -ppc integration fragment construction and verification electrophoresis diagram; where M—1kb DNA Marker; 1—upstream homology arm; 2—target gene; 3—downstream homology arm; 4—overlapping fragment; 5—original bacteria PCR fragment; 6—positive single colony PCR identification fragment;

[0048] Fig.11 This is the electrophoresis diagram for constructing and verifying the sucA gene knockout fragment in the present invention; wherein, M—1kb DNA Marker; 1—upstream homology arm; 2—downstream homology arm; 3—overlapping fragment; 4—original bacteria PCR fragment; 5—positive single colony PCR identification fragment;

[0049] Fig.12 In the present invention, P rpst , P rpsl , P rrnc ::P sucAThe electrophoresis diagram of the construction and verification of the dynamic integration fragment; M—1kb DNA Marker; 1—original bacteria PCR fragment (sucA knockout gene); 2—positive single colony PCR identification fragment (P rpst ); 3-positive single colony PCR identification fragment (P rpsl ); 4-positive single colony PCR identification fragment (P rrnc );

[0050] Fig.13 This is the electrophoresis diagram for constructing and verifying the argA gene knockout fragment in the present invention; wherein, M—1kb DNA Marker; 1—upstream homology arm; 2—downstream homology arm; 3—overlapping fragment; 4—original bacteria PCR fragment; 5—positive single colony PCR identification fragment;

[0051] Fig.14 In the present invention, P rpst , P rpsl , P rrnc ::P argA The electrophoresis diagram of the construction and verification of the dynamic integration fragment; M—1kb DNA Marker; 1—original bacteria PCR fragment (argA knockout gene); 2—positive single colony PCR identification fragment (P rpst ); 3-positive single colony PCR identification fragment (P rpsl ); 4-positive single colony PCR identification fragment (P rrnc );

[0052] Fig.15 This is a comparison chart of γ-aminobutyric acid production of 2-oxoglutarate dehydrogenase gene strains under the control of three growth-coupled promoters using genetically engineered bacteria shake flask fermentation in the present invention;

[0053] Fig.16 This is a comparison chart of γ-aminobutyric acid production of strains expressing amino acid N-acetyltransferase genes under the control of three growth-coupled promoters using shake flask fermentation of genetically engineered bacteria in the present invention;

[0054] Fig.17 This is a process diagram of producing γ-aminobutyric acid by fermentation in a fermenter using genetically engineered bacteria in the present invention. DETAILED DESCRIPTION

[0055] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0056] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0057] A plasmid-free genetically engineered bacterium that can efficiently synthesize γ-aminobutyric acid from scratch using a cheap carbon source as a substrate. The genetically engineered bacterium is based on wild-type Escherichia coli E. coli MG1655, overexpresses the phage-derived T7 RNA polymerase gene T7 RNAP, and is driven by a xylose promoter P xylF Control; GABA transaminase genes gabT and puuE were deleted; the endogenous GABA transporter protease gene gadC of Escherichia coli was overexpressed; the glutamate decarboxylase gene gad from Bacillus megaterium was overexpressed bm ; Overexpression of the glutamate dehydrogenase gene gdh (cgl2079) from Corynebacterium glutamicum; Overexpression of the endogenous citrate synthase gene gltA from Escherichia coli; Overexpression of the pyruvate carboxylase gene pyc (cgl0689) from Corynebacterium glutamicum; Overexpression of the endogenous phosphoenolpyruvate carboxylase gene ppc from Escherichia coli; Use of three growth-coupled promoters, namely P rpst , P rpsl , P rrnc The 2-ketoglutarate dehydrogenase gene sucA and the amino acid N-acetyltransferase gene argA in the GABA production pathway of Escherichia coli are dynamically regulated respectively.

[0058] Preferably, some genes have been registered in Gene Bank, and those skilled in the art can obtain these genes by PCR. As an example, the gabT gene is Gene ID 948067, the puuE gene is Gene ID 945446, the gadC gene is Gene ID 946057, and the gad bm The gene is KT895523.1, the gdh gene is Gene ID 1020031, the gltA gene is Gene ID 945323, the pyc gene is Gene ID 1019553, the ppc gene is Gene ID 948457, the sucA gene is Gene ID 945303, and the argA gene is Gene ID 947289;

[0059] The sequence of the T7 RNA polymerase gene is SEQ ID NO.1; the xylose promoter P xylF The sequence of the three growth-coupled promoters is SEQ ID NO.2; rpst The sequence is SEQ ID NO.3, P rpslThe sequence is SEQ ID NO.4, P rrnc The sequence is SEQ ID NO.5.

[0060] The method for constructing the genetically engineered bacteria as described above is to use CRISPR / Cas9-mediated gene editing technology to carry out targeted modification of the E. coli MG1655 genome.

[0061] Preferably, the specific steps are as follows:

[0062] (1) The RNA polymerase gene T7RNAP from bacteriophage T7 was integrated into the lacI-lacZ site of the E. coli MG1655 genome, and the xylose promoter P xylF control;

[0063] (2) Knockout of the GABA aminotransferase gene gabT;

[0064] (3) Knockout of the GABA aminotransferase gene puuE;

[0065] (4) Integrate the endogenous GABA transporter protease gene gadC of Escherichia coli into the pseudogene site yjgX, and trc Promoter control;

[0066] (5) Integrate the endogenous glutamate decarboxylase gene gad from Bacillus megaterium at the pseudogene site yciQ bm , by P T7 Promoter control;

[0067] (6) The glutamate dehydrogenase gene gdh (cgl2079) from Corynebacterium glutamicum was integrated into the pseudogene site mbhA, driven by the strong promoter P trc control;

[0068] (7) The endogenous citrate synthase gene gltA from Escherichia coli was integrated into the pseudogene site ylbE, and P trc Promoter control;

[0069] (8) The pyruvate carboxylase gene pyc (cgl0689) from Corynebacterium glutamicum was integrated into the pseudogene site yghE. trc Promoter control;

[0070] (9) Integrate the endogenous phosphoenolpyruvate carboxylase gene ppc from Escherichia coli into the pseudogene site gapC;

[0071] (10) Using three growth-coupled promoters P rpst , P rpsl , P rrncReplace the natural promoter of 2-oxoglutarate dehydrogenase gene sucA;

[0072] (11) Using three growth-coupled promoters P rpst , P rpsl , P rrnc Replaces the native promoter of the amino acid N-acetyltransferase gene argA.

[0073] The application of the genetically engineered bacteria as described above in the production of γ-aminobutyric acid.

[0074] The method for producing gamma-aminobutyric acid by fermentation using the genetically engineered bacteria as described above increases the yield of gamma-aminobutyric acid through a staged pH fermentation control process.

[0075] Preferably, the method is carried out by a fermentation culture method, wherein the fermentation culture includes shake flask fermentation or fermentation tank fermentation, and the specific operation steps are as follows:

[0076] During shake flask fermentation, the genetically engineered bacteria were first inoculated from a solid slant into a triangular flask containing a seed culture medium, and cultured at 37°C and 220 r / min for 12 h. Then, the seed culture was inoculated with 10-15% of the inoculation amount into a triangular flask containing a fermentation culture medium for fermentation culture, and cultured at 37°C and 220 r / min for 24 h. During the fermentation process, ammonia water was added to maintain the pH between 6.5 to ensure the normal growth of the bacteria, and a 60% mass concentration of glucose solution was added in time to maintain the normal fermentation process.

[0077] During fermentation in a fermenter, the bacterial liquid of the genetically engineered bacteria is taken and evenly coated on an activated slant, and then subcultured; the strain on the activated slant is inoculated into a seed culture medium, and cultured at 37°C for 8-10 hours, and ammonia water is added during the culture process to maintain the pH value at 7.0-7.2; the seed liquid is inoculated into the fermentation culture medium at an inoculation rate of 15-20%, and fermentation culture is started; the initial pH value of the fermentation is controlled at 7.0-7.2, and ammonia water is added after 6-8 hours of fermentation to maintain the pH value at 6.4-6.5; when the glucose in the culture medium is consumed, a glucose solution with a mass concentration of 80% is added to maintain the final mass concentration of residual sugar at 0.1-0.5%; the temperature is controlled at 37°C during the entire fermentation process, the dissolved oxygen value is controlled at 15%-30%, the fermentation cycle is 38 hours, and gamma-aminobutyric acid is obtained.

[0078] Preferably, the slant culture medium used in the solid slant and activated slant is: glucose 1-2 g / L, peptone 10-15 g / L, beef extract 10-15 g / L, yeast powder 5-8 g / L, NaCl 2.5-5 g / L, agar 20 g / L;

[0079] Alternatively, the seed culture medium is: glucose 25-30 g / L, KH 2 PO 4 1.2-1.5 g / L, MgSO 4 0.5-1.0 g / L, yeast powder 5-8 g / L, FeSO 4 10-12 mg / L, MnSO 4 10-12 mg / L, peptone 3-5g / L, VB 1 ,VB 3 ,VB 5 ,VB 12 、V H Each 1.3-2.5 mg / L; pH 7.0-7.5, 121℃, high pressure steam sterilization for 20 min;

[0080] Alternatively, the fermentation medium is: glucose 20-25 g / L, xylose 5-10 g / L, KH 2 PO 4 2.5-5.0 g / L, MgSO 4 7H 2 O 1.2-2.0 g / L, yeast powder 4-8 g / L, FeSO 4 20-24 mg / L, MnSO 4 10-12 mg / L, sodium citrate 2-3g / L, peptone 5-8g / L, VB 1 ,VB 3 ,VB 5 ,VB 12 、V H 2-4 mg / L each, VB 6 50 mg / L; pH 7.0-7.5, 121°C, high pressure steam sterilization for 20 min.

[0081] Specifically, the relevant preparation and detection are as follows:

[0082] Example 1: Construction of γ-aminobutyric acid genetic engineering strain (transformation strategy see Figure 1 ):

[0083] 1. Gene Editing Methods

[0084] The present invention adopts a CRISPR / Cas9-mediated gene editing method, which can be carried out with reference to the literature (MetabolicEngineering, 2015, 31: 13-21.). CRISPR / Cas9 is a precise and efficient new gene targeting modification technology. The two plasmids used in this method are pGRB and pREDCas9. The pREDCas9 plasmid is a temperature-sensitive plasmid, carrying a gRNA plasmid elimination system, a lambda phage Red recombination system and a Cas9 protein expression system, and has spectinomycin resistance (working concentration: 100 mg / L), and an optimal culture temperature of 32°C; the pGRB plasmid, with pUC18 as the backbone, contains a promoter J23100, a gRNA-Cas9 binding region sequence and a terminator sequence, and has ampicillin resistance (working concentration: 100 mg / L), and an optimal culture temperature of 37°C.

[0085] 2. Specific process of strain construction

[0086] A plasmid-free genetically engineered bacterium that efficiently synthesizes γ-aminobutyric acid from scratch using cheap carbon sources such as glucose as substrates. The γ-aminobutyric acid genetically engineered bacterium is based on wild-type Escherichia coli E. coli MG1655, overexpresses the T7 RNA polymerase gene from bacteriophage, deletes the GABA aminotransferase genes gabT and puuE, overexpresses the endogenous GABA transporter protease gene gadC from Escherichia coli, overexpresses the glutamate decarboxylase gene gadC from Bacillus megaterium, and overexpresses the glutamate decarboxylase gene gadC from Bacillus megaterium. bm ; Overexpression of the glutamate dehydrogenase gene gdh (cgl2079) from Corynebacterium glutamicum; Overexpression of the endogenous citrate synthase gene gltA from Escherichia coli; Overexpression of the pyruvate carboxylase gene pyc (cgl0689) from Corynebacterium glutamicum; Overexpression of the endogenous phosphoenolpyruvate carboxylase gene ppc from Escherichia coli; Use of three growth-coupled promoters (P rpst , P rpsl , P rrnc ) dynamically regulate the 2-ketoglutarate dehydrogenase gene sucA and the amino acid N-acetyltransferase gene argA in the GABA production pathway of Escherichia coli.

[0087] 2.1 Integration of the T7RNAP gene into the lacI-lacZ locus of the E. coli MG1655 genome

[0088] Using the genome of E. coli MG1655 (numbered E. coli G1) as a template, upstream homology arm primers UP-lacI-lacZ-S (SEQ ID NO.11), UP-lacI-lacZ-A (SEQ ID NO.12) and downstream homology arm primers DN-lacI-lacZ-S (SEQ ID NO.13), DN-lacI-lacZ-A (SEQ ID NO.14) were designed according to the upper and lower sequences of its lacI-lacZ gene, and the upstream and downstream homology arm fragments were amplified by PCR; the sequence of the T7 RNA polymerase gene T7 RNAP (SEQ ID NO.1) was obtained by gene synthesis, which contained the xylose promoter P xylF (SEQ ID NO.2), primers T7RNAP-S (SEQ ID NO.15) and T7RNAP-A (SEQ ID NO.16) were designed according to the T7RNAP gene sequence, and PCR was performed to amplify the T7RNAP fragment; the above fragments were used to obtain the integration fragment of the T7RNAP gene (upstream homology arm-P xylF -T7RNAP- downstream homology arm). Primers gRNA-lacI-lacZ-S (SEQ ID NO.17) and gRNA-lacI-lacZ-A (SEQ ID NO.18) were designed to amplify the DNA fragment containing the 20 bp target sequence (SEQ ID NO.19) on the lacI-lacZ gene sequence, and the recombinant pGRB-lacI-lacZ was obtained after recombination with the linearized pGRB vector. The integrated fragment and pGRB-lacI-lacZ were electroporated into E. coli G1 competent cells containing pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-lacI-lacZ used for gene editing was eliminated, that is, strain E. coli G2. The verification figure is shown in the figure below. Figure 2 shown.

[0089] 2.2 gabT gene knockout

[0090] According to the upstream and downstream sequences of the gabT gene, upstream homology arm primers UP-gabT-S (SEQ ID NO.20), UP-gabT-A (SEQ ID NO.21) and downstream homology arm primers DN-gabT-S (SEQ ID NO.22), DN-gabT-A (SEQ ID NO.23) were designed. Using E. coli G2 as a template, the upstream and downstream homology arms were amplified by PCR technology, and the knockout fragment of the gene (upstream homology arm-downstream homology arm) was obtained by recombinant PCR. The DNA fragment containing the target sequence of the gabT target gene 20 bp (SEQ ID NO.26) was obtained by annealing the primers gRNA-gabT-S (SEQ ID NO.24) and gRNA-gabT-A (SEQ ID NO.25), and the recombinant pGRB-gabT was obtained after recombination with the linearized pGRB vector. The integration fragment and pGRB-gabT were electroporated into E. coli G2 competent cells containing pREDCas9 plasmid, and single colonies were obtained by resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-gabT used for gene editing was eliminated, that is, strain E. coli G3. The verification picture is shown in the figure Figure 3 shown.

[0091] 2.3 puuE gene knockout

[0092] According to the upstream and downstream sequences of the puuE gene, upstream homology arm primers UP-puuE-S (SEQ ID NO.27), UP-puuE-A (SEQ ID NO.28) and downstream homology arm primers DN-puuE-S (SEQ ID NO.29), DN-puuE-A (SEQ ID NO.30) were designed. Using E. coli G3 as a template, the upstream and downstream homology arms were amplified by PCR technology, and the knockout fragment of the gene (upstream homology arm-downstream homology arm) was obtained by recombinant PCR. A DNA fragment containing the target sequence of the puuE target gene 20 bp (SEQ ID NO.33) was obtained by annealing primers gRNA-puuE-S (SEQ ID NO.31) and gRNA-puuE-A (SEQ ID NO.32), and recombined with the linearized pGRB vector to obtain the recombinant pGRB-puuE. The integration fragment and pGRB-puuE were electroporated into E. coli G3 competent cells containing pREDCas9 plasmid, and single colonies were obtained by resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-puuE used for gene editing was eliminated, that is, strain E. coli G4. The verification diagram is shown in the figure below. Figure 4 shown.

[0093] 2.4 Integration of the gadC gene at the yjgX pseudogene locus

[0094] According to the upstream and downstream sequences of the pseudogene, upstream homology arm primers UP-yjgX-S (SEQ ID NO.34) and UP-yjgX-P were designed. trc -A (SEQ ID NO.35); downstream homology arm primer DN-T trc -yjgX-S (SEQ ID NO.36) and DN-yjgX-A (SEQ ID NO.37), using E. coli G4 as template, using PCR technology to amplify the upstream and downstream homology arms of the yjgX gene; according to the gene sequence of gadC, primers P trc -gadC-S (SEQ ID NO.38), gadC-T trc -A (SEQ ID NO.39), amplify the target gene. trc The promoter is designed in the antisense primer of the upstream homology arm of the pseudogene and the sense primer of the target gene; T trc The terminator was designed in the antisense primer of the target gene and the sense primer of the downstream homologous arm of the pseudogene site. The integrated fragment of the gene (upstream homologous arm-target gene-downstream homologous arm) was obtained by recombinant PCR. A DNA fragment containing the target sequence of the yjgX pseudogene 20 bp (SEQ ID NO.42) was obtained by annealing primers gRNA-yjgX-S (SEQ ID NO.40) and gRNA-yjgX-A (SEQ ID NO.41), and recombined with the linearized pGRB vector to obtain recombinant pGRB-yjgX. The integrated fragment and pGRB-yjgX were electrotransformed into E. coli G4 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-yjgX used for gene editing was eliminated, that is, strain E. coli G5. The verification figure is as shown Figure 5 shown.

[0095] 2.5 gad bm Integration of genes at the yciQ pseudogene locus

[0096] According to the upstream and downstream sequences of the pseudogene, upstream homology arm primers UP-yciQ-S (SEQ ID NO.43) and UP-yciQ-P were designed. T7 -A (SEQ ID NO.44); downstream homology arm primer DN-T T7-yciQ-S (SEQ ID NO.45) and DN-yciQ-A (SEQ ID NO.46), using E. coli G5 as template, using PCR technology to amplify the upstream and downstream homology arms of the pseudogene; according to the gene sequence of gadbm, primers P T7 -gadbm-S (SEQ ID NO.47), gadbm-T T7 -A (SEQ ID NO.48), amplify the target gene. T7 The promoter is designed in the antisense primer of the upstream homology arm of the pseudogene and the sense primer of the target gene; T T7 The terminator was designed in the antisense primer of the target gene and the positive primer of the downstream homologous arm of the pseudogene site. The integrated fragment of the gene (upstream homologous arm-target gene-downstream homologous arm) was obtained by recombinant PCR. A DNA fragment containing the yciQ pseudogene 20 bp (SEQ ID NO.51) target sequence was obtained by annealing primers gRNA-yciQ-S (SEQ ID NO.49) and gRNA-yciQ-A (SEQ ID NO.50), and recombined with the linearized pGRB vector to obtain recombinant pGRB-yciQ. The integrated fragment and pGRB-yciQ were electrotransformed into E. coli G5 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-yciQ used for gene editing was eliminated, that is, strain E. coli G6, as shown in the verification figure. Figure 6 shown.

[0097] 2.6 Integration of the gdh gene at the mbhA locus

[0098] According to the upstream and downstream sequences of the pseudogene, upstream homology arm primers UP-mbhA-S (SEQ ID NO.52) and UP-mbhA-P were designed. trc -A (SEQ ID NO.53); downstream homology arm primer DN-T trc -mbhA-S (SEQ ID NO.54) and DN-mbhA-A (SEQ ID NO.55); using the E. coli G6 genome as a template, PCR technology was used to amplify the upstream and downstream homologous arms of the pseudogene; according to the gene sequence of gdh, primers P trc -gdh-S (SEQ ID NO.56), gdh-T trc -A (SEQ ID NO.57), amplify the target gene. trc The promoter is designed in the antisense primer of the upstream homology arm of the pseudogene and the sense primer of the target gene; T trcThe terminator was designed in the antisense primer of the target gene and the sense primer of the downstream homologous arm of the pseudogene site. The integrated fragment of the gene (upstream homologous arm-target gene-downstream homologous arm) was obtained by recombinant PCR. A DNA fragment containing the target sequence of the mbhA pseudogene 20 bp (SEQ ID NO.60) was obtained by annealing primers gRNA-mbhA-S (SEQ ID NO.58) and gRNA-mbhA-A (SEQ ID NO.59), and recombined with the linearized pGRB vector to obtain recombinant pGRB-mbhA. The integrated fragment and pGRB-mbhA were electrotransformed into E. coli G6 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-mbhA used for gene editing was eliminated, that is, strain E. coli 7, as shown in the verification figure. Figure 7 shown.

[0099] 2.7 Integration of the gltA gene at the ylbE locus

[0100] According to the upstream and downstream sequences of the pseudogene, upstream homology arm primers UP-ylbE-S (SEQ ID NO.61), UP-ylbE-P trc -A (SEQ ID NO.62); downstream homology arm primer DN-T trc -ylbE-S (SEQ ID NO.63) and DN-ylbE-A (SEQ ID NO.64). Using the E. coli G7 genome as a template, PCR technology was used to amplify the upstream and downstream homologous arms of the pseudogene; primers P were designed based on the gene sequence of gltA. trc -gltA-S (SEQ ID NO.65), gltA-T trc -A (SEQ ID NO.66), amplify the target gene. trc The promoter is designed in the antisense primer of the upstream homology arm of the pseudogene and the sense primer of the target gene; T trcThe terminator is designed in the antisense primer of the target gene and the sense primer of the downstream homologous arm of the pseudogene site. The integrated fragment of the gene (upstream homologous arm-target gene-downstream homologous arm) is obtained by the recombinant PCR method. The DNA fragment containing the target sequence of the ylbE pseudogene 20bp (SEQ ID NO.69) is obtained by annealing primers gRNA-ylbE-S (SEQ ID NO.67) and gRNA-ylbE-A (SEQ ID NO.68), and the recombinant pGRB-ylbE is obtained after recombination with the linearized pGRB vector. The integrated fragment and pGRB-ylbE are electrotransformed into E. coli G7 competent cells containing the pREDCas9 plasmid, and a single colony is obtained by recovery culture. The positive recombinant is obtained by PCR colony verification, and then the pGRB-ylbE used for gene editing is eliminated, that is, the strain E. coli G8, as shown in the verification figure. Figure 8 shown.

[0101] 2.8 Integration of the pyc gene at the yghE locus

[0102] According to the upstream and downstream sequences of the pseudogene, upstream homology arm primers UP-yghE-S (SEQ ID NO.70), UP-yghE-P trc -A (SEQ ID NO.71) and downstream homology arm primer DN-T trc -yghE-S (SEQ ID NO.72), DN-yghE-A (SEQ ID NO.73). Using the E. coli G8 genome as a template, PCR technology was used to amplify the upstream and downstream homology arms; primers P were designed according to the gene sequence of PyC trc -pyc-S (SEQ ID NO.74), pyc-T trc -A (SEQ ID NO.75), amplify the target gene. trc The promoter is designed in the antisense primer of the upstream homology arm of the pseudogene and the sense primer of the target gene; T trcThe terminator was designed in the antisense primer of the target gene and the sense primer of the downstream homologous arm of the pseudogene site. The integrated fragment of the gene (upstream homologous arm-target gene-downstream homologous arm) was obtained by recombinant PCR. A DNA fragment containing the target sequence of the yghE pseudogene 20 bp (SEQ ID NO.78) was obtained by annealing primers gRNA-yghE-S (SEQ ID NO.76) and gRNA-yghE-A (SEQ ID NO.77), and recombined with the linearized pGRB vector to obtain recombinant pGRB-yghE. The integrated fragment and pGRB-yghE were electrotransformed into E. coli G8 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-yghE used for gene editing was eliminated, that is, strain E. coli G9. The verification figure is as shown Fig. 9 shown.

[0103] 2.9 Integration of the ppc gene at the gapC gene locus

[0104] According to the upstream and downstream sequences of the pseudogene, upstream homology arm primers UP-gapC-S (SEQ ID NO.79), UP-gapC -P trc -A (SEQ ID NO.80) and downstream homology arm primer DN-T trc -gapC-S (SEQ ID NO.81), DN-gapC-A (SEQ ID NO.82). Using the E. coli G9 genome as a template, PCR technology was used to amplify the upstream and downstream homology arms; primers P were designed according to the gene sequence of ppc trc -ppc-S (SEQ ID NO.83), ppc-T trc -A (SEQ ID NO.84), amplify the target gene. The integrated fragment of the gene (upstream homology arm-target gene-downstream homology arm) was obtained by recombinant PCR. A DNA fragment containing the target sequence of the gapC pseudogene 20 bp (SEQ ID NO.87) was obtained by annealing primers gRNA-gapC-S (SEQ ID NO.85) and gRNA-gapC-A (SEQ ID NO.86), and recombined with the linearized pGRB vector to obtain recombinant pGRB-gapC. The integrated fragment and pGRB-gapC were electroporated into E. coli G9 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-gapC used for gene editing was eliminated, that is, strain E. coli G10, as shown in the verification figure. Fig.10 shown.

[0105] 2.10 Dynamic regulation strategy of sucA gene

[0106] Dynamic regulation adopts the strategy of knockout first and then integration. According to the upstream and downstream sequences of the sucA gene, upstream homology arm primers UP-sucA-S (SEQ ID NO.88), UP-sucA-A (SEQ ID NO. 89) and downstream homology arm primers DN-sucA-S (SEQ ID NO.90), DN-sucA-A (SEQ ID NO.91) were designed, and the upstream and downstream homology arms were amplified by PCR technology using E. coli G10 templates. The knockout fragment of the gene (upstream homology arm-downstream homology arm) was obtained by the recombinant PCR method. The DNA fragment containing the target sequence of the sucA target gene 20 bp (SEQ ID NO.94) was obtained by annealing the primers gRNA-sucA-S (SEQ ID NO.92) and gRNA-sucA-A (SEQ ID NO.93), and the recombinant pGRB-sucA was obtained after recombination with the linearized pGRB vector. The integrated fragment and pGRB-sucA were electroporated into E. coli G10 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-sucA used for gene editing was eliminated, that is, strain E. coli G11. The verification figure is shown in the figure Fig.11 On this basis, according to the upstream and downstream sequences of the sucA gene and three growth-coupled promoters P rpsl , P rpst , P rrnc The upstream homology arm primers UP-sucA-S (SEQ ID NO.88), UP-P rpsl -A (SEQ ID NO.95), UP-P rpst -A1 (SEQ ID NO.96), UP-P rpst -A2 (SEQ ID NO.97), UP-P rrnc -A1 (SEQ ID NO.98), UP-P rrnc -A2 (SEQ ID NO.99) and downstream homology arm primer DN-P rpsl -S (SEQ ID NO.100), DN-P rpst -S1 (SEQ ID NO.101), DN-P rpst -S2 (SEQ ID NO. 102), DN-P rrnc -S1 (SEQ ID NO. 103), DN-P rrnc-S2 (SEQ ID NO.104), DN-sucA-A (SEQID NO.91), plasmid No. 4 20 bp (SEQ ID NO.10) target sequence gene was designed in the downstream primer of the upstream homology arm of gene sucA and the upstream primer of the downstream homology arm. Using E. coli G11 genome as template, PCR technology was used to amplify the upstream and downstream homology arms; the integrated fragment of the gene (upstream homology arm-P rpsl -sucA-downstream homology arm), (upstream homology arm-P rpst -sucA-downstream homology arm), (upstream homology arm-P rrnc -sucA- downstream homology arm). The DNA fragment containing the target sequence of the exogenous plasmid gene No. 4 was obtained by annealing primers gRNA-S1 (SEQ ID NO.105) and gRNA-A1 (SEQ ID NO.106), and the recombinant pGRB-sucA2 was obtained after recombination with the linearized pGRB vector. The integrated fragment and pGRB-sucA2 were electrotransformed into E. coli G11 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-sucA2 used for gene editing was eliminated, that is, strains E. coli G12, E. coli G13, and E. coli G14. The verification figure is as shown Fig.12 As shown. The No. 4 plasmid and gene segment integration method refer to the literature (Journal of Industrial Microbiology & Biotechnology, 2019, 46(1):81-90.)

[0107] 2.11 Dynamic regulation strategy of argA gene

[0108] Dynamic regulation adopts the strategy of knocking out first and then integrating. According to the upstream and downstream sequences of the argA gene, upstream homology arm primers UP-argA-S (SEQ ID NO.107), UP-argA-A (SEQ ID NO.108) and downstream homology arm primers DN-argA-S (SEQ ID NO.109), DN-argA-A (SEQ ID NO.110) were designed. Using E. coli G13 as a template, the upstream and downstream homology arms were amplified by PCR technology, and the knockout fragment of the gene (upstream homology arm-downstream homology arm) was obtained by recombinant PCR. The DNA fragment containing the target sequence of the argA target gene 20bp (SEQ ID NO.113) was obtained by annealing the primers gRNA-argA-S (SEQ ID NO.111) and gRNA-argA-A (SEQ ID NO.112), and the recombinant pGRB-argA was obtained after recombination with the linearized pGRB vector. The integrated fragment and pGRB-argA were electroporated into E. coli G13 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by resuscitation culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-argA used for gene editing was eliminated, that is, strain E. coli G15. The verification figure is shown in the figure Fig.13 On this basis, according to the upstream and downstream sequences of the argA gene and three growth-coupled promoters P rpst , P rpsl , P rrnc The upstream homology arm primers UP-argA-S (SEQ ID NO.107), UP-P rpst -AA1 (SEQ ID NO.114), UP-P rpst -AA2 (SEQ ID NO.115), UP-P rpsl -AA (SEQ ID NO. 116), UP-P rrnc -AA1 (SEQ ID NO.117), UP-P rrnc -AA2 (SEQ ID NO.118) and downstream homology arm primer DN-P rpst -SS1 (SEQ ID NO.119), DN-P rpst -SS2 (SEQ ID NO. 120), DN-P rpsl -SS (SEQ ID NO.121), DN-P rrnc -SS1 (SEQ ID NO.122), DN-P rrnc-SS2 (SEQ ID NO.123), DN-argA-A (SEQ ID NO.110), and the 20 bp gene sequence of plasmid No. 4 (SEQ ID NO.10) was designed in the downstream primer of the upstream homology arm of gene argA and the upstream primer of the downstream homology arm. Using the E. coli G15 genome as a template, the upstream and downstream homology arms were amplified by PCR technology; the integrated fragment of the gene (upstream homology arm-P rpst -argA-downstream homology arm), (upstream homology arm-P rpsl -argA-downstream homology arm), (upstream homology arm-P rrnc -argA- downstream homology arm). The DNA fragment containing the target sequence of the exogenous plasmid gene No. 4 was obtained by annealing with the primers gRNA-S1 (SEQ ID NO.105) and gRNA-A1 (SEQ ID NO.106), and the recombinant pGRB-argA2 was obtained after recombination with the linearized pGRB vector. The integrated fragment and pGRB-argA2 were electrotransformed into E. coli G15 competent cells containing the pREDCas9 plasmid, and single colonies were obtained by recovery culture. Positive recombinants were obtained by PCR colony verification, and then pGRB-argA2 used for gene editing was eliminated, that is, strains E. coli G16, E. coli G17, and E. coli G18, as shown in the verification figure. Fig.14 As shown. The No. 4 plasmid and gene segment integration method refer to the literature (Journal of Industrial Microbiology & Biotechnology, 2019, 46(1):81-90.)

[0109] 3. Primers used in strain construction

[0110] All primers used in the strain construction process are shown in the table below:

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119] Example 2: Production of γ-aminobutyric acid by shake flask fermentation using genetically engineered bacteria.

[0120] First, the genetically engineered strain was inoculated from the solid slant into a triangular flask containing a seed culture medium, and cultured at 37°C and 220 r / min for 12 h. Then, the seed culture was inoculated with 10-15% of the inoculation amount into a triangular flask containing a fermentation culture medium for fermentation culture, and cultured at 37°C and 220 r / min for 24 h. During the fermentation process, ammonia water was added to maintain the pH between 6.5 to ensure the normal growth of the strain, and a 60% mass concentration of glucose solution was added in time to maintain the normal fermentation process.

[0121] The slant culture medium formula of the solid slant is: glucose 1 g / L, peptone 10 g / L, beef extract 10 g / L, yeast powder 5 g / L, sodium chloride 2.5 g / L, agar 30 g / L;

[0122] The seed culture medium formula is: glucose 25-30 g / L, KH 2 PO 4 1.2-1.5 g / L, MgSO 4 0.5-1.0 g / L, yeast powder 5-8 g / L, FeSO 4 10-12 mg / L, MnSO 4 10-12 mg / L, peptone 3-5 g / L, VB1, VB3, VB5, VB12, VH 1.3-2.5 mg / L each, pH 7.0-7.5, 121℃, high pressure steam sterilization for 20 min;

[0123] The fermentation medium formula is: glucose 20-25 g / L, xylose 5-10 g / L, KH 2 PO 4 2.5-5.0 g / L, MgSO 4 7H 2 O 1.2-2.0 g / L, yeast powder 4-8 g / L, FeSO 4 20-24 mg / L, MnSO 4 10-12 mg / L, sodium citrate 2-3 g / L, peptone 5-8 g / L, VB 1 ,VB 3 ,VB 5 ,VB 12 、V H 2-4 mg / L each, VB 650 mg / L, pH 7.0-7.5, 121°C, high pressure steam sterilization for 20 min.

[0124] The concentration of γ-aminobutyric acid in the fermentation supernatant was detected by high performance liquid chromatography. First, the effects of growth-coupled promoters of different strengths on the regulation of sucA gene expression were compared. Fig.15 As shown, strain E. coil G12 (P rpsl promoter controls sucA gene), E. coil G 13 (P rpst promoter controls sucA gene), E. coil G 14 (P rrnc The GABA production of the argA gene controlled by the promoter was 9.5 g / L, 10.8 g / L and 8.4 g / L, respectively. Therefore, the E. coil G 13 strain was selected for subsequent genetic manipulation. Secondly, the effects of different strength growth-coupled promoters on the regulation of argA gene expression were compared. Fig.16 As shown, strain E. coil G 16 (P rpst promoter controls the argA gene), E. coil G 17 (P rpsl promoter controls the argA gene), E. coil G 18 (P rrnc The GABA production of the strains controlled by the promoter (argA gene) were 14.8 g / L, 12.3 g / L and 11.7 g / L, respectively. Therefore, the E. coil G 16 strain was selected for the subsequent 5 L fermentation tank scale-up optimization experiment.

[0125] Example 3: Production of γ-aminobutyric acid using genetically engineered bacteria E. coli G16 in a 5 L fermenter.

[0126] Use an inoculation loop to dip the bacterial solution in the bacterial preservation tube, evenly spread it on the activated slant, and perform subculture; inoculate the strain on the activated slant into the seed culture medium and culture it at 37°C for 8 hours. During the culture process, the pH value is maintained at 7.2 by adding ammonia water. Inoculate the seed solution into the fermentation medium at an inoculation rate of 15%, and start fermentation culture. The initial pH value of fermentation is controlled at 7.0, and after 8 hours of fermentation, the pH value is maintained at 6.4 by adding ammonia water. When the glucose in the culture medium is consumed, a glucose solution with a mass concentration of 80% is added to maintain the final mass concentration of residual sugar at 0.1-0.5%. During the entire fermentation process, the temperature is controlled at 37°C, the dissolved oxygen value is controlled at 15%-30%, the fermentation cycle is 38 hours, and the fermentation results are as follows: Fig.17 shown.

[0127] The slant culture medium formula is: glucose 1 g / L, peptone 10 g / L, beef extract 10 g / L, yeast powder 5 g / L, sodium chloride 2.5 g / L, agar 30 g / L;

[0128] The seed culture medium formula is: glucose 25-30 g / L, KH 2 PO 4 1.2-1.5 g / L, MgSO 4 0.5-1.0 g / L, yeast powder 5-8 g / L, FeSO 4 10-12 mg / L, MnSO 4 10-12 mg / L, peptone 3-5 g / L, VB 1 ,VB 3 ,VB 5 ,VB 12 、V H 1.3-2.5 mg / L each, pH 7.0-7.5, 121℃, high pressure steam sterilization for 20 min.

[0129] The fermentation medium formula is: glucose 20-25 g / L, xylose 5-10 g / L, KH 2 PO 4 2.5-5.0 g / L, MgSO 4 7H 2 O 1.2-2.0 g / L, yeast powder 4-8 g / L, FeSO 4 20-24 mg / L, MnSO 4 10-12 mg / L, sodium citrate 2-3 g / L, peptone 5-8 g / L, VB 1 ,VB 3 ,VB 5 ,VB 12 、V H 2-4 mg / L each, VB 6 50 mg / L, pH 7.0-7.5, 121°C, high pressure steam sterilization for 20 min.

[0130] The concentration of γ-aminobutyric acid in the fermentation supernatant was detected by high-performance liquid chromatography. The GABA production of the E. coil G16 genetically engineered strain was as high as 35.4 g / L after 38 h of fermentation, which is the highest yield of γ-aminobutyric acid synthesized from scratch by Escherichia coli reported so far.

[0131] Gene sequence in the present invention:

[0132] SEQ ID NO.1: T7 RNA polymerase gene

[0133]

[0134] Xylose promoter P xylF The sequence is SEQ ID NO.2:

[0135] GAGATAATTCACAAGTGTGCGCTCGCTCGCAAAATAAAATGGAATGATGAAACTGGGTAATTCCTCGAAGAGAAAAAATGCAATAAGTACAATTGCGCAACAAAAGTAAGATCTCGGTCATAAATCAAGAAATAAACCAAAATCGTA ATCGAAAGATAAAAATCTGTAATTGTTTTCCCCTGTTTAGTTGCTAAAAATTGGTTACGTTTATCGCGGTGATTGTTACTTATTAAAACTGTCCTCTAACTACAGAAGGCCCTACACCATGGGATTTACTAACTGGAAGAGGCACTAA

[0136] Growth-coupled promoter P rpst The gene sequence is SEQ ID NO.3:

[0137] TCATTGCCATGGCGCAAATCACGGGAAGAAACTGACCGCCTGCTGCAATTTTTATCGCGGAAAAGCTGTATTCACACCCCGCAAGCTGGTAGAATCCTGCGCCATCACTACGTAACGAGT;

[0138] P rpsl The gene sequence is SEQ ID NO.4:

[0139] TCGTCAGACTTACGGTTAAGCACCCCAGCCAGATGGCCTGGTGATGGCGGGATCGTTGTATATTTCTTGACACCTTTTCGGCATCGCCCTAAAATTCGGCGTCCTCATA

[0140] P rrnc The gene sequence is SEQ ID NO.5:

[0141] CTTAAAGGCATTACTTATCTCCTTTTTCTTTTTATTCCTCCTTAGTATGCCACCAGGAAGTGTGATTACGGTTGCAAAAACGGCAAATTGCTTGTTTTATGGCACATTAACGGGGCTTTTGCTGAAAAAATGCGCGGTCAGAAAATTATTTTAAATTTCCTCTTGTCAGGCCGGAATAACTCCCTATAATGCGCCACCA;

[0142] The strong promoter P trc The gene sequence is SEQ ID NO.6:

[0143] TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACC;

[0144] The T trc The gene sequence of the terminator is SEQ ID NO.7:

[0145] CAAATAAAACGAAAGGCTCAGTCGAAAGACTGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAAT;

[0146] The strong promoter P T7 The gene sequence is SEQ ID NO.8:

[0147] TAATACGACTCACTATAGGGTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACC;

[0148] The T T7 The gene sequence of the terminator is SEQ ID NO.9:

[0149] CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG;

[0150] The sgRNA targeting recognition sequence of plasmid No. 4 is SEQ ID NO.10:

[0151] TGCGCTGGTTGATTTCTTCT.

[0152] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A plasmid-free genetically engineered bacterium that can efficiently synthesize γ-aminobutyric acid from scratch using a cheap carbon source as a substrate, characterized in that: The genetically engineered bacteria is based on wild-type Escherichia coli E. coli MG1655, overexpressing the T7 RNA polymerase gene T7 RNAP from bacteriophage, driven by a xylose promoter P xylF Control; GABA transaminase genes gabT and puuE were deleted; the endogenous GABA transporter protease gene gadC of Escherichia coli was overexpressed; the glutamate decarboxylase gene gad from Bacillus megaterium was overexpressed bm ; Overexpression of the glutamate dehydrogenase gene gdh from Corynebacterium glutamicum, i.e., cgl2079; Overexpression of the endogenous citrate synthase gene gltA from Escherichia coli; Overexpression of the pyruvate carboxylase gene pyc from Corynebacterium glutamicum, i.e., cgl0689; Overexpression of the endogenous phosphoenolpyruvate carboxylase gene ppc from Escherichia coli; Use of three growth-coupled promoters, i.e., P rpst , P rpsl , P rrnc The 2-ketoglutarate dehydrogenase gene sucA and the amino acid N-acetyltransferase gene argA in the GABA production pathway of Escherichia coli are dynamically regulated respectively.

2. The genetically engineered bacterium according to claim 1, characterized in that: The registration number of the gene gabT in Gene Bank is Gene ID 948067, the registration number of the gene puuE in Gene Bank is Gene ID 945446, the registration number of the gene gadC in Gene Bank is Gene ID 946057, and the registration number of the gene gad bm The accession number of gene gdh in Gene Bank is Gene ID 1020031, the accession number of gene gltA in Gene Bank is Gene ID 945323, the accession number of gene pyc in Gene Bank is Gene ID 1019553, the accession number of gene ppc in Gene Bank is Gene ID 948457, the accession number of gene sucA in Gene Bank is Gene ID 945303, and the accession number of gene argA in Gene Bank is Gene ID 947289; The sequence of gene T7RNAP is SEQ ID NO.1; xylose promoter P xylF The sequence of the three growth-coupled promoters is SEQ ID NO.2; rpst The sequence is SEQ ID NO.3, P rpsl The sequence is SEQ ID NO.4, P rrnc The sequence is SEQ ID NO.

5.

3. The method for constructing a genetically engineered bacterium according to claim 1 or 2, characterized in that: The method is to use CRISPR / Cas9-mediated gene editing technology to carry out targeted modification of the E. coli MG1655 genome.

4. The construction method according to claim 3, characterized in that: The specific steps are as follows: (1) The RNA polymerase gene T7RNAP from bacteriophage T7 was integrated into the lacI-lacZ site of the E. coli MG1655 genome, and the xylose promoter P xylF control; (2) Knockout of the GABA aminotransferase gene gabT; (3) Knockout of the GABA aminotransferase gene puuE; (4) Integrate the endogenous GABA transporter protease gene gadC of Escherichia coli into the pseudogene site yjgX, and trc Promoter control; (5) Integrate the endogenous glutamate decarboxylase gene gad from Bacillus megaterium at the pseudogene site yciQ bm , by P T7 Promoter control; (6) The glutamate dehydrogenase gene gdh from Corynebacterium glutamicum, i.e. cgl2079, was integrated into the pseudogene site mbhA and driven by a strong promoter P trc control; (7) The endogenous citrate synthase gene gltA from Escherichia coli was integrated into the pseudogene site ylbE, and P trc Promoter control; (8) The pyruvate carboxylase gene pyc, i.e. cgl0689, from Corynebacterium glutamicum was integrated into the pseudogene site yghE. trc Promoter control; (9) Integrate the endogenous phosphoenolpyruvate carboxylase gene ppc from Escherichia coli into the pseudogene site gapC; (10) Using three growth-coupled promoters P rpst , P rpsl , P rrnc Replace the natural promoter of 2-oxoglutarate dehydrogenase gene sucA; (11) Using three growth-coupled promoters P rpst , P rpsl , P rrnc Replaces the native promoter of the amino acid N-acetyltransferase gene argA.

5. Use of the genetically engineered bacteria as claimed in claim 1 or 2 in the production of γ-aminobutyric acid.

6. A method for producing γ-aminobutyric acid by fermentation using the genetically engineered bacteria as claimed in claim 1 or 2, characterized in that: The method improves the yield of gamma-aminobutyric acid through a staged pH fermentation control process.

7. The method according to claim 6, characterized in that: The method is carried out by a fermentation culture method, wherein the fermentation culture includes shake flask fermentation or fermentation tank fermentation, and the specific operation steps are as follows: During shake flask fermentation, the genetically engineered bacteria were first inoculated from a solid slant into a triangular flask containing a seed culture medium, and cultured at 37°C and 220 r / min for 12 h. Then, the seed culture was inoculated with 10-15% of the inoculation amount into a triangular flask containing a fermentation culture medium for fermentation culture, and cultured at 37°C and 220 r / min for 24 h. During the fermentation process, ammonia water was added to maintain the pH between 6.5 to ensure the normal growth of the bacteria, and a 60% mass concentration of glucose solution was added in time to maintain the normal fermentation process. During fermentation in a fermenter, the bacterial liquid of the genetically engineered bacteria is taken and evenly coated on an activated slant, and then subcultured; the strain on the activated slant is inoculated into a seed culture medium, and cultured at 37°C for 8-10 hours, and ammonia water is added during the culture process to maintain the pH value at 7.0-7.2; the seed liquid is inoculated into the fermentation culture medium at an inoculation rate of 15-20%, and fermentation culture is started; the initial pH value of the fermentation is controlled at 7.0-7.2, and ammonia water is added after 6-8 hours of fermentation to maintain the pH value at 6.3-6.5; when the glucose in the culture medium is consumed, a glucose solution with a mass concentration of 80% is added to maintain the final mass concentration of residual sugar at 0.1-0.5%; the temperature is controlled at 37°C during the entire fermentation process, the dissolved oxygen value is controlled at 15%-30%, the fermentation cycle is 38 hours, and gamma-aminobutyric acid is obtained.

8. The method according to claim 7, characterized in that: The slant culture medium used for the solid slant and activated slant is: glucose 1-2 g / L, peptone 10-15 g / L, beef extract 10-15 g / L, yeast powder 5-8 g / L, NaCl 2.5-5 g / L, agar 20 g / L, and the solvent is water; Alternatively, the seed culture medium is: glucose 25-30 g / L, KH2PO4 1.2-1.5 g / L, MgSO4 0.5-1.0 g / L, yeast powder 5-8 g / L, FeSO4 10-12 mg / L, MnSO4 10-12 mg / L, peptone 3-5 g / L, VB1, VB3, VB5, VB 12 、V H 1.3-2.5 mg / L each, the solvent is water; pH is 7.0-7.5, 121℃, high pressure steam sterilization for 20 min; Alternatively, the fermentation medium is: glucose 20-25 g / L, xylose 5-10 g / L, KH2PO4 2.5-5.0 g / L, MgSO4·7H2O 1.2-2.0 g / L, yeast powder 4-8 g / L, FeSO4 20-24 mg / L, MnSO4 10-12 mg / L, sodium citrate 2-3 g / L, peptone 5-8 g / L, VB1, VB3, VB5, VB 12 、V H 2-4 mg / L each, VB6 50 mg / L, solvent is water; pH is 7.0-7.5, 121℃, high pressure steam sterilization for 20 min.

Citation Information

Patent Citations

  • An L-amino acid-producing bacterium and a method for producing an L-amino acid

    CN101864465A

  • Genetically engineered bacterium for producing L-ornithine as well as construction method and application of genetically engineered bacterium

    CN116162581A

  • Gamma-aminobutyric acid production strain as well as construction method and application thereof

    CN118165907A

  • Recombinant escherichia coli for efficiently producing gamma-aminobutyric acid as well as construction method and application of recombinant escherichia coli

    CN119220574A

Cited By

  • Recombinant microorganism for producing hydroxytyrosol as well as construction method and application of recombinant microorganism

    CN121931026A