Pig IPO4 gene knockout cell line as well as construction method and application thereof

By constructing the IPO4 gene knockout cell line, the problem of insufficient research on the PCV2 replication mechanism in the existing technology has been solved, which significantly inhibits the replication of the PCV2 virus and provides a new target for the research and development of antiviral drugs.

CN120098934AActive Publication Date: 2025-06-06INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE JIANGXI ACAD OF AGRI SCI
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510267432.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-07
Publication Date
2025-06-06
Estimated Expiration
2045-03-07

AI Technical Summary

Technical Problem

There are few researches on the replication mechanism of porcine cyclovirus type II (PCV2) in the prior art, especially the function of the nuclear transporter IPO4 in PCV2 replication, which has not yet been reported in literature, resulting in insufficient targets for the development of antiviral drugs.

Method used

By designing sgRNA targeting the pig IPO4 gene, using CRISPR/Cas9 technology to construct IPO4 gene knockout cell line, verifying the inhibitory effect of cells on PCV2 virus replication after IPO4 gene knockout.

Benefits of technology

The successfully constructed IPO4 gene knockout cell line can significantly inhibit the replication of PCV2 virus, revealing the association between IPO4 gene and PCV2 virus replication, and providing new targets and ideas for the prevention and treatment of PCV2.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120098934A_ABST
    Figure CN120098934A_ABST
Patent Text Reader

Abstract

The invention discloses a pig IPO4 gene knockout cell line as well as a construction method and application thereof, and belongs to the technical field of gene engineering. The pig IPO4 gene knockout cell line is named as a pig kidney cell PK15-KO-IPO4, and is preserved in the China Center for Type Culture Collection (CCTCC), the preservation number is CCTCC NO: C202541, and the preservation date is January 7, 2025. The invention verifies that after the IPO4 gene is knocked out, cells can significantly inhibit the replication of the PCV2 virus, reveals the association between the IPO4 gene and the replication of the PCV2 virus, and provides a new target and idea for research and development of drugs for preventing and treating the PCV2. The cell line constructed by the invention can stably silence the IPO4 gene, can significantly inhibit the replication of the PCV2 virus, and can be used as a cell line for researching and developing medicines for preventing and treating PCV2 and researching a porcine circovirus replication mechanism.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a porcine IPO4 gene knockout cell line and a construction method and application thereof. Background Art

[0002] Porcine circovirus II (PCV2) is a disease pathogen characterized by multisystem failure (PMWS). It is now widely distributed and prevalent in all pig-raising countries. It is an immunosuppressive disease that seriously endangers pig production and causes huge losses to my country's pig industry. To date, the discovery and research of porcine circovirus has lasted for nearly 40 years, and its virological characteristics and pathogenicity are not fully understood, and there are still many unsolved mysteries. Currently, nuclear transport proteins based on virus targeting are one of the targets for the development and design of antiviral drugs. Peptides or peptoid activators synthesized by simulating the binding of viruses to transport proteins can effectively inhibit viral replication and achieve antiviral effects. PCV2 is an intranuclear replicating virus, and the entry of viruses and viral proteins into the cell nucleus is a key step in viral replication. However, so far, there are few studies on the regulation of PCV2 replication by nuclear transport proteins, and there is no literature report on the function of transport protein IPO4 in PCV2 replication. Summary of the invention

[0003] The purpose of the present invention is to provide a porcine IPO4 gene knockout cell line and its construction method and application, so as to solve the problems existing in the above-mentioned prior art. The present invention verifies that after the IPO4 gene is knocked out, the cell can significantly inhibit the replication of the PCV2 virus, reveals the association between the IPO4 gene and the replication of the PCV2 virus, and provides a new target and idea for the research and development of drugs for the prevention and treatment of PCV2. The cell line constructed by the present invention can stably silence the IPO4 gene, can significantly inhibit the replication of the PCV2 virus, and can be used as a cell line for the research and development of drugs for the prevention and treatment of PCV2 and the study of the replication mechanism of porcine circovirus.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] The present invention provides a pig kidney cell (Sus scrofa) PK15-KO-IPO4 with an IPO4 gene knockout, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: C202541 and a deposit date of January 7, 2025.

[0006] The present invention also provides a method for constructing the above-mentioned pig kidney cell PK15-KO-IPO4, comprising the following steps:

[0007] (1) Designing sgRNA targeting IPO4 gene and obtaining double-stranded sgRNA-oligo after annealing;

[0008] (2) connecting the double-stranded sgRNA-oligo to the CRISPR / Cas9 vector to obtain an IPO4 gene knockout vector;

[0009] (3) transfecting the IPO4 gene knockout vector into pig kidney PK15 cells, and obtaining the pig kidney cell PK15-KO-IPO4 through screening and subcloning;

[0010] The sgRNA is IPO4-sgRNA, and the nucleotide sequence is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0011] Optionally, the CRISPR / Cas9 vector comprises a PX459 plasmid.

[0012] Furthermore, the connection method is to insert the double-stranded sgRNA-oligo into the BbsI restriction site of the PX459 plasmid.

[0013] Optionally, the screening method is to use a culture medium containing puromycin to screen positive cells with IPO4 gene knockout.

[0014] The present invention also provides an application of the above-mentioned pig kidney cell PK15-KO-IPO4 or the pig kidney cell PK15-KO-IPO4 constructed by the above-mentioned construction method in preparing a drug for inhibiting the replication of porcine circovirus.

[0015] The present invention also provides an application of the above-mentioned pig kidney cell PK15-KO-IPO4 or the pig kidney cell PK15-KO-IPO4 constructed by the above-mentioned construction method in screening drugs for inhibiting the replication of porcine circovirus.

[0016] The present invention also provides an application of the above-mentioned pig kidney cell PK15-KO-IPO4 or the pig kidney cell PK15-KO-IPO4 constructed by the above-mentioned construction method in studying the replication mechanism of porcine circovirus.

[0017] The present invention also provides the use of an agent for inhibiting or silencing IPO4 gene expression in preparing a drug for inhibiting porcine circovirus replication.

[0018] Optionally, the reagent includes sgRNA that targets and knocks out the IPO4 gene; the sgRNA is IPO4-sgRNA, and the nucleotide sequence is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0019] The present invention also provides an sgRNA for targeted knockout of the IPO4 gene, wherein the sgRNA is IPO4-sgRNA, and the nucleotide sequence is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0020] The present invention discloses the following technical effects:

[0021] The present invention designs sgRNA targeting the porcine IPO4 gene and constructs an IPO4 gene knockout cell line. IPOP4 protein and PCV2 virus Cap protein were detected by Western blotting, and it was verified that after the IPO4 gene was knocked out, the cells could significantly inhibit the replication of PCV2 virus and the expression of viral Cap protein, revealing the association between the IPO4 gene and PCV2 virus replication, and providing new targets and ideas for the development of drugs for the prevention and treatment of PCV2.

[0022] The IPO4 gene knockout cell line constructed by the present invention is suitable for growing in a DMEM high-glucose medium containing 10% fetal bovine serum, and the cell doubling time is 36 hours; the cell can still stably silence the IPO4 gene after 30 generations, and there is no IPO4 protein expression; the replication of PCV2 virus can be significantly inhibited, and it can be used as a model cell for developing drugs for preventing and treating PCV2, and as a cell line for studying the replication mechanism of porcine circovirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1 This is the sequencing result of the PX459-IPO4-KO knockout plasmid;

[0025] Figure 2 The figure shows the results of Western blotting detection of IPO4 protein in PK15-IPO4-KO cells and PK15-WT cells;

[0026] Figure 3 The figure shows the sequencing results of IPO4 gene in PK15-IPO4-KO cells and PK15-WT cells;

[0027] Figure 4 The Western blotting results of IPO4 protein in PK15-IPO4-KO cells of the 5th, 10th, 15th, 20th and 30th generations and PK15-WT cells of the 30th generation are shown;

[0028] Figure 5 Figure 2 shows the results of cell viability detection of PK15-IPO4-KO cells and PK15-WT cells;

[0029] Figure 6 The figure shows the Western blotting results of Cap protein in PK15-IPO4-KO cells and PK15-WT cells infected with PCV2;

[0030] Figure 7 The PCV2 replication status after PK15-IPO4-KO cells and PK15-WT cells were infected with PCV2. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] The experimental materials and sources used in the examples of the present invention are as follows:

[0037] DMEM high-glucose medium and 0.25% trypsin were purchased from Sewell Biotechnology; fetal bovine serum was purchased from Sigma; sgRNA sequences and identification primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd.; IPO4 monoclonal antibody was purchased from abcam; β-actin monoclonal antibody was purchased from Hangzhou Huaan Biotechnology Co., Ltd.; PCV2 Cap protein monoclonal antibody was purchased from Hangzhou Dayao Biotechnology Co., Ltd.; HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-mouse IgG were purchased from KPL; Lipo2000 transfection reagent was purchased from Novezan Biotechnology Co., Ltd.; Bbs1 restriction endonuclease was purchased from New England Biolabs; PMD19-T vector was purchased from Takara; plasmid extraction kit and blood / cell / tissue genomic DNA extraction kit were purchased from Zhejiang Easyside Biotechnology Co., Ltd.; PX459 plasmid, PK15 cell line and PCV2 strain were all preserved by Jiangxi Animal Husbandry and Veterinary Research Institute.

[0038] The experimental methods in the examples of the present invention are conventional methods unless otherwise specified; the experimental materials used in the examples, in addition to the above-mentioned sources, can also be purchased from conventional biochemical reagent companies unless otherwise specified.

[0039] Example 1 Construction and Identification of the Porcine IPO4 Gene Knockout Plasmid PX459-IPO4-KO Plasmid

[0040] 1. Primer design and synthesis

[0041] Using the pig IPO4 reference nucleic acid sequence in Ensembl (IPO4: ENSSCG0000000200) as a template, the sgRNA sequence GGCACCAACATCCGCGCAAG (SEQ ID NO. 1) was designed using the CRISPR guide RNA online design tool (http: / / crispor.tefor.net / ). A CACCG sticky end was added to the 5' end of the forward sequence, an AAAC sticky end was added to the 5' end of the reverse sequence, and a C base was added to the 3' end. A pair of primers was designed and synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The sequence is as follows:

[0042] IPO4-sgRNA-F: 5'-CACCGGGCACCAACATCCGCGCAAG-3' (SEQ ID NO. 2);

[0043] IPO4-sgRNA-R: 5'-AAACCTTGCGCGGATGTTGGTGCCC-3' (SEQ ID NO. 3).

[0044] 2. Construction and identification of knockout plasmid (PX459-IPO4-KO)

[0045] The primers in the primer pair were diluted to 50 μM respectively, and 10 μL of each was mixed and annealed. The annealing conditions were: directly placed in boiled water, and the sample was taken out after naturally cooling to room temperature to form a double-stranded sgRNA-oligo. At the same time, the PX459 plasmid was digested with the endonuclease BbsI at 37°C for 1 hour, and the digestion product was recovered using a PCR recovery kit. The digested and purified PX459 was ligated with the double-stranded sgRNA-oligo overnight. The ligation product was transformed into DH5a competent cells, cultured at 37°C overnight, and then the cloned plaques were picked and sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. The sequencing results are as follows Figure 1 After the successful clone was selected and expanded, the plasmid was extracted and named PX459-IPO4-KO.

[0046] Example 2 Screening and identification of PK15 cell lines with IPO4 gene knockout

[0047] 1. Construction and screening of IPO4 knockout PK15 cell lines

[0048] After PK15 cells were revived and stably passaged for 3-4 generations, they were plated into six-well plates. When the cell confluence reached 70%-90%, the successfully constructed PX459-IPO4-KO plasmid was transfected into PK15 cells using lipo2000 transfection reagent. At the same time, the PX459 empty vector was transfected as a negative control group. The specific transfection steps are as follows:

[0049] (1) Add 200 μL of DMEM serum-free medium and 10 μL of Lipomaster 2000 Reagent to a 1.5 mL sterile centrifuge tube and mix gently with a pipette;

[0050] (2) Add 200 μL of DMEM serum-free medium to a 1.5 mL sterile centrifuge tube and add 5 μg of plasmid, mix gently, and let the mixture stand for 5 min;

[0051] (3) Add the plasmid / DMEM dropwise to the Lipomaster 2000 Reagent / DMEM, mix gently with a pipette, and let stand at room temperature for 15 minutes before transfection. During transfection, add the Lipomaster 2000 Reagent / DNA complex mixture dropwise to the culture medium, gently shake the culture dish to evenly disperse it, and finally place the cells at 37°C and 5% CO. 2Culture in an incubator. After transfection for 6 hours, fresh culture medium was used for further culture for 48 hours. After that, the medium containing 5 μg / mL puromycin was added to the medium and cultured for 96 hours, during which the medium containing puromycin was changed once every 48 hours; at this time, most of the untransfected negative cells have died, and the remaining positive cells are added with a medium containing 20% ​​serum and no puromycin and cultured for 72-96 hours. After the positive cells have proliferated significantly, the cells are digested and an appropriate amount of cells are taken for multiple dilution in the first column of a 96-well cell culture plate. One of the wells contains about 80 well-growing cells, which are added to 18 mL of DMEM medium containing 20% ​​serum to fully suspend and mix, and then 200 μL / well is added to the remaining wells of the 96-well cell culture plate. The 96-well plate is statically cultured in a cell culture incubator. After 5 days, the wells containing single cells are observed and marked under an inverted microscope. When the cells grow to about 50%, they are expanded and cultured in 48-well, 24-well and 6-well plates. The knockout cell line was named PK15-IPO4-KO, and the negative control cell line was named PK15-WT.

[0052] 2. Identification of IPO4 gene knockout cell lines

[0053] Western blotting was used to detect IPO4 knockout cell lines. PK15-IPO4-KO and PK15-WT cells were collected, lysed with RIPA lysis buffer, 5× protein loading buffer was added, and the samples were boiled in a 100°C water bath for 10 minutes. Centrifuged at 12,000 rpm for 10 minutes, and the supernatant was used for BCA determination of protein concentration. The amount of sample loaded in each well was kept consistent for SDS-PAGE electrophoresis. After the electrophoresis, the protein was transferred to the NC membrane and blocked with 5% skim milk at 37°C for 30 minutes. The primary antibodies were IPO4 rabbit monoclonal antibody and β-Actin mouse monoclonal antibody, respectively, and incubated at 4°C overnight. The secondary antibodies were HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-mouse IgG, respectively, and incubated at room temperature for 1 hour. During this period, PBST was used for washing 5 times, each for 5 minutes, and finally the ECL ultrasensitive chemiluminescence kit was used for development. The results are shown in the figure. Figure 2 As shown, it can be seen that IPO4 protein could not be detected in the IPO4 gene knockout cell line, while IPO4 protein bands were present in the control group.

[0054] The knockout effect of IPO4 gene was further identified by gene sequencing. PK15-IPO4-KO and PK15-WT cells were collected respectively, and the total DNA of each cell line was extracted using a DNA extraction kit. PCR amplification was performed using IPO4 gene detection primers. The total reaction system was 50 μL: 2×Rapid Taq Master Mix, 25 μL; DNA template, 100 ng; IPO4 gene DNA detection primers: PK15-IPO4-F (5'-GGTGGGCTCTCCTGGGCTCCTCTTCTATTC-3', SEQ ID NO.4) and PK15-IPO4-R (5'-AGTCACAAGGCTTCAGTGCTCTCCTCTGGT-3', SEQ ID NO.5), 10 pmol each; ddH 2 O was added to 50 μL. Reaction procedure: 95℃, 2min; 94℃, 30sec, 54℃, 30sec, 72℃, 30sec, 35 cycles; 72℃, 5min; stored at 16℃. Take 10μL of PCR product for agarose gel electrophoresis identification. The identified amplified sample was purified and recovered by PCR product. After recovery, it was connected to the PMD-19T vector, with a total system of 10μL: pMD19-T Vector 0.5μL; Solution I 5μL; PCR recovery product 4.5μL; react at 16℃ overnight. Add 10μL of ligation product to DH5a competent cells and place in ice for 20min; heat at 42℃ for 90sec, and then place in ice for 2min. The suspension was evenly spread on agar plate medium containing ampicillin resistance and cultured for 12h. After a single colony is formed, 3 white colonies are selected for each sample and sequenced using pMD19-T Vector universal primers. Sequence comparison between wild-type and IPO4 knockout cell lines was performed, and the results were as follows Figure 3 As shown, it can be seen that the PK15-IPO4-KO strain has a 4-base deletion between the 4th and 5th bases of the PAM motif at the predetermined cutting position of Cas9, which causes the base sequence of IPO4 to shift and cannot encode the correct IPO4 amino acid sequence, indicating that the IPO4 gene has been successfully knocked out.

[0055] Example 3 Stability detection of PK15 cell line with IPO4 gene knockout

[0056] PK15-IPO4-KO and PK15-WT cells were continuously subcultured, and PK15-KO-IPO4 cells cultured to the 5th, 10th, 15th, 20th and 30th generations, and PK15-WT cells at the 30th generation were collected, and Western Blot detection of IPO4 protein was performed. The detection process was referred to Example 2. The results are shown in FIG. Figure 4As shown, it can be seen that IPO4 protein was not detected during the continuous subculture of PK15-KO-IPO4 cell line for 30 generations, while IPO4 protein expression was normal in the control group PK15-WT cell line.

[0057] Example 4 IP04 gene knockout PK15 cell viability detection

[0058] PK15-IPO4-KO and PK15-WT cell lines were passaged separately, and approximately 2×10 5 The number of cells was 100 μL of cell suspension per well. The same sample was repeated 4-6 times, and culture medium was added as a background control group. After the cells were inoculated and cultured for 24 hours, 10 μL of CCK-8 solution was added to each well, and the cells were placed in a cell culture incubator and continued to incubate for 2 hours. During this period, the absorbance was measured on a microplate reader at 450 nm. The readings were taken at a certain time for analysis. Cell viability (%) = (KO group OD-background control group OD) / (WT group OD-background control group OD) × 100. The results are shown in Figure 5 As shown, it can be seen that there is no significant difference in cell viability between the PK15-KO-IPO4 cell line and the wild-type PK15-WT cell line.

[0059] Example 5 Effect of IPO4 gene knockout cell line PK15-KO-IPO4 on PCV2 replication

[0060] 1. IPO4 gene knockout cell line infected with PCV2 to detect viral protein expression levels

[0061] PK15-WT cells and PK15-IPO4-KO cells were passaged separately. After counting with a cell counting plate, an equal amount of cells were plated on a 12-well plate culture dish and cultured for 12-18 hours. When the cell confluence was about 70-80%, PCV2 strains were inoculated at MOI=1, 10, and 25. After 2 hours of infection, the supernatant was discarded and replaced with the same volume of maintenance solution containing 2% PCV2. The cells were placed at 37°C and 5% CO. 2 The cells were cultured in an incubator for 24 and 36 hours, and the cells were collected. The level of PCV2 Cap protein was detected by Western blotting. The detection process was referred to Example 2. The results are shown in FIG. Figure 6 As shown, it can be seen that the expression level of PCV2 Cap protein in IPO4 gene knockout PK15 cells was significantly reduced compared with that in the control group PK15-WT cells.

[0062] 2. Effect of PCV2 infection in IPO4 knockout cell lines on PCV2 virus replication

[0063] PK15-WT cells and PK15-IPO4-KO cells were passaged separately. After counting with a cell counting plate, an equal amount of cells were plated on a 12-well plate culture dish and cultured for 12-18 hours. When the cell confluence was about 70-80%, PCV2 strain was inoculated at MOI=1. After 2 hours of infection, the supernatant was discarded and replaced with the same volume of maintenance solution containing 2% PCV2. The cells were placed at 37°C and 5% CO. 2 Incubator for 36 hours. Wash once with PBS, fix with 4% paraformaldehyde at room temperature for 20 minutes, permeabilize with 0.02% TritonX-100 permeabilization solution for 5 minutes, then add 5% skim milk to block at 37℃ for 30 minutes, rinse 3 times with PBS; use Cap mouse monoclonal antibody (1:500) and IPO4 rabbit monoclonal antibody (1:100) as primary antibody at 37℃ for 1.5 hours, rinse 3 times with PBS; use FITC-labeled goat anti-mouse (1:200) and A546-labeled donkey anti-rabbit (1:200) as secondary antibody at 37℃ for 1 hour, rinse 3 times with PBS, finally add DAPI staining solution and observe the fluorescence results under a fluorescence microscope. The results are as follows Figure 7 As shown, it can be seen that the replication of PCV2 virus in IPO4 gene knockout PK15 cells was reduced compared with the control PK15-WT cells.

[0064] The above results show that knocking out the IPO4 gene can effectively inhibit PCV2 virus replication, and the knockout cell line PK15-KO-IPO4 can be used to study the PCV2 virus replication mechanism, and also provide new ideas for the development of drugs to prevent or treat PCV2. The knockout cell line PK15-KO-IPO4 has been deposited in the China Center for Type Culture Collection on January 7, 2025, address: Wuhan University, Wuhan, China, with a deposit number of CCTCC NO: C202541 and a deposit name of porcine kidney cell PK15-KO-IPO4.

[0065] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A pig kidney cell (Sus scrofa) with knockout IPO4 gene, PK15-KO-IPO4, characterized in that: It is deposited in the China Center for Type Culture Collection, with the deposit number being CCTCC NO: C202541 and the deposit date being January 7, 2025.

2. The method for constructing the pig kidney cell PK15-KO-IPO4 according to claim 1, characterized in that: The steps include: (1) Designing sgRNA targeting IPO4 gene and obtaining double-stranded sgRNA-oligo after annealing; (2) connecting the double-stranded sgRNA-oligo to the CRISPR / Cas9 vector to obtain an IPO4 gene knockout vector; (3) transfecting the IPO4 gene knockout vector into pig kidney PK15 cells, and obtaining the pig kidney cell PK15-KO-IPO4 through screening and subcloning; The sgRNA is IPO4-sgRNA, and the nucleotide sequence is shown in SEQ ID NO.2 and SEQ ID NO.

3.

3. The construction method according to claim 2, characterized in that: The CRISPR / Cas9 vector includes the PX459 plasmid.

4. The construction method according to claim 2, characterized in that: The connection method is to insert the double-stranded sgRNA-oligo into the BbsI restriction site of the PX459 plasmid.

5. Use of the pig kidney cell PK15-KO-IPO4 according to claim 1 or the pig kidney cell PK15-KO-IPO4 constructed by the construction method according to any one of claims 2 to 4 in the preparation of a drug for inhibiting the replication of porcine circovirus.

6. Use of the pig kidney cell PK15-KO-IPO4 according to claim 1 or the pig kidney cell PK15-KO-IPO4 constructed by the construction method according to any one of claims 2 to 4 in screening drugs that inhibit porcine circovirus replication.

7. Use of the pig kidney cell PK15-KO-IPO4 according to claim 1 or the pig kidney cell PK15-KO-IPO4 constructed by the construction method according to any one of claims 2 to 4 in studying the replication mechanism of porcine circovirus.

8. Use of an agent for inhibiting or silencing IPO4 gene expression in the preparation of a drug for inhibiting porcine circovirus replication.

9. The use according to claim 8, characterized in that: The reagent includes sgRNA for targeted knockout of IPO4 gene; the sgRNA is IPO4-sgRNA, and the nucleotide sequence is shown in SEQ ID NO.2 and SEQ ID NO.

3.

10. A sgRNA for targeted knockout of IPO4 gene, characterized in that: The sgRNA is IPO4-sgRNA, and the nucleotide sequence is shown in SEQ ID NO.2 and SEQ ID NO.3.

Citation Information

Patent Citations

  • PMKRN1 (porcine Makorin ring finger protein 1) gene-knockout porcine somatic cell, method for preparing same and application of pMKRN1 gene-knockout porcine somatic cell

    CN108373997A

  • M6A'reader 'YTHDF2 gene modification method and application thereof

    CN112941105A

  • Construction method of porcine GSDMD knockout cell line and application of porcine GSDMD knockout cell line in PDCoV infection

    CN118389443A

  • Method for Preparing Porcine Fibroblasts with Both CD163 Gene and CD13 Gene Being Knocked-out

    US20200323182A1