Engineered wide-range nuclease with specificity for recognition sequences in muscular dystrophin genes
By using engineered large-scale nucleases to cleave and remove specific exons from dystrophin genes, the problem of difficulty in effectively treating Duchenne mustrophin genes is solved, and permanent modification of the gene and reduction of disease severity is achieved.
Patent Information
- Application Number
- CN202510254831.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2021-08-16
- Filing Date
- 2021-11-12
- Publication Date
- 2025-06-06
AI Technical Summary
The prior art is difficult to effectively treat Duchenne muscular dystrophy (DMD), especially in restoring the normal expression of dystrophin genes and reducing the severity of the disease.
Using engineered large-scale nucleases, the modified dystrophin protein is removed by identifying and cleaving specific exons in the dystrophin gene and removing exons 45-55, thereby restoring the normal reading frame and expressing modified dystrophin.
Permanent modification of dystrophin genes is achieved, reducing the severity of the disease, converting into a milder Baker phenotype, and improving the durability and efficiency of treatment.
Smart Images

Figure CN120098962A_ABST
Abstract
Description
[0001] This application is a divisional application of the invention patent application with application date of November 12, 2021, application number 202180088740.3, and invention name "Engineered large-range nuclease specific to recognition sequences in the dystrophin gene". Technical Field
[0002] The present application relates to the fields of engineered meganucleases, molecular biology and recombinant nucleic acid technology. In a particular aspect, the present invention relates to engineered meganucleases that can be used to remove exons from the dystrophin gene and can be used to treat subjects with Duchenne muscular dystrophy.
[0003] References to sequence listings submitted as text files via EFS-WEB
[0004] This application contains a sequence listing, which has been submitted in ASCII format via EFS-Web, and the entire contents of which are incorporated herein by reference. This ASCII copy, created on November 12, 2021, is named P109070054WO00-SEQ-EPG and is 279,819 bytes in size. Background Art
[0005] Duchenne muscular dystrophy (DMD) is a rare X-linked muscle degenerative disease, with approximately 1 in every 3500 boys worldwide suffering from this disease. This disease is caused by mutations in the dystrophin gene, which is the largest gene known. The dystrophin gene spans 2.2Mb of the X chromosome and mainly encodes a 14kb transcript from 79 exons. The full-length dystrophin expressed in skeletal muscle, smooth muscle and cardiac muscle cells is 3685 amino acids with a molecular weight of 427kD. Severe Duchenne phenotypes are usually associated with the absence of full-length dystrophin in skeletal muscle and cardiac muscle, which can lead to debilitating muscle degeneration and ultimately heart failure. A large number of different dystrophin gene mutations have been described, many of which lead to severe DMD or lighter Becker muscular dystrophy.
[0006] There are currently several therapeutic strategies for treating DMD. First, the "gene replacement" strategy is an active area of research (Oshima et al., (2009) J. Am. Soc. Gene Ther. 17: 73-80; Liu et al., (2005) Mol. Ther. 11: 245-56; Lai et al., (2006) Hum Gene Ther. 17: 1036-42; Odom et al., (2008) Mol. Ther. 16: 1539-45). This approach involves the use of a viral delivery vector, usually an adeno-associated virus (AAV), to deliver a functional copy of the dystrophin gene to the patient. However, the large size of the dystrophin gene makes it incompatible with the limited carrying capacity of ordinary viral vectors. This requires the use of a "mini-dystrophin" gene, in which most of the repeated central part of the gene is removed, leaving only the minimum functional protein. However, it is not clear whether the expression of "mini-dystrophin" is sufficient to obtain clinical benefits. Additionally, this approach carries the potential for random gene integration into the patient's genome, which could result in insertional mutagenesis, as well as the potential for an immune response against the delivery vector.
[0007] The second method for treating DMD is to transplant healthy muscle precursor cells into the patient's muscle fibers (Peault et al., (2007) Mol. Ther. 15: 867-77; Skuk et al., (2007) Neuromuscul. Disord. 17: 38-46). This method has the problems of low migration efficiency of transplanted myoblasts and possible immune rejection by the patient.
[0008] A third approach involves the use of PTC124 to suppress nonsense mutations (Welch et al., (2007) Nature 447:87-91). However, this requires lifelong dosing, and this approach has not yet shown any significant clinical benefit.
[0009] A fourth approach for treating DMD is called "exon skipping" (Williams et al., (2008) BMC Biotechnol. 8:35; Jearawiriyapaisarn et al., (2008) Mol Ther. 16:1624-29; Yokota et al., (2007) Acta Myol. 26:179-84; van Deutekom et al., (2001) Hum. Mol. Gen. 10:1547-54; Benedetti et al., (2013) FEBS J. 280:4263-80; Rodino-Klapac (2013) Curr Neurol Neurosci Rep. 13:332; Verhaart & Aartsma-Rus (2012) Curr Opin Neurol. 25:588-96). In general, the amino (N) and carboxyl (C) terminal portions of the dystrophin gene are essential for its role as a "scaffolding" protein that maintains the integrity of the sarcolemma, whereas the central "rod domain" comprising 24 spectrin-like repeats is at least partially dispensable. Indeed, the severe Duchenne phenotype is often associated with mutations in the dystrophin gene that introduce frameshifts and / or premature stop codons, resulting in a shortened form of dystrophin lacking the essential C-terminal domain. Mutations in the central rod domain, including large deletions of entire exons, generally result in a milder Becker-type phenotype if they maintain the reading frame, leaving the C-terminal domain of the protein intact.
[0010] The most common cause of DMD is the deletion of one or more entire exons, resulting in a shift in the reading frame. For example, exon 45 is commonly deleted in Duchenne patients. Because the length of exon 45 is 176 bp, which is not divisible by three, deleting all exons would put exons 46-79 into the wrong reading frame. The same is true for exon 44, which is 148 bp in length. However, if exons 44 and 451 are deleted, the total size of the deletion is 324 bp, which is divisible by three. Thus, the deletion of two exons does not result in a shift in the reading frame. Since these exons encode part of the non-essential rod domain of dystrophin, their deletion from the protein is expected to result in a mild Becker-like phenotype. Therefore, patients with a Duchenne phenotype due to the deletion of one or more exons can be treated by eliminating one or more adjacent exons to restore the reading frame. This is the principle behind "exon skipping," in which modified oligonucleotides are used to block splice acceptor sites in the dystrophin pre-mRNA so that one or more specific exons are not present in the processed transcript. This approach has been used to restore expression of the dystrophin gene in the mdx mouse model by skipping exon 23, which carries a nonsense mutation that induces disease (Mann et al., (2001) Proc. Nat. Acad. Sci. USA 98:42-47). Oligonucleotide analogs that induce exon 51 skipping have also shown promise in early human clinical trials (Benedetti et al., (2013) FEBS J. 280:4263-80). The main limitations of this approach are: (1) the exon skipping process is inefficient, resulting in relatively low levels of functional dystrophin expression; and (2) the half-life of exon skipping oligonucleotides is relatively short, so the effects are short-lived and require repeated and lifelong dosing. Therefore, although the exon skipping approach has shown some promise in clinical trials, the improvement in disease progression is minimal and variable.
[0011] The present disclosure improves current methods of exon skipping by correcting gene expression at the genomic DNA level rather than at the pre-mRNA level. The present invention is a permanent treatment for DMD that involves the use of a pair of engineered, site-specific homing endonucleases (commonly referred to as meganucleases) to excise specific exons from the dystrophin coding sequence. By targeting a pair of such endonucleases to sites in the intronic regions flanking the exons of the dystrophin gene, the intermediate fragment can be permanently removed from the genome. The resulting cells and their progeny will express a modified dystrophin protein in which part of the non-essential spectrin repeat domain is removed, but the essential N- and C-terminal domains are intact.
[0012] Homing endonucleases or meganucleases are a group of naturally occurring nucleases that recognize common 15-40 base pair cleavage sites in plant and fungal genomes. They often bind to parasite DNA elements, such as group 1 self-splicing introns and inteins. They naturally promote homologous recombination or gene insertion into a specific location of the host genome by producing double-strand breaks on chromosomes, thereby recruiting cellular DNA repair mechanisms (Stoddard (2006) Q. Rev. Biophys. 38: 49-95). Homing endonucleases are generally divided into four families: LAGLIDADG family, GIY-YIG family, His-Cys box family and HNH family. These families are characterized by structural motifs, which affect catalytic activity and recognition sequences. For example, the LAGLIDADG family members are characterized by having one or two conservative LAGLIDADD motif copies (see, Chevalier et al., (2001) Nucleic Acids Res. 29: 3757-74). LAGLIDADD homing endonucleases with one copy of the LAGLIDADG motif form homodimers, whereas members with two LAGLIDADG motifs are found as monomers.
[0013] I-Crel (SEQ ID NO: 1) is a member of the LAGLIDADG family of homing endonucleases that recognizes and cleaves a 22 base pair recognition sequence in the chloroplast chromosome of the alga Chlamydomonas reinhardtii. Genetic selection techniques have been used to modify the preference of wild-type I-Crel cleavage sites (Sussman et al., (2004) J. Mol. Biol. 342: 31-41; Chames et al., (2005) Nucleic Acids Res. 33: e178; Seligman et al., (2002) Nucleic Acids Res. 30: 3870-79, Arnould et al., (2006) J. Mol. Biol. 355: 443-58). A method for the rational design of a single LAGLIDADG homing endonuclease has been described that enables comprehensive redesign of l-Crel and other homing endonucleases to target a wide range of different DNA sites, including sites in mammalian, yeast, plant, bacterial and viral genomes (WO 2007 / 047859).
[0014] As first described in WO 2009 / 059195, l-Crel and its engineered derivatives are usually dimers, but can be fused into a single polypeptide using a short peptide linker connecting the C-terminus of the first subunit to the N-terminus of the second subunit (Li et al., (2009) Nucleic Acids Res. 37: 1650-62; Grizot et al., (2009) Nucleic Acids Res. 37: 5405-19). Thus, a functional "single-chain" meganuclease can be expressed from a single transcript. By delivering genes encoding two different single-chain meganucleases into the same cell, two different sites can be cleaved simultaneously. This, combined with the extremely low off-target cleavage frequency observed with engineered meganucleases, makes it a preferred endonuclease for the present disclosure. Summary of the invention
[0015] The present disclosure provides an engineered meganuclease that binds and cuts a recognition sequence in a dystrophin gene (e.g., a human dystrophin gene), as well as a composition comprising such an engineered meganuclease and a method of using the same. In some embodiments, an engineered meganuclease is used to remove multiple exons from a dystrophin gene by producing a first cleavage site in an intron upstream of a first exon and a second cleavage site in an intron downstream of a second exon. In a specific example described herein, the first cleavage site is produced in an intron 5' upstream of exon 45 of a dystrophin gene, and the second cleavage site is produced in an intron 3' downstream of exon 55. This process allows excision and removal of exons 45-55 from a dystrophin gene after annealing of the two cleavage sites and repair of the genome. The recognition sequences targeted by the disclosed engineered meganucleases are selected to have the same four base pair central sequence so that the first and second cleavage sites will have complementary four base pair 3' overhangs that can perfectly connect to each other (i.e., each base pair of one overhang is paired with the complement on the other overhang). This approach results in the restoration of the normal (i.e., wild-type) reading frame of the dystrophin gene by removing exons 45-55 from a mutant dystrophin gene lacking one or more of these exons. Cells so treated will express a shortened, modified form of dystrophin in which a portion of the central spectrin repeat domain is absent, but the N- and C-terminal domains are intact. In many cases, this will reduce the severity of the disease. In some cases, it will result in a milder Becker-type phenotype.
[0016] Thus, in one aspect, the invention provides an engineered meganuclease that binds to and cleaves a recognition sequence in a dystrophin gene, wherein the engineered meganuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and wherein the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region.
[0017] In some embodiments, the recognition sequence comprises SEQ ID NO:6.
[0018] In some such embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 36-44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 36-44.
[0019] In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of any one of SEQ ID NOs: 36-44. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of any one of SEQ ID NOs: 36-44. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NOs: 36-44. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of any one of SEQ ID NOs: 36-44. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NOs: 38, 39 or 149. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 36-44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 36-44.
[0020] In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR2 region comprises a residue corresponding to residue 236 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of any one of SEQ ID NOs: 36-37. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of any one of SEQ ID NOs: 36-44. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 36-44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 36-44.
[0021] In some such embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of any one of SEQ ID NOs: 36-44. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of any one of SEQ ID NOs: 36-44. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of any one of SEQ ID NOs: 36-44. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of any one of SEQ ID NOs: 36, 39, 40, 43 or 44. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of any one of SEQ ID NOs: 36-38 or 40-44. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 36-44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 36-44.
[0022] In some such embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 36-44. In some embodiments, the engineered meganuclease comprises an amino acid sequence of any one of SEQ ID NOs: 36-44. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in any one of SEQ ID NOs: 60-68. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence shown in any one of SEQ ID NOs: 60-68.
[0023] In some embodiments, the recognition sequence comprises SEQ ID NO:10.
[0024] In some such embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 24-79 corresponding to any one of SEQ ID NOs: 45-52. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 45-52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 45-52.
[0025] In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of any one of SEQ ID NOs: 45-52. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of any one of SEQ ID NOs: 45-52. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NOs: 45-52. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of any one of SEQ ID NOs: 45-52. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NOs: 45-51. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 45-52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 45-52.
[0026] In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR2 region comprises residues corresponding to residues 239, 241, and 264 of any one of SEQ ID NOs: 45-52. In some embodiments, the HVR2 region comprises residues corresponding to residue 250 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises residues corresponding to residue 263 of any one of SEQ ID NOs: 45 or 46. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 45-52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 45-52.
[0027] In some such embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of any one of SEQ ID NOs: 45-52. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of any one of SEQ ID NOs: 45-52. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of any one of SEQ ID NOs: 45-52. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NOs: 52. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of any one of SEQ ID NOs: 45-52. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 45-52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 45-52.
[0028] In some such embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 45-52. In some embodiments, the engineered meganuclease comprises an amino acid sequence of any one of SEQ ID NOs: 45-52. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in any one of SEQ ID NOs: 69-76. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence shown in any one of SEQ ID NOs: 69-76.
[0029] In some embodiments, the recognition sequence comprises SEQ ID NO:12.
[0030] In some such embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR1 region comprises Y, R, K or D at a residue corresponding to residue 66 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR1 region comprises a residue corresponding to residue 64 of SEQ ID NO: 54. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 53-59 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of any one of SEQ ID NOs: 53-59.
[0031] In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of any one of SEQ ID NOs: 53-59. In some embodiments, the first subunit comprises a G, S or A at a residue corresponding to residue 19 of any one of SEQ ID NOs: 53-59. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of any one of SEQ ID NOs: 53-59. In some embodiments, the first subunit comprises an E, Q or K at a residue corresponding to residue 80 of any one of SEQ ID NOs: 53-59. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of any one of SEQ ID NOs: 53-55, 57 or 58. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 53-59 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of any one of SEQ ID NOs: 53-59.
[0032] In some such embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 53 or SEQ ID NO: 55. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of any one of SEQ ID NOs: 53-55. In some embodiments, the HVR2 region comprises a residue corresponding to residue 255 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of any one of SEQ ID NOs: 56-59. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of any one of SEQ ID NOs: 53-59. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 53-59 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of any one of SEQ ID NOs: 53-59.
[0033] In some such embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of any one of SEQ ID NOs: 53-59. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of any one of SEQ ID NOs: 53-59. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of any one of SEQ ID NOs: 53-59. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of any one of SEQ ID NOs: 53 or 55-59. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of any one of SEQ ID NOs: 54-59. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 53-59 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of any one of SEQ ID NOs: 53-59.
[0034] In some such embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any one of SEQ ID NOs: 53-59. In some embodiments, the engineered meganuclease comprises an amino acid sequence of any one of SEQ ID NOs: 53-59. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in any one of SEQ ID NOs: 77-83. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence shown in any one of SEQ ID NOs: 77-83.
[0035] In each of the above embodiments, the engineered meganuclease may comprise a nuclear localization signal. In some embodiments, the nuclear localization signal is at the N-terminus of the engineered meganuclease. In some embodiments, the nuclear localization signal comprises an amino acid sequence having at least 80% or at least 90% sequence identity to SEQ ID NO: 3. In some embodiments, the nuclear localization signal comprises SEQ ID NO: 3.
[0036] In another aspect, the present invention provides a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease as described herein. In some embodiments, the polynucleotide is mRNA.
[0037] In another aspect, the present invention provides a recombinant DNA construct comprising a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease described herein.
[0038] In some embodiments, the recombinant DNA construct encodes a recombinant virus comprising a polynucleotide. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant AAV. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an rh.74 capsid. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the rh.74 capsid comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 182. In some embodiments, the rh.74 capsid comprises the amino acid sequence of SEQ ID NO: 182. In some embodiments, the AAV9 capsid comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 183. In some embodiments, the AAV9 capsid comprises the amino acid sequence of SEQ ID NO: 183. In some embodiments, the recombinant AAV has an AAV8 capsid.
[0039] In some embodiments, the nucleic acid sequence comprises a promoter, which is operably linked to the nucleic acid sequence encoding the engineered meganuclease described herein. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter includes an MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, or a SP-905 promoter. In some embodiments, the promoter is capable of expressing the engineered meganuclease described herein in muscle precursor cells (e.g., satellite cells or stem cells).
[0040] In another aspect, the present invention provides a recombinant virus comprising a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease described herein.
[0041] In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant AAV. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an rh.74 capsid. In some embodiments, the rh.74 capsid comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 182. In some embodiments, the rh.74 capsid comprises an amino acid sequence of SEQ ID NO: 182. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the AAV9 capsid comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 183. In some embodiments, the AAV9 capsid comprises the amino acid sequence of SEQ ID NO: 183. In some embodiments, the recombinant AAV has an AAV8 capsid.
[0042] In some embodiments, the polynucleotide comprises a promoter operably linked to a nucleic acid sequence encoding an engineered meganuclease as described herein. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter comprises an MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, or a SP-905 promoter. In some embodiments, the promoter is capable of expressing an engineered meganuclease as described herein in muscle precursor cells (e.g., satellite cells or stem cells).
[0043] In another aspect, the present invention provides a lipid nanoparticle composition comprising a lipid nanoparticle comprising a polynucleotide, wherein the polynucleotide comprises a nucleic acid sequence encoding an engineered meganuclease as described herein. In some embodiments, the polynucleotide is mRNA.
[0044] In another aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and the engineered meganuclease described herein.
[0045] In another aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and the polynucleotide described herein.
[0046] In another aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and the recombinant DNA construct described herein.
[0047] In another aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and the recombinant virus described herein.
[0048] In another aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and the lipid nanoparticle composition described herein.
[0049] In another aspect, the present invention provides a polynucleotide comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease, wherein the first engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO:6, and wherein the second engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO:10, or wherein the second engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO:12.
[0050] In some embodiments, the first engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 6, and the second engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 10. In some embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from a combination of meganucleases provided in Table 1 (and variants thereof described herein).
[0051] Table 1:
[0052]
[0053]
[0054]
[0055] In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD 35-36x.63 (SEQ ID NO: 45), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD 35-36x.81 (SEQ ID NO: 46), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD 35-36x.81 (SEQ ID NO: 46), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD 35-36x.63 (SEQ ID NO: 45), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof as described herein, and the second engineered meganuclease is DMD 35-36L.195 (SEQ ID NO: 47), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof as described herein, and the second engineered meganuclease is DMD 35-36L.282 (SEQ ID NO: 48), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof as described herein, and the second engineered meganuclease is DMD 35-36L.282 (SEQ ID NO: 48), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof as described herein, and the second engineered meganuclease is DMD 35-36L.349 (SEQ ID NO: 49), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof as described herein, and the second engineered meganuclease is DMD 35-36L.349 (SEQ ID NO: 49), or a variant thereof as described herein.
[0056] In certain embodiments, the first engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 6, and the second engineered meganuclease is an engineered meganuclease described herein that binds and cleaves a recognition sequence comprising SEQ ID NO: 12. In some embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from a combination of meganucleases provided in Table 2 (and variants thereof described herein).
[0057] Table 2:
[0058]
[0059]
[0060]
[0061] In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.15 (SEQ ID NO: 53), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.15 (SEQ ID NO: 53), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.66 (SEQ ID NO: 54), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.66 (SEQ ID NO: 54), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.79 (SEQ ID NO: 55), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.79 (SEQ ID NO: 55), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof described herein, and the second engineered meganuclease is DMD37-38L.166 (SEQ ID NO: 56), or a variant thereof described herein.
[0062] In some embodiments, the polynucleotide is an mRNA. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are separated by an IRES or 2A sequence. In certain embodiments, the 2A sequence is a T2A, P2A, E2A or F2A sequence.
[0063] In another aspect, the present invention provides a recombinant DNA construct comprising a polynucleotide described herein (ie, comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease).
[0064] In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are separated by an IRES or a 2A sequence. In certain embodiments, the 2A sequence is a T2A, P2A, E2A or F2A sequence.
[0065] In some embodiments, the polynucleotide comprises a promoter, which is operably connected to the first nucleic acid sequence and the second nucleic acid sequence. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter includes MCK promoter, C5-12 promoter, spc 5-12 promoter, MHCK7 promoter, CK8 promoter, SK-CRM4 promoter, SP-301 promoter, SP-817 promoter or SP-905 promoter. In some embodiments, the promoter is capable of expressing the first and second engineered meganucleases described herein in muscle precursor cells (e.g., satellite cells or stem cells).
[0066] In some embodiments, the polynucleotide comprises a first promoter operably connected to the first nucleic acid sequence and a second promoter operably connected to the second nucleic acid sequence. In some embodiments, the first promoter and the second promoter are muscle-specific promoters. In some embodiments, the muscle-specific promoter includes MCK promoter, C5-12 promoter, spc 5-12 promoter, MHCK7 promoter, CK8 promoter, SK-CRM4 promoter, SP-301 promoter, SP-817 promoter, SP-905 promoter or a combination thereof. In some embodiments, the promoter is capable of expressing the first and second engineered meganucleases described herein in muscle precursor cells (e.g., satellite cells or stem cells).
[0067] In some embodiments, the recombinant DNA construct encodes a recombinant virus comprising a polynucleotide. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant AAV. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an rh.74 capsid. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the rh.74 capsid comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 182. In some embodiments, the rh.74 capsid comprises the amino acid sequence of SEQ ID NO: 182. In some embodiments, the AAV9 capsid comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 183. In some embodiments, the AAV9 capsid comprises the amino acid sequence of SEQ ID NO: 183. In some embodiments, the recombinant AAV has an AAV8 capsid.
[0068] In another aspect, the present invention provides a recombinant virus comprising a polynucleotide as described herein (ie, comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease).
[0069] In some embodiments, the polynucleotide comprises a promoter, and the promoter is operably connected to the first nucleic acid sequence and the second nucleic acid sequence. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are separated by an IRES or a 2A sequence. In certain embodiments, the 2A sequence is a T2A, P2A, E2A or F2A sequence.
[0070] In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the muscle-specific promoter includes an MCK promoter, a C5-12 promoter, a spc 5-12 promoter, a MHCK7 promoter, a CK8 promoter, a SK-CRM4 promoter, a SP-301 promoter, a SP-817 promoter, or a SP-905 promoter. In some embodiments, the promoter is capable of expressing an engineered meganuclease described herein in muscle precursor cells (e.g., satellite cells or stem cells).
[0071] In some embodiments, the polynucleotide comprises a first promoter operably connected to the first nucleic acid sequence and a second promoter operably connected to the second nucleic acid sequence. In some embodiments, the first promoter and the second promoter are muscle-specific promoters. In some embodiments, muscle-specific promoters include MCK promoter, C5-12 promoter, spc 5-12 promoter, MHCK7 promoter, CK8 promoter, SK-CRM4 promoter, SP-301 promoter, SP-817 promoter, SP-905 promoter or a combination thereof. In some embodiments, the promoter can express the engineered meganuclease described herein in muscle precursor cells (e.g., satellite cells or stem cells). In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus or a recombinant AAV. In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an rh.74 capsid. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the rh.74 capsid comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 182. In some embodiments, the rh.74 capsid comprises an amino acid sequence of SEQ ID NO: 182. In some embodiments, the AAV9 capsid comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 183. In some embodiments, the AAV9 capsid comprises an amino acid sequence of SEQ ID NO: 183. In some embodiments, the recombinant AAV has an AAV8 capsid.
[0072] In another aspect, the present invention provides a lipid nanoparticle composition comprising a lipid nanoparticle comprising a polynucleotide described herein (i.e., comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease).
[0073] In some embodiments, the polynucleotide is an mRNA described herein. In some embodiments, the polynucleotide is a recombinant DNA construct described herein.
[0074] In another aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a polynucleotide described herein (ie, comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease).
[0075] In some embodiments, the polynucleotide comprises an mRNA as described herein. In some embodiments, the polynucleotide comprises a recombinant DNA construct as described herein. In some embodiments, the pharmaceutical composition comprises a recombinant virus as described herein. In some embodiments, the pharmaceutical composition comprises a lipid nanoparticle composition as described herein.
[0076] In another aspect, the present invention provides a method for preparing a genetically modified eukaryotic cell having a modified target sequence in a dystrophin gene of a genetically modified eukaryotic cell, the method comprising: introducing a polynucleotide into a eukaryotic cell, the polynucleotide comprising a nucleotide sequence encoding an engineered meganuclease as described herein, wherein the engineered meganuclease is expressed in a eukaryotic cell, and wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO:6. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a myocyte. In some embodiments, the myocyte is a muscle precursor cell (e.g., satellite cell or stem cell), a skeletal muscle cell or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into a eukaryotic cell by lipid nanoparticles, mRNA or a recombinant virus (e.g., recombinant AAV).
[0077] In another aspect, the present invention provides a method for preparing a genetically modified eukaryotic cell having a modified target sequence in a dystrophin gene of a genetically modified eukaryotic cell, the method comprising: introducing an engineered meganuclease as described herein into a eukaryotic cell, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO:6. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or a stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell.
[0078] In another aspect, the present invention provides a method for producing a genetically modified eukaryotic cell, comprising inserting a target exogenous sequence into a dystrophin gene of a genetically modified eukaryotic cell, the method comprising introducing one or more polynucleotides into a eukaryotic cell, comprising: a first nucleic acid sequence encoding an engineered meganuclease as described herein, wherein the engineered meganuclease is expressed in a eukaryotic cell; and a second nucleic acid sequence comprising a target sequence, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO:6, and wherein the target sequence is inserted into the dystrophin gene at the cleavage site. In some embodiments, the second nucleic acid sequence comprises a nucleic acid sequence homologous to the nucleic acid sequence flanking the cleavage site, and the target sequence is inserted into the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or a stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, one or more polynucleotides are introduced into eukaryotic cells via lipid nanoparticles, mRNA, or recombinant viruses (e.g., recombinant AAV).
[0079] In another aspect, the present invention provides a method for producing a genetically modified eukaryotic cell, comprising inserting a target exogenous sequence into a dystrophin gene of a genetically modified eukaryotic cell, the method comprising introducing an engineered meganuclease as described herein and a polynucleotide comprising a target sequence into a eukaryotic cell, wherein the engineered meganuclease produces a cleavage site in a dystrophin gene at a recognition sequence comprising SEQ ID NO:6, and wherein the target sequence is inserted into the dystrophin gene at the cleavage site. In some embodiments, the polynucleotide comprises a nucleic acid sequence homologous to the nucleic acid sequence flanking the cleavage site, and the target sequence is inserted into the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a myocyte. In some embodiments, the myocyte is a muscle precursor cell (e.g., satellite cell or stem cell), a skeletal muscle cell or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into a eukaryotic cell by lipid nanoparticles, mRNA or a recombinant virus (e.g., recombinant AAV).
[0080] In another aspect, the invention provides a method for preparing a genetically modified eukaryotic cell having a modified target sequence in a dystrophin gene of a genetically modified eukaryotic cell, the method comprising: introducing a polynucleotide into a eukaryotic cell, the polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease as described herein, wherein the engineered meganuclease is expressed in a eukaryotic cell, and wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., satellite cell or stem cell), a skeletal muscle cell or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into a eukaryotic cell by lipid nanoparticles, mRNA or a recombinant virus (e.g., recombinant AAV).
[0081] In another aspect, the invention provides a method for preparing a genetically modified eukaryotic cell having a modified target sequence in a dystrophin gene of a genetically modified eukaryotic cell, the method comprising: introducing an engineered meganuclease as described herein into a eukaryotic cell, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or a stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell.
[0082] In another aspect, the present invention provides a method for producing a genetically modified eukaryotic cell, comprising inserting a target exogenous sequence into a dystrophin gene of a genetically modified eukaryotic cell, the method comprising introducing one or more polynucleotides into a eukaryotic cell, comprising: a first nucleic acid sequence encoding an engineered meganuclease as described herein, wherein the engineered meganuclease is expressed in a eukaryotic cell; and a second nucleic acid sequence comprising a target sequence, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10, and wherein the target sequence is inserted into the dystrophin gene at the cleavage site. In some embodiments, the second nucleic acid sequence comprises a nucleic acid sequence homologous to the nucleic acid sequence flanking the cleavage site, and the target sequence is inserted into the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or a stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, one or more polynucleotides are introduced into eukaryotic cells via lipid nanoparticles, mRNA, or recombinant viruses (e.g., recombinant AAV).
[0083] In another aspect, the present invention provides a method for producing a genetically modified eukaryotic cell, comprising inserting a target exogenous sequence into a dystrophin gene of a genetically modified eukaryotic cell, the method comprising introducing an engineered meganuclease as described herein and a polynucleotide comprising a target sequence into a eukaryotic cell, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10, and wherein the target sequence is inserted into the dystrophin gene at the cleavage site. In some embodiments, the polynucleotide comprises a nucleic acid sequence homologous to the nucleic acid sequence flanking the cleavage site, and the target sequence is inserted into the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a myocyte. In some embodiments, the myocyte is a muscle precursor cell (e.g., satellite cell or stem cell), a skeletal muscle cell or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into a eukaryotic cell by lipid nanoparticles, mRNA or a recombinant virus (e.g., recombinant AAV).
[0084] In another aspect, the invention provides a method for preparing a genetically modified eukaryotic cell having a modified target sequence in a dystrophin gene of a genetically modified eukaryotic cell, the method comprising: introducing a polynucleotide into a eukaryotic cell, the polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease as described herein, wherein the engineered meganuclease is expressed in a eukaryotic cell, and wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 12. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., satellite cell or stem cell), a skeletal muscle cell or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into a eukaryotic cell by lipid nanoparticles, mRNA or a recombinant virus (e.g., recombinant AAV).
[0085] In another aspect, the invention provides a method for preparing a genetically modified eukaryotic cell having a modified target sequence in a dystrophin gene of a genetically modified eukaryotic cell, the method comprising: introducing an engineered meganuclease as described herein into a eukaryotic cell, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 12. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., satellite cell or stem cell), a skeletal muscle cell or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell.
[0086] In another aspect, the present invention provides a method for producing a genetically modified eukaryotic cell, comprising inserting a target exogenous sequence into a dystrophin gene of a genetically modified eukaryotic cell, the method comprising introducing one or more polynucleotides into a eukaryotic cell, the polynucleotide comprising: a first nucleic acid sequence encoding an engineered meganuclease as described herein, wherein the engineered meganuclease is expressed in a eukaryotic cell; and a second nucleic acid sequence comprising a target sequence, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 12, and wherein the target sequence is inserted into the dystrophin gene at the cleavage site. In some embodiments, the second nucleic acid sequence comprises a nucleic acid sequence homologous to the nucleic acid sequence flanking the cleavage site, and the target sequence is inserted into the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., a satellite cell or a stem cell), a skeletal muscle cell, or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, one or more polynucleotides are introduced into eukaryotic cells via lipid nanoparticles, mRNA, or recombinant viruses (e.g., recombinant AAV).
[0087] In another aspect, the present invention provides a method for producing a genetically modified eukaryotic cell, comprising inserting a target exogenous sequence into a dystrophin gene of a genetically modified eukaryotic cell, the method comprising introducing an engineered meganuclease as described herein and a polynucleotide comprising a target sequence into a eukaryotic cell, wherein the engineered meganuclease produces a cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 12, and wherein the target sequence is inserted into the dystrophin gene at the cleavage site. In some embodiments, the polynucleotide comprises a nucleic acid sequence homologous to the nucleic acid sequence flanking the cleavage site, and the target sequence is inserted into the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a myocyte. In some embodiments, the myocyte is a muscle precursor cell (e.g., satellite cell or stem cell), a skeletal muscle cell or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into a eukaryotic cell by lipid nanoparticles, mRNA or a recombinant virus (e.g., recombinant AAV).
[0088] In another aspect, the present invention provides a method for producing a genetically modified eukaryotic cell comprising a modified dystrophin gene, the method comprising: introducing one or more polynucleotides into a eukaryotic cell, the polynucleotides comprising a first nucleic acid sequence encoding a first engineered nuclease and a second nucleic acid sequence encoding a second engineered nuclease, wherein the first engineered nuclease binds and cleaves a recognition sequence in an intron 5' upstream of exon 45, and wherein the second engineered nuclease binds and cleaves a recognition sequence in an intron 3' downstream of exon 55, wherein the first engineered nuclease and the second engineered nuclease are expressed in the eukaryotic cell, wherein the first engineered nuclease generates a first cleavage site in the dystrophin gene at its recognition sequence, wherein the second engineered nuclease generates a second cleavage site in the dystrophin gene at its recognition sequence, wherein the first cleavage site and the second cleavage site have complementary overhangs, wherein intervening genomic DNA between the first cleavage site and the second cleavage site is excised from the dystrophin gene, and wherein the dystrophin genes are annealed to produce a modified dystrophin gene.
[0089] In some embodiments, the first engineered nuclease is an engineered meganuclease as described herein that binds and cuts a recognition sequence comprising SEQ ID NO: 6, and the second engineered nuclease is an engineered meganuclease as described herein that binds and cuts a recognition sequence comprising SEQ ID NO: 10. In some embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from a combination of meganucleases (and variants thereof described herein) provided in Table 1. In such embodiments, the first cleavage site and the second cleavage site have complementary 3' overhangs. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD35-36x.63 (SEQ ID NO: 45), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36x.81 (SEQ ID NO: 46), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36x.81 (SEQ ID NO: 46), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36x.63 (SEQ ID NO: 45), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.195 (SEQ ID NO: 47), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.282 (SEQ ID NO: 48), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.282 (SEQ ID NO: 48), or a variant thereof as described herein.In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.349 (SEQ ID NO: 49), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.349 (SEQ ID NO: 49), or a variant thereof as described herein.
[0090] In some embodiments, the first engineered nuclease is an engineered meganuclease as described herein that binds and cuts a recognition sequence comprising SEQ ID NO: 6, and the second engineered nuclease is an engineered meganuclease as described herein that binds and cuts a recognition sequence comprising SEQ ID NO: 12. In such embodiments, the first cleavage site and the second cleavage site have complementary 3' overhangs. In some embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from a combination of meganucleases (and variants thereof described herein) provided in Table 2. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD37-38x.15 (SEQ ID NO: 53), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.15 (SEQ ID NO: 53), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.66 (SEQ ID NO: 54), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.66 (SEQ ID NO: 54), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.79 (SEQ ID NO: 55), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.79 (SEQ ID NO: 55), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38L.166 (SEQ ID NO: 56), or a variant thereof as described herein.
[0091] In some embodiments, the complementary overhangs (eg, 3' overhangs) of the first cleavage site and the second cleavage site are completely ligated to each other.
[0092] In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO: 32 or 34. In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO: 32. In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO: 34.
[0093] In some embodiments, the normal reading frame is restored in the modified dystrophin gene compared to the full-length wild-type dystrophin gene.
[0094] In some embodiments, the modified dystrophin gene encodes a modified dystrophin polypeptide that lacks the amino acids encoded by exons 45-55 of the wild-type dystrophin gene. In some embodiments, the modified dystrophin polypeptide comprises the amino acid sequence shown in SEQ ID NO:5.
[0095] In some embodiments, the method includes introducing a first polynucleotide and a second polynucleotide into a eukaryotic cell, wherein the first polynucleotide comprises a first nucleic acid sequence encoding a first engineered meganuclease and the second polynucleotide comprises a second nucleic acid sequence encoding a second engineered meganuclease. In some embodiments, the first polynucleotide is a first mRNA. In some embodiments, the second polynucleotide is a second mRNA. In some embodiments, the first mRNA and / or the second mRNA are mRNAs as described herein (i.e., encoding engineered meganucleases as described herein). In some embodiments, the first polynucleotide is a first recombinant DNA construct. In some embodiments, the second polynucleotide is a second recombinant DNA construct. In some embodiments, the first recombinant DNA construct and / or the second recombinant DNA construct are recombinant DNA constructs as described herein (i.e., comprising nucleic acid sequences encoding engineered meganucleases as described herein). In some embodiments, the first polynucleotide and the second polynucleotide are introduced into a eukaryotic cell by one or more lipid nanoparticles. In some embodiments, the first polynucleotide is introduced into a eukaryotic cell by a first lipid nanoparticle. In some embodiments, the second polynucleotide is introduced into a eukaryotic cell by a second lipid nanoparticle. In some embodiments, the first polynucleotide is introduced into a eukaryotic cell by a first recombinant virus. In some embodiments, the second polynucleotide is introduced into a eukaryotic cell by a second recombinant virus. In some embodiments, the first recombinant virus and / or the second recombinant virus is a recombinant virus as described herein (i.e., comprising a polynucleotide containing a nucleic acid sequence encoding an engineered meganuclease as described herein).
[0096] In some embodiments, the method includes introducing a polynucleotide comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease into a eukaryotic cell. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the mRNA is an mRNA as described herein (i.e., comprising the first and second nucleic acid sequences encoding the meganuclease described herein, respectively). In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the recombinant DNA construct is a recombinant DNA construct as described herein (i.e., comprising the first and second nucleic acid sequences encoding the meganuclease described herein, respectively). In some embodiments, the polynucleotide is introduced into a eukaryotic cell by a lipid nanoparticle. In some embodiments, the polynucleotide is introduced into a eukaryotic cell by a recombinant virus. In some embodiments, the recombinant virus is a recombinant virus as described herein (i.e., comprising a polynucleotide comprising the first nucleic acid sequence and the second nucleic acid sequence encoding the meganuclease described herein, respectively).
[0097] In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., satellite cell or stem cell), a skeletal muscle cell or a cardiomyocyte. In some embodiments, the mammalian cell is a human cell.
[0098] In another aspect, the invention provides a method for modifying a dystrophin gene in a target cell of a subject, wherein the dystrophin gene is characterized by a mutation that alters the reading frame of the dystrophin gene from wild-type, the method comprising: delivering to the target cell one or more polynucleotides comprising a first nucleic acid sequence encoding a first engineered nuclease and a second nucleic acid sequence encoding a second engineered nuclease, wherein the first engineered nuclease binds to and cleaves a recognition sequence in an intron 5' upstream of exon 45, and wherein the second engineered nuclease binds to and cleaves a recognition sequence in an intron 3' downstream of exon 55, wherein The first engineered nuclease and the second engineered nuclease are expressed in a target cell, wherein the first engineered nuclease generates a first cleavage site in a dystrophin gene at its recognition sequence, wherein the second engineered nuclease generates a second cleavage site in a dystrophin gene at its recognition sequence, wherein the first cleavage site and the second cleavage site have complementary overhangs, wherein intervening genomic DNA between the first cleavage site and the second cleavage site is excised from the dystrophin gene, wherein the dystrophin gene is annealed, and wherein a normal reading frame of the dystrophin gene is restored compared to a full-length wild-type dystrophin gene.
[0099] In some embodiments, the first engineered nuclease is an engineered meganuclease as described herein that binds and cuts a recognition sequence comprising SEQ ID NO: 6, and the second engineered nuclease is an engineered meganuclease as described herein that binds and cuts a recognition sequence comprising SEQ ID NO: 10. In some embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from a combination of meganucleases (and variants thereof described herein) provided in Table 1. In such embodiments, the first cleavage site and the second cleavage site have complementary 3' overhangs. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD35-36x.63 (SEQ ID NO: 45), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36x.81 (SEQ ID NO: 46), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36x.81 (SEQ ID NO: 46), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36x.63 (SEQ ID NO: 45), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.195 (SEQ ID NO: 47), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.282 (SEQ ID NO: 48), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.282 (SEQ ID NO: 48), or a variant thereof as described herein.In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.349 (SEQ ID NO: 49), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.349 (SEQ ID NO: 49), or a variant thereof as described herein.
[0100] In some embodiments, the first engineered nuclease is an engineered meganuclease as described herein that binds and cuts a recognition sequence comprising SEQ ID NO: 6, and the second engineered nuclease is an engineered meganuclease as described herein that binds and cuts a recognition sequence comprising SEQ ID NO: 12. In some embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from a combination of meganucleases (and variants thereof described herein) provided in Table 2. In such embodiments, the first cleavage site and the second cleavage site have complementary 3' overhangs. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD37-38x.15 (SEQ ID NO: 53), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.15 (SEQ ID NO: 53), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.66 (SEQ ID NO: 54), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.66 (SEQ ID NO: 54), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.79 (SEQ ID NO: 55), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.79 (SEQ ID NO: 55), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38L.166 (SEQ ID NO: 56), or a variant thereof as described herein.
[0101] In some embodiments, the complementary overhangs (eg, 3' overhangs) of the first cleavage site and the second cleavage site are completely ligated to each other.
[0102] In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO: 32 or 34. In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO: 32. In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO: 34.
[0103] In some embodiments, the dystrophin gene encodes a modified dystrophin polypeptide lacking the amino acids encoded by exons 45-55 of the wild-type dystrophin gene. In some embodiments, the modified dystrophin polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 5. In some embodiments, the subject transforms to a Becker muscular dystrophy phenotype.
[0104] In some embodiments, the method includes delivering a first polynucleotide and a second polynucleotide to a target cell, wherein the first polynucleotide comprises a first nucleic acid encoding a first engineered meganuclease and the second polynucleotide comprises a second nucleic acid sequence encoding a second engineered meganuclease. In some embodiments, the first polynucleotide is a first mRNA. In some embodiments, the second polynucleotide is a second mRNA. In some embodiments, the first mRNA and / or the second mRNA are as described herein (i.e., encoding an engineered meganuclease as described herein). In some embodiments, the first polynucleotide is a first recombinant DNA construct. In some embodiments, the second polynucleotide is a second recombinant DNA construct. In some embodiments, the first recombinant DNA construct and / or the second recombinant DNA construct are recombinant DNA constructs as described herein (i.e., comprising a nucleic acid sequence encoding an engineered meganuclease as described herein). In some embodiments, the first polynucleotide and the second polynucleotide are delivered to the target cell by one or more lipid nanoparticles. In some embodiments, the first polynucleotide is delivered to the target cell by a first lipid nanoparticle. In some embodiments, the second polynucleotide is delivered to the target cell by a second lipid nanoparticle. In some embodiments, the first polynucleotide is delivered to the target cell by a recombinant virus. In some embodiments, the second polynucleotide is delivered to the target cell by a second recombinant virus.In some embodiments, the first recombinant virus and / or the second recombinant virus is a recombinant virus as described herein (i.e., comprising a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease as described herein).
[0105] In some embodiments, the method includes delivering a first polynucleotide and a second polynucleotide to a target cell, wherein the first polynucleotide comprises a first nucleic acid encoding a first engineered meganuclease and the second polynucleotide comprises a second nucleic acid sequence encoding a second engineered meganuclease. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the mRNA is an mRNA as described herein (i.e., comprising first and second nucleic acid sequences encoding meganucleases as described herein, respectively). In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the recombinant DNA construct is a recombinant DNA construct as described herein (i.e., comprising first and second nucleic acid sequences encoding meganucleases as described herein, respectively). In some embodiments, the polynucleotide is delivered to the target cell by lipid nanoparticles. In some embodiments, the polynucleotide is delivered to the target cell by a recombinant virus. In some embodiments, the recombinant virus is a recombinant virus as described herein (i.e., comprising a polynucleotide containing a first nucleic acid sequence and a second nucleic acid sequence encoding meganucleases as described herein, respectively).
[0106] In some embodiments, the subject is a mammal. In some embodiments, the target cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., satellite cell or stem cell), a skeletal muscle cell or a cardiomyocyte. In some embodiments, the subject is a human.
[0107] In another aspect, the invention provides a method for treating DMD in a subject in need thereof, wherein the DMD is characterized by a mutation in a dystrophin gene that alters the reading frame of the dystrophin gene relative to the full-length wild-type dystrophin gene, the method comprising: administering to the subject an effective amount of one or more polynucleotides comprising a first nucleic acid sequence encoding a first engineered nuclease and a second nucleic acid sequence encoding a second engineered nuclease, wherein the first engineered nuclease binds to and cleaves a recognition sequence in an intron 5' upstream of exon 45, and wherein the second engineered nuclease binds to and cleaves a recognition sequence in an intron 3' downstream of exon 55, wherein The one or more polynucleotides are delivered to a target cell of a subject, wherein a first engineered nuclease and a second engineered nuclease are expressed in the target cell, wherein the first engineered nuclease generates a first cleavage site in a dystrophin gene at its recognition sequence, wherein the second engineered nuclease generates a second cleavage site in the dystrophin gene at its recognition sequence, wherein the first cleavage site and the second cleavage site have complementary overhangs, wherein intervening genomic DNA between the first cleavage site and the second cleavage site is excised from the dystrophin gene, wherein the dystrophin gene is annealed, and wherein a normal reading frame of the dystrophin gene is restored compared to the full-length wild-type dystrophin gene.
[0108] In some embodiments, the first engineered nuclease is an engineered meganuclease as described herein that binds and cuts a recognition sequence comprising SEQ ID NO: 6, and the second engineered nuclease is an engineered meganuclease as described herein that binds and cuts a recognition sequence comprising SEQ ID NO: 10. In some embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from a combination of meganucleases (and variants thereof described herein) provided in Table 1. In such embodiments, the first cleavage site and the second cleavage site have complementary 3' overhangs. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD35-36x.63 (SEQ ID NO: 45), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36x.81 (SEQ ID NO: 46), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36x.81 (SEQ ID NO: 46), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36x.63 (SEQ ID NO: 45), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.195 (SEQ ID NO: 47), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.282 (SEQ ID NO: 48), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.282 (SEQ ID NO: 48), or a variant thereof as described herein.In some embodiments, the first engineered meganuclease is DMD 19-20L.302 (SEQ ID NO: 39), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.349 (SEQ ID NO: 49), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.329 (SEQ ID NO: 40), or a variant thereof as described herein, and the second engineered meganuclease is DMD35-36L.349 (SEQ ID NO: 49), or a variant thereof as described herein.
[0109] In some embodiments, the first engineered nuclease is an engineered meganuclease as described herein that binds and cuts a recognition sequence comprising SEQ ID NO: 6, and the second engineered nuclease is an engineered meganuclease as described herein that binds and cuts a recognition sequence comprising SEQ ID NO: 12. In some embodiments, the first engineered meganuclease and the second engineered meganuclease are selected from a combination of meganucleases (and variants thereof described herein) provided in Table 2. In such embodiments, the first cleavage site and the second cleavage site have complementary 3' overhangs. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof described herein, and the second engineered meganuclease is DMD37-38x.15 (SEQ ID NO: 53), or a variant thereof described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.15 (SEQ ID NO: 53), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.66 (SEQ ID NO: 54), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.66 (SEQ ID NO: 54), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.13 (SEQ ID NO: 36), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.79 (SEQ ID NO: 55), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20x.87 (SEQ ID NO: 37), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38x.79 (SEQ ID NO: 55), or a variant thereof as described herein. In some embodiments, the first engineered meganuclease is DMD 19-20L.249 (SEQ ID NO: 38), or a variant thereof as described herein, and the second engineered meganuclease is DMD37-38L.166 (SEQ ID NO: 56), or a variant thereof as described herein.
[0110] In some embodiments, the complementary overhangs (eg, 3' overhangs) of the first cleavage site and the second cleavage site are completely ligated to each other.
[0111] In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO: 32 or 34. In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO: 32. In some embodiments, the dystrophin gene comprises the nucleic acid sequence shown in SEQ ID NO: 34.
[0112] In some embodiments, the dystrophin gene encodes a modified dystrophin polypeptide lacking the amino acids encoded by exons 45-55 of the wild-type dystrophin gene. In some embodiments, the modified dystrophin polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 5. In some embodiments, the subject transforms to a Becker muscular dystrophy phenotype.
[0113] In some embodiments, the method includes administering to a subject a first polynucleotide and a second polynucleotide, wherein the first polynucleotide comprises a first nucleic acid encoding a first engineered meganuclease and the second polynucleotide comprises a second nucleic acid sequence encoding a second engineered meganuclease. In some embodiments, the first polynucleotide is a first mRNA. In some embodiments, the second polynucleotide is a second mRNA. In some embodiments, the first mRNA and / or the second mRNA are mRNAs described herein (i.e., encoding engineered meganucleases described herein). In some embodiments, the first polynucleotide is a first recombinant DNA construct. In some embodiments, the second polynucleotide is a second recombinant DNA construct. In some embodiments, the first recombinant DNA construct and / or the second recombinant DNA construct are recombinant DNA constructs described herein (i.e., comprising a nucleic acid sequence encoding an engineered meganuclease described herein). In some embodiments, the first polynucleotide and the second polynucleotide are administered to a subject by lipid nanoparticles. In some embodiments, the first polynucleotide is administered to a subject by a first lipid nanoparticle. In some embodiments, the second polynucleotide is administered to a subject by a second lipid nanoparticle. In some embodiments, the first polynucleotide is administered to a subject by a first recombinant virus. In some embodiments, the second polynucleotide is administered to the subject via a second recombinant virus.In some embodiments, the first recombinant virus and / or the second recombinant virus is a recombinant virus described herein (i.e., comprising a polynucleotide comprising a nucleic acid sequence encoding an engineered meganuclease described herein).
[0114] In some embodiments, the method includes administering to a subject a polynucleotide comprising a first nucleic acid encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the mRNA is an mRNA as described herein (i.e., comprising first and second nucleic acid sequences encoding meganucleases as described herein, respectively). In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the recombinant DNA construct is a recombinant DNA construct as described herein (i.e., comprising first and second nucleic acid sequences encoding meganucleases as described herein, respectively). In some embodiments, the polynucleotide is administered to a subject via a lipid nanoparticle. In some embodiments, the polynucleotide is administered to a subject via a recombinant virus. In some embodiments, the recombinant virus is a recombinant virus as described herein (i.e., comprising a polynucleotide comprising a first nucleic acid sequence and a second nucleic acid sequence encoding meganucleases as described herein, respectively).
[0115] In some embodiments, the subject is a mammal. In some embodiments, the target cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., satellite cell or stem cell), a skeletal muscle cell or a cardiomyocyte. In some embodiments, the subject is a human.
[0116] In another aspect, the present invention provides a polynucleotide comprising the nucleic acid sequence as shown in SEQ ID NO:32 or SEQ ID NO:34.
[0117] In some embodiments, the polynucleotide comprises a nucleic acid sequence as shown in SEQ ID NO: 32. In some embodiments, the polynucleotide is a dystrophin gene in the genome of a cell (e.g., a human muscle cell), comprising a nucleic acid sequence as shown in SEQ ID NO: 32. In some embodiments, the polynucleotide is a pre-mRNA in a cell (e.g., a human muscle cell), comprising a nucleic acid sequence as shown in SEQ ID NO: 32.
[0118] In some embodiments, the polynucleotide comprises a nucleic acid sequence as shown in SEQ ID NO: 34. In some embodiments, the polynucleotide is a dystrophin gene in the genome of a cell (e.g., a human muscle cell), comprising a nucleic acid sequence as shown in SEQ ID NO: 34. In some embodiments, the polynucleotide is a pre-mRNA in a cell (e.g., a human muscle cell), comprising a nucleic acid sequence as shown in SEQ ID NO: 34.
[0119] In another aspect, the present invention provides a genetically modified eukaryotic cell comprising a modified dystrophin gene in its genome, wherein the modified dystrophin gene lacks exons 45-55, and wherein the modified dystrophin gene comprises the nucleic acid sequence as shown in SEQ ID NO:32 or the nucleic acid sequence as shown in SEQ ID NO:34 located within an intron between exon 44 and exon 56.
[0120] In some embodiments, the nucleic acid sequence comprises SEQ ID NO: 32. In some embodiments, the nucleic acid sequence comprises SEQ ID NO: 34.
[0121] In some embodiments, the genetically modified eukaryotic cell is a mammalian cell. In some embodiments, the genetically modified eukaryotic cell is a human cell. In some embodiments, the genetically modified eukaryotic cell is a muscle cell. In some embodiments, the muscle cell is a muscle precursor cell (e.g., satellite cell or stem cell), a skeletal muscle cell or a cardiomyocyte.
[0122] In another aspect, the invention provides a polypeptide comprising an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 5, wherein the polypeptide is a modified dystrophin protein lacking amino acids encoded by exons 45-55 of the dystrophin gene, and wherein the polypeptide comprises the C-terminal domain of dystrophin protein. In some embodiments, the polypeptide comprises the amino acid sequence as shown in SEQ ID NO: 5.
[0123] In another aspect, the present invention provides an engineered meganuclease as described herein, or a polynucleotide as described herein encoding an engineered meganuclease, or a cell as described herein expressing an engineered meganuclease, for use as a medicament.
[0124] In some embodiments, the medicament can be used to prepare a modified dystrophin gene in a subject. In some embodiments, the medicament can be used to treat DMD.
[0125] In another aspect, the present invention provides the use of the engineered meganuclease described herein, or the polynucleotide disclosed herein encoding the engineered meganuclease, or the cell described herein expressing the engineered meganuclease in the preparation of a medicament for treating DMD, wherein the medicament is used to increase the level of modified dystrophin (i.e., lacking the amino acids encoded by exons 45-55 of the dystrophin gene), or reduce symptoms associated with DMD. BRIEF DESCRIPTION OF THE DRAWINGS
[0126] Figure 1 It is a schematic diagram that provides the approximate location of the DMD meganuclease recognition sequence, and illustrates the method of double meganucleases that excise multiple exons from the dystrophin gene. As shown in the figure, the engineered meganuclease pairs that bind and cut the DMD 19-20 recognition sequence and the DMD 35-36 recognition sequence, or the DMD 19-20 recognition sequence and the DM 37-38 recognition sequence lead to the removal of exons 45-55 from the dystrophin gene. These recognition sequence pairs are located in introns, have the same four-base pair central sequence, and produce cleavage sites with complementary overhangs. Therefore, after removing the exons, the genes are connected at the cleavage site, and the cleavage site will be located in the intron between exon 44 and exon 56. After post-transcriptional splicing, this genetic modification leads to the production of dystrophin mRNA with exon 44 in frame with exon 56, which restores the dystrophin gene reading frame and leads to Becker-type dystrophin expression. Also shown are the approximate locations where a pair of engineered meganucleases bind and cleave the DMD 19-20 recognition sequence and the DMD 29-30 recognition sequence, resulting in the removal of exon 45 from the dystrophin gene.
[0127] Figure 2 Schematic diagram showing exemplary recognition sequences disclosed herein, including sense and antisense sequences for DMD 19-20 (SEQ ID NO: 6 and 7), DMD 29-30 (SEQ ID NO: 8 and 9), DMD 35-36 (SEQ ID NO: 10 and 11) and DMD 37-38 (SEQ ID NO: 12 and 13) recognition sequences in the human dystrophin gene. Each DMD recognition sequence targeted by the engineered meganuclease described herein includes two recognition half sites. Each recognition half site includes 9 base pairs, separated by a central sequence of 4 base pairs. For example, the DMD 19-20 recognition sequence has a 5' DMD19 half site and a 3' DMD20 half site, which has a four base pair central sequence GTAT.
[0128] Figure 3 The engineered meganuclease described herein comprises two subunits, wherein the first subunit comprises an HVR1 region (e.g., DMD19) that binds to a first recognition half site and the second subunit comprises an HVR2 region (e.g., DMD20) that binds to a second recognition half site. In embodiments where the engineered meganuclease is a single-chain meganuclease, the first subunit comprising the HVR1 region may be located at the N-terminal or C-terminal subunit. Similarly, the second subunit comprising the HVR2 region may be located at the N-terminal or C-terminal subunit.
[0129] Figures 4A-4C . Figure 4A An alignment of DMD 19-20 meganuclease sequences is provided. Figure 4B An alignment of the DMD 35-36 engineered meganuclease sequences is provided. Figure 4C An alignment of the DMD 37-38 engineered meganuclease sequences is provided. Asterisks indicate conserved residues between all aligned nucleases, and spaces indicate at least one amino acid difference between the meganucleases.
[0130] Figure 5 It is a schematic diagram of a reporter gene assay in CHO cells for evaluating an engineered meganuclease targeting a recognition sequence found in the dystrophin gene. For the engineered meganucleases described herein, a CHO cell line is generated in which a reporter gene cassette is stably integrated into the genome of the cell. The reporter gene cassette comprises, in 5' to 3' order: an SV40 early promoter; 5'2 / 3 of a GFP gene; a recognition sequence of an engineered meganuclease described herein (e.g., DMD 19-20, DMD 29-30, DMD 35-36, or DMD 37-38 recognition sequence); a recognition sequence of a CHO-23 / 24 meganuclease (WO 2012 / 167192); and 3'2 / 3 of a GFP gene. In the absence of a DNA breakage inducing agent, cells stably transfected with the cassette do not express GFP. Meganucleases are introduced by transducing mRNA encoding each meganuclease. When DNA breaks are induced at either meganuclease recognition sequence, the duplicated regions of the GFP gene recombine with each other, generating a functional GFP gene. The percentage of cells expressing GFP can then be determined by flow cytometry as an indirect indicator of the frequency of genome cleavage by the meganuclease.
[0131] Figures 6A-6I . Fig. 6A , 6B and 6G provide the efficiency of the engineered DMD 19-20 meganuclease binding and cleavage of the DMD 19-20 recognition sequence expressed in a CHO cell reporter gene assay. Figure 6C The efficiency of the engineered DMD 29-30 meganuclease in binding and cleaving the DMD 29-30 recognition sequence expressed in a CHO cell reporter gene assay is provided. Fig.6D and Figure 6H The efficiency of the engineered DMD 35-36 meganuclease in binding and cleaving the DMD 35-36 recognition sequence expressed in a CHO cell reporter gene assay is provided. Fig. 6E , Fig. 6F and Fig.6IThe efficiency of engineered DMD 37-38 meganucleases to bind and cleave DMD 37-38 recognition sequences expressed in a CHO cell reporter gene assay is provided. The relative activity index represents the % of GFP positive cells for each cell line expressing the tested meganuclease, which is normalized to the CHO-23 / 24 meganuclease expressing cell line to account for meganuclease toxicity.
[0132] Figures 7A-7D Shown is a bar graph showing the percentage frequency of insertions and deletions (indels) of the tested meganucleases targeting the indicated recognition sequences at two doses in MRC5 cells.Each meganuclease was tested at three time points after meganuclease transfection (days 2, 5 and 8). Fig. 7A The percentage of editing using DMD 19-20 meganucleases is provided. Figure 7B The percentage of editing using DMD 35-36 meganuclease is provided. Figure 7C The percentage of editing using DMD 37-38 meganucleases is provided. Fig.7D The percentage of editing using DMD 29-30 meganuclease is provided.
[0133] Fig. 8A and Figure 8B Perfectly linked PCR products and sequencing data of the dystrophin gene after cleavage with a pair of engineered meganucleases designed to bind and cleave the DMD 19-20 and DMD 35-36 recognition sequences are provided. Fig. 8A 1 is a gel image of PCR products using primers that specifically amplify complementary DMD 19-20 and DMD 35-36 recognition sequences. Lane 5 represents the combination of DMD 19-20x.13 and DMD 35-36x.63 meganucleases. Lane 6 represents the combination of DMD19-20x.87 and DMD 35-36x.81 meganucleases. Lane 7 represents the combination of DMD 19-20x.13 and DMD 35-36x.81 meganucleases. Lane 8 represents the combination of DMD 19-20x.87 and DMD 35-36x.63 meganucleases. Lane 24 represents a mock control. Figure 8B Representative sequencing data of perfect ligation during genomic sequence cleavage and after excision of the DMD 19-20 and DMD35-36 meganuclease recognition sequences are provided.
[0134] Fig. 9A and Fig. 9B Perfectly linked PCR products and sequencing data of the dystrophin gene after cleavage with a pair of engineered meganucleases designed to bind and cleave the DMD 19-20 and DMD 37-38 recognition sequences are provided. Fig. 8A : is a gel image of PCR products using primers that specifically amplify complementary DMD 19-20 and DMD 37-38 recognition sequences linked. Lane 9 represents the combination of DMD 19-20x.13 and DMD 37-38x.15 meganucleases. Lane 10 represents the combination of DMD19-20x.87 and DMD 37-38x.15 meganucleases. Lane 11 represents the combination of DMD 19-20x.13 and DMD 37-38x.66 meganucleases. Lane 12 represents the combination of DMD 19-20x.87 and DMD 37-38x.66 meganucleases. Lane 13 represents the combination of DMD 19-20x.13 and DMD 37-38x.79 meganucleases. Lane 14 represents the combination of DMD19-20x.87 and DMD 37-38x.79 meganucleases. Lane 24 represents a mock control. Fig. 9B Representative sequencing data of perfect ligation during genomic sequence cleavage and after excision of the DMD 19-20 and DMD 37-38 meganuclease recognition sequences are provided.
[0135] Fig.10 A PCR product of a perfect connection of the dystrophin gene after cutting with a pair of engineered meganucleases designed to bind and cut DMD 19-20 and DMD 29-30 recognition sequences is provided. Shown is a gel image of a PCR product using primers that specifically amplify the connection of complementary DMD 19-20 and DMD 29-30 recognition sequences. Lane 1 represents a combination of DMD 19-20x.13 and DMD 29-30x.18 meganucleases. Lane 2 represents a combination of DMD 19-20x.87 and DMD29-30x.40 meganucleases. Lane 3 represents a combination of DMD 19-20x.13 and DMD 29-30x.40 meganucleases. Lane 4 represents a combination of DMD 19-20x.87 and DMD 29-30x.18 meganucleases. Lane 24 represents a mock control.
[0136] Fig.11 A schematic is provided showing the approximate locations of forward and reverse primers and probes for reference and perfect ligation primer sets used to detect post-cleavage ligation events in a digital droplet PCR (ddPCR) assay. The schematic illustrates the recognition sequences for DMD 19-20 and DMD 37-38 ligations.
[0137] Figures 12A-12C Bar graphs are provided showing the percentage of deletion of exons 45-55 or exon 45 alone as assessed by ddPCR. Fig. 12AExon deletion data are provided for DMD 19-20x.13 and DMD 35-36x.63 meganucleases, DMD 19-20x.87 and DMD 35-36x.81 meganucleases, a combination of DMD 19-20x.13 and DMD 35-36x.81 meganucleases, 19-20x.87 and DMD 35-36x.63 meganucleases, and mock controls. Fig. 12B Exon deletion data are provided for DMD 19-20x.13 and DMD 37-38x.15 meganuclease, DMD 19-20x.87 and DMD 37-38x.15 meganuclease, DMD 19-20x.13 and DMD 37-38x.66 meganuclease, DMD 19-20x.87 and DMD 37-38x.66 meganuclease, DMD 19-20x.13 and DMD 37-38x.79 meganuclease, a combination of DMD 19-20x.87 and DMD 37-38x.79 meganuclease, and mock controls. Fig. 12C Exon deletion data are provided for exon 45 alone as well as for DMD 19-20x.13 and DMD 29-30x.18 meganucleases, DMD 19-20x.87 and DMD 29-30x.40 meganucleases, the combination of DMD 19-20x.13 and DMD 29-30x.40 meganucleases, DMD 19-20x.87 and DMD 29-30x.18 meganucleases, and mock controls.
[0138] Fig.13 Line graphs of perfect ligation events assessed by ddPCR using other different combinations of engineered meganucleases are provided.
[0139] Fig.14 Provided is a bar graph showing the percentage of exon 45-55 deletions, assessed by ddPCR in human skeletal muscle myoblasts (HSMM) using the DMD 19-20L.249 and DMD37-38L.166 engineered meganuclease pairs. HSMM cells were transfected with 20ng, 40ng, 80ng or 160ng of mRNA encoding each engineered meganuclease.
[0140] Fig.15A bar graph is provided showing the percentage of perfect ligation assessed by ddPCR using the DMD 19-20L.249 and DMD 37-38L.166 engineered meganuclease pairs in an immortalized myoblast cell line from a patient with DMD (AB1098 cells). AB1098 cells were transfected with 10 ng, 20 ng, 40 ng, 80 ng, or 160 ng of mRNA encoding each meganuclease.
[0141] Figures 16A-16C Protein expression data following treatment with 10 ng, 20 ng, 40 ng, 80 ng or 160 ng of mRNA encoding DMD 19-20L.249 and DMD 37-38L.166 engineered meganucleases or a mock control in AB1098 cells are provided. Fig.16A is a graph showing dystrophin expression after treatment with engineered meganuclease combinations or mock control. Fig. 16B A gel image of a shortened dystrophin band of the correct size (ie, lacking the amino acids encoded by exons 45-55) is provided. Fig. 16C The amount of dystrophin relative to the reference vinculin gene is provided.
[0142] Fig.17 Provided is a bar graph showing RNA splicing from exon 44 to exon 56 in mRNA of AB1098 cells following transfection with 10 ng, 20 ng, 40 ng, 80 ng or 160 ng of mRNA encoding DMD 19-20L.249 and DMD 37-38L.166 engineered meganucleases or a mock control.
[0143] Fig.18 A bar graph is provided showing the percentage of perfect ligation assessed by ddPCR in HSMM cells using the indicated pairs of engineered meganucleases. HSMM cells were transfected with 40 ng of mRNA encoding each engineered meganuclease.
[0144] Fig.19 A schematic diagram of an oligo capture assay for determining off-target effects of an engineered nuclease (e.g., an engineered meganuclease as described herein) is provided. As shown, an integration cassette or oligomer anneals to a double-strand break in the genome, which may be due to cutting by an engineered nuclease. The DNA is then sheared by ultrasound, an adapter is connected and PCR amplification is performed, followed by sequence analysis to determine the location of the double-strand break.
[0145] Fig. 20Figures describing the results of oligo (oligonucleotide) capture assays are provided, which are used to identify off-target cleavage induced by DMD 19-20x.13, DMD 19-20L.249, DMD 19 / 20L.329, DMD 19:20L.374, DMD19-20L.375, DMD 19-20L.431 and DMD 19-20-L.458 meganucleases transfected in HEK293 cells. The circled points represent the sites on the target, and the points without circles will represent the off-target sites, and the X-axis represents the number of sequencing reads for each detected off-target site. The shadow of the point represents the number of base pair mismatches between the sites on the target and each detected off-target site. The closer the point is to the top of the row, the fewer the number of mismatches.
[0146] Fig.21 Figures are provided describing the results of oligo capture assays to identify off-target cleavage induced by DMD35-36x.63, DMD 35-36L.195, DMD 35-36L.364, DMD 35.36L.372, DMD 35-36L.457, and DMD35.36L.469 meganucleases transfected in HEK 293 cells. Circled points represent on-target sites, uncircled points represent off-target sites, and the X-axis represents the number of sequencing reads for each off-target site. The shading and proximity of the top of the row of points represent the number of base pair mismatches between the on-target site and each detected off-target site.
[0147] Fig. 22 A bar graph is provided showing the total percent (%) of genomic DNA adjacent to exon 45-55 after cleavage of the DMD 19-20 and DMD 35-36 recognition sequences by each pair of engineered DMD 19-20- and DMD 35-36 meganucleases shown.
[0148] Fig.23AProvided is a WES protein intensity readout of levels of a shortened modified dystrophin protein lacking exons 45-55 of the dystrophin gene in AB1098 cells treated with a combination of DMD 19-20 and DMD 35-36 meganucleases. Lane 1 is a marker control; Lane 2 is a cardiac dystrophin positive control; Lane 3 is a blank control; Lane 4 is a combination of DMD 19-20L.374 and DMD 35-36L.376 meganucleases; Lane 5 is a combination of DMD 19-20L.374 and DMD35-36L.457 meganucleases; Lane 6 is a combination of DMD 19-20L.374 and DMD 35-36L.469 meganucleases; Lane 7 is a combination of DMD 19-20L.375 and DMD 35-36L.376 meganucleases; Lane 8 is a combination of DMD19-20L.375 and DMD 35-36L.457 meganucleases; Lane 9 is a combination of DMD 19-20L.375 and DMD Lane 10 is a combination of DMD 19-20L.431 and DMD 35-36L.376 meganuclease; Lane 11 is a combination of DMD 19-20L.431 and DMD 35-36L.457 meganuclease; Lane 12 is a combination of DMD19-20L.431 and DMD 35-36L.469 meganuclease; Lane 13 is a combination of DMD 19-20L.458 and DMD 35-36L.376 meganuclease; Lane 14 is a combination of DMD 19-20L.458 and DMD 35-36L.457 meganuclease; Lane 15 is a combination of DMD 19-20L.458 and DMD Lanes 35-36 are combinations of L.469 meganucleases; and lane 16 is a mock AB1098 cell line control, which lacks expression of dystrophin. Fig. 23B Provided is a bar graph showing levels of shortened modified dystrophin by WES analysis normalized to the vinculin loading control for each pair of engineered DMD 19-20 and DMD 35-36 meganucleases shown.
[0149] Figures 24A-24B . Fig.24A A bar graph is provided showing the total percent (%) of genomic DNA adjacent to exons 45-55 after cleavage of the DMD 19-20 and DMD 37-38 recognition sequences by each pair of engineered DMD 19-20- and DMD 37-38 meganucleases indicated. Fig. 24BA bar graph is provided showing the percent (%) recovery of dystrophin for each indicated pair of engineered DMD 19-20 and DMD 37-38 meganucleases compared to an equivalent rat quadriceps tissue lysate loading based on a standard curve generated from that tissue.
[0150] Figures 25A-25E Provided is a bar graph showing the percentage (%) of perfect junctions of genomic DNA adjacent to exon 45-55 in muscle tissue following cleavage of the DMD 19-20 and DMD 37-38 recognition sequences by the DMD 19-20x.13 and DMD 37-38x.15 engineered meganucleases pairs using different muscle-specific promoter combinations. Fig.25A The percentage of perfect connections in the quadriceps tissue is shown. Fig.25B The percentage of perfect connections in cardiac tissue is shown. Fig.25C The percentage of perfect connections in the diaphragm tissue is shown. Fig.25D The percentage of perfect connections in soleus muscle tissue is shown. Fig.25E The percentage of perfect connections in liver tissue is shown.
[0151] Figures 26A-26E Provided is a bar graph showing the total percent (%) of genomic DNA adjacent to exon 45-55 in muscle tissue following cleavage of the DMD 19-20L.329 and DMD 37-38L.219 engineered meganuclease pairs at the DMD 19-20 and DMD 35-36 recognition sequences. Fig.26A The percentage of total connections in the quadriceps tissue is shown. Fig.26B The percentage of total connectivity in cardiac tissue is shown. Fig.26C The percentage of total connections in diaphragmatic tissue is shown. Fig.25D The percentage of total connections in soleus muscle tissue is shown. Fig.26E The percentage of total connectivity in liver tissue is shown.
[0152] Figures 27A-27E A bar graph is provided showing the total AAV amount at two different dose levels (2x10 12 or 4x10 12 ), Total ligation percentage (%) of genomic DNA adjacent to exon 45-55 in muscle tissue after cleavage of the DMD 19-20 and DMD 35-36 recognition sequences by the DMD 19-20x.13 and DMD 37-38x.15 engineered meganucleases. Fig.27A The percentage of total connections in the quadriceps tissue is shown. Fig.27B The percentage of total connectivity in cardiac tissue is shown. Fig.27CThe percentage of total connections in diaphragmatic tissue is shown. Fig.27D The percentage of total connections in tibialis anterior (TA) tissue is shown. Fig.27E The percentage of total connectivity in liver tissue is shown.
[0153] Figures 28A-28C Provided are WES protein intensity readouts of dystrophin levels in shortened modified dystrophin gene deletion exons 45-55 following treatment with DMD 19-20x.13 and DMD 37-38x.15 meganucleases. Figures 28A-28C Lanes 1-6 represent the standard curve of protein band intensity of full-length human dystrophin from mice expressing human dystrophin; Lanes 7-8 represent the standard curve of protein band intensity from using 1x10 14 The protein band intensity of shortened modified dystrophin in mice treated with a combination of DMD 19-20x.13 and DMD 37-38x.15 meganucleases at 2x10 VG / kg; Lanes 9-10 represent the intensity of the protein band from ... 14 Intensity of the protein band of shortened modified dystrophin in mice treated with a combination of DMD 19-20x.13 and DMD 37-38x.15 meganucleases at 5 VG / kg; lanes 11-12 represent mice treated with PBS and without meganucleases. Fig.28A represents the levels of shortened modified dystrophin detected in cardiac tissue at the indicated doses; Fig.28B represents the levels of shortened modified dystrophin detected in diaphragm tissue at the indicated doses; Fig.28C The levels of shortened modified dystrophin detected in quadriceps muscle tissue at the indicated doses are shown.
[0154] Fig.29 Provided is a graph showing the total percent (%) of genomic DNA adjacent to exon 45-55 in quadriceps, heart, and diaphragm muscle tissues after cleavage of the DMD 19-20L.329 and DMD 35-36L.349 engineered meganuclease pairs at the DMD 19-20 and DMD 35-36 recognition sequences.
[0155] Figures 30A-30C Provided are WES protein intensity readouts of shortened modified dystrophin levels lacking exons 45-55 of the dystrophin gene following treatment with DMD 19-20L.329 and DMD 35-36L.349 meganucleases utilizing different muscle-specific promoters. Figures 30A-30CLane 1 represents ladder (molecular weight standard); Lanes 2-6 represent the band intensity of full-length human dystrophin from mice expressing human dystrophin; Lane 7 represents the band intensity of 1×10 14 The intensity of the band of shortened modified dystrophin in mice treated with a combination of DMD 19-20L.329 and DMD 35-36L.349 meganucleases at 10 VG / kg; Lane 8 represents the ... 14 Band intensity of shortened modified dystrophin in mice treated with a combination of DMD 19-20L.329 and DMD 35-36L.349 meganucleases at 1x10 14 Band intensity of shortened modified dystrophin in mice treated with a combination of DMD19-20L.329 and DMD 35-36L.349 meganucleases at 5 VG / kg, where DMD 19-20L.329 meganuclease is under the control of the CK8 muscle-specific promoter and DMD 35-36L.349 meganuclease is under the control of the SPc5-12 muscle-specific promoter; Lanes 10-11 represent mice treated with PBS. Fig. 30A represents the levels of shortened modified dystrophin detected in cardiac tissue at the indicated doses; Fig. 30B represents the levels of shortened modified dystrophin detected in diaphragm tissue at the indicated doses; and Fig. 30C The levels of shortened modified dystrophin detected in quadriceps muscle tissue at the indicated doses are shown.
[0156] Fig.31 Provided is a bar graph showing shortened modified dystrophin levels normalized to vinculin loading control in quadriceps, heart, and diaphragm muscle tissues from mice treated with DMD19-20L.329 and DMD 35-36L.349 meganucleases or PBS by WES analysis.
[0157] Fig.32 Provided are images of immunohistochemistry of quadriceps, heart and diaphragm muscle tissue from mice treated with a combination of DMD 19-20L.329 and DMD 35-36L.349 meganucleases or PBS. Dark staining represents detection of human dystrophin, which is only visible in mice treated with the meganuclease combination.
[0158] Fig.33A and Fig.33BProvided are fluorescent immunohistochemistry images of mouse quadriceps tissue following treatment with PBS or the DMD 19-20L.329 and DMD 35-36L.349 meganuclease pair delivered to hDMDdel52 / mdx (hDMD) mice using AAV9 capsids. Fig.33A Images of Pax7 expression in quadriceps muscle tissue from PBS treated mice are provided. The left image is a control image showing any background staining using primary and secondary antibodies that detect meganuclease expression. The middle image shows cells expressing Pax7 indicated by white arrows; and the right image shows Pax7 (white arrows) and any background staining from antibodies that detect meganuclease expression. Fig.33B Images of meganuclease and Pax7 expression in quadriceps muscle tissue from meganuclease treated mice are provided. The left image provides cells expressing only meganuclease indicated by white arrows, and full arrows indicate cells expressing meganuclease protein and Pax7; the middle image shows cells expressing only Pax7 indicated by white arrows or Pax7 and meganuclease protein indicated by full arrows. The right image shows cells expressing meganuclease protein or Pax7 indicated by arrows, or cells expressing both meganuclease protein and Pax7 indicated by full arrows.
[0159] Fig.34 A schematic diagram of a BaseScope assay for detecting mRNA expression of modified dystrophin transcripts is provided, wherein exons 45-55 of the human dystrophin gene have been deleted after expression of two nucleases. The first nuclease binds and cuts a recognition sequence in the intron immediately adjacent to the 5' of exon 45, while the second nuclease binds and cuts a recognition sequence in the inclusion immediately adjacent to the 3' of exon 55. As shown, the nucleases that bind and cut the recognition sequences in these introns cause double-strand breaks, which are then repaired by direct reconnection of the genome. After transcription and splicing, mRNAs with exons 44 and exon 56 spliced together are produced. The human dystrophin transcripts of this modification are then detected in muscle tissue sections using probes designed to recognize that the exon 44 is connected to exon 56 (expressed as E44-E56 connection).
[0160] Fig.35A and Fig.35B Provided are BaseScope staining of mouse quadriceps muscle tissue from hDMDdel52 / mdx (hDMD) mice treated with PBS or DMD 19-20L.329 and DMD 35-36L.349 meganucleases. Fig.35ABaseScope staining for Pax7 transcript expression from muscle tissue of PBS-treated mice is shown, along with any background staining from the probe used to detect expression of the modified human dystrophin transcript. Fig.35B BaseScope staining of muscle tissue from mice treated with DMD 19-20L.329 and DMD 35-36L.349 meganucleases for expression of Pax7 transcript and modified human dystrophin transcript is shown.
[0161] Fig.36 Provided are WES protein intensity reads for the levels of shortened modified dystrophin proteins lacking exons 45-55 of the dystrophin gene after electroporation of KM1328 patient cell lines that normally lack dystrophin expression with increasing doses of DMD19-20L.329 and DMD 35-36L.349 meganucleases at 20ng, 80ng and 160ng of mRNA encoding meganucleases. Lane 1 represents ladder (molecular weight standard); Lane 2 represents mock control; Lanes 3-5 represent the band intensity of shortened modified dystrophin proteins in cells treated with 20ng, 80ng and 160ng meganuclease mRNA; Lane 6 represents the band intensity of full-length human dystrophin proteins.
[0162] Fig.37 Provided are WES protein intensity readouts for the levels of shortened modified dystrophin proteins lacking exons 45-55 of the dystrophin gene after electroporation of AB1098 patient cell lines that normally lack dystrophin with 80 ng of mRNA encoding meganucleases using DMD 19-20L.329 and DMD 35-36L.349 meganucleases. Lane 1 represents the band intensity of full-length human dystrophin; Lane 2 represents a mock control; Lane 3 represents the band intensity of shortened modified dystrophin proteins in cells treated with 80 ng of meganuclease mRNA.
[0163] Figures 38A-38D Provided are fluorescent immunohistochemistry images of mouse quadriceps tissue following treatment with PBS or DMD19-20L.329 and DMD 35-36L.349 meganuclease pairs delivered to hDMDdel52 / mdx (hDMD) mice using AAVrH74 capsid. Fig.38AImages of Pax7 expression in quadriceps muscle tissue from PBS treated mice are provided. The left image is a control image, which provides any background staining with primary and secondary antibodies detecting meganuclease expression; asterisks indicate nonspecific background detection. The middle image shows cells expressing Pax7 indicated by white arrows; the right image shows Pax7 (white arrows) and any background staining from antibodies detecting meganuclease expression indicated by asterisks. Fig.38B Provides a 1x10 14 Images of meganuclease and Pax7 expression in quadriceps muscle tissue of mice treated with VG / kg dose of meganuclease; Fig.38C Provides 3x10 13 Images of meganuclease treated mice at a dose of VG / kg; and Fig.38D Provides a 1x10 13 Images of mice treated with meganuclease at a dose of VG / kg. Figures 38B-38D The left panel in provides cells expressing only meganucleases; the middle panel shows cells expressing Pax7; and Figures 38B-38D The right panel in shows cells expressing either meganuclease protein or Pax7, or both meganuclease protein and Pax7, as indicated by full arrows. Asterisks indicate nonspecific background staining.
[0164] A brief description of the sequence
[0165] SEQ ID NO: 1 shows the amino acid sequence of the wild-type I-Crel meganuclease from Chlamydomonas reinhardtii.
[0166] SEQ ID NO: 2 shows the amino acid sequence of the LAGLIDADG motif.
[0167] SEQ ID NO: 3 shows the amino acid sequence of the nuclear localization signal.
[0168] SEQ ID NO: 4 shows the amino acid sequence of wild-type dystrophin CCDS48091.1 (Gene ID 1756).
[0169] SEQ ID NO: 5 shows the amino acid sequence of wild-type dystrophin CCDS48091.1 (Gene ID 1756) lacking the amino acids encoded by exons 45-55.
[0170] SEQ ID NO: 6 shows the nucleic acid sequence of the sense strand of the DMD 19-20 recognition sequence.
[0171] SEQ ID NO: 7 shows the nucleic acid sequence of the antisense strand of the DMD 19-20 recognition sequence.
[0172] SEQ ID NO: 8 shows the nucleic acid sequence of the sense strand of the DMD 29-30 recognition sequence.
[0173] SEQ ID NO: 9 shows the nucleic acid sequence of the antisense strand of the DMD 29-30 recognition sequence.
[0174] SEQ ID NO: 10 shows the nucleic acid sequence of the sense strand of the DMD 35-36 recognition sequence.
[0175] SEQ ID NO: 11 shows the nucleic acid sequence of the antisense strand of the DMD 35-36 recognition sequence.
[0176] SEQ ID NO: 12 shows the nucleic acid sequence of the sense strand of the DMD 37-38 recognition sequence.
[0177] SEQ ID NO: 13 shows the nucleic acid sequence of the antisense strand of the DMD 37-38 recognition sequence.
[0178] SEQ ID NO: 14 shows the nucleic acid sequence of the first half-site sense strand of the DMD 19-20 recognition sequence.
[0179] SEQ ID NO: 15 shows the nucleic acid sequence of the first half site antisense strand of the DMD 19-20 recognition sequence.
[0180] SEQ ID NO: 16 shows the nucleic acid sequence of the first half-site sense strand of the DMD 29-30 recognition sequence.
[0181] SEQ ID NO: 17 shows the nucleic acid sequence of the first half site antisense strand of the DMD 29-30 recognition sequence.
[0182] SEQ ID NO: 18 shows the nucleic acid sequence of the first half-site sense strand of the DMD 35-36 recognition sequence.
[0183] SEQ ID NO: 19 shows the nucleic acid sequence of the first half site antisense strand of the DMD 35-36 recognition sequence.
[0184] SEQ ID NO: 20 shows the nucleic acid sequence of the first half-site sense strand of the DMD 37-38 recognition sequence.
[0185] SEQ ID NO: 21 shows the nucleic acid sequence of the first half site antisense strand of the DMD 37-38 recognition sequence.
[0186] SEQ ID NO: 22 shows the nucleic acid sequence of the second half site sense strand of the DMD 19-20 recognition sequence.
[0187] SEQ ID NO: 23 shows the nucleic acid sequence of the second half site antisense strand of the DMD 19-20 recognition sequence.
[0188] SEQ ID NO: 24 shows the nucleic acid sequence of the second half site sense strand of the DMD 29-30 recognition sequence.
[0189] SEQ ID NO: 25 shows the nucleic acid sequence of the second half site antisense strand of the DMD 29-30 recognition sequence.
[0190] SEQ ID NO: 2 shows the nucleic acid sequence of the second half site sense strand of the DMD 35-36 recognition sequence.
[0191] SEQ ID NO: 27 shows the nucleic acid sequence of the second half site antisense strand of the DMD 35-36 recognition sequence.
[0192] SEQ ID NO: 28 shows the nucleic acid sequence of the second half site sense strand of the DMD 37-38 recognition sequence.
[0193] SEQ ID NO: 29 shows the nucleic acid sequence of the second half site antisense strand of the DMD 37-38 recognition sequence.
[0194] SEQ ID NO: 30 shows the nucleic acid sequence of the linked hybrid DMD 19-20 / 29-30 sense strand.
[0195] SEQ ID NO:31 shows the nucleic acid sequence of the linked hybrid DMD 19-20 / 29-30 sense strand.
[0196] SEQ ID NO:32 shows the nucleic acid sequence of the linked hybrid DMD 19-20 / 35-36 sense strand.
[0197] SEQ ID NO:33 shows the nucleic acid sequence of the linked hybrid DMD 19-20 / 35-36 sense strand.
[0198] SEQ ID NO: 34 shows the nucleic acid sequence of the linked hybrid DMD 19-20 / 37-38 sense strand.
[0199] SEQ ID NO:35 shows the nucleic acid sequence of the linked hybrid DMD 19-20 / 37-38 sense strand.
[0200] SEQ ID NO: 36 shows the amino acid sequence of the DMD 19-20x.13 engineered meganuclease.
[0201] SEQ ID NO: 37 shows the amino acid sequence of the DMD 19-20x.87 engineered meganuclease.
[0202] SEQ ID NO: 38 shows the amino acid sequence of the DMD 19-20L.249 engineered meganuclease.
[0203] SEQ ID NO: 39 shows the amino acid sequence of the DMD 19-20L.302 engineered meganuclease.
[0204] SEQ ID NO:40 shows the amino acid sequence of the DMD 19-20L.329 engineered meganuclease.
[0205] SEQ ID NO:41 shows the amino acid sequence of the DMD 19-20L.374 engineered meganuclease.
[0206] SEQ ID NO:42 shows the amino acid sequence of the DMD 19-20L.375 engineered meganuclease.
[0207] SEQ ID NO:43 shows the amino acid sequence of the DMD 19-20L.431 engineered meganuclease.
[0208] SEQ ID NO:44 shows the amino acid sequence of the DMD 19-20L.458 engineered meganuclease.
[0209] SEQ ID NO:45 shows the amino acid sequence of the DMD 35-36x.63 engineered meganuclease.
[0210] SEQ ID NO:46 shows the amino acid sequence of the DMD 35-36x.81 engineered meganuclease.
[0211] SEQ ID NO:47 shows the amino acid sequence of the DMD 35-36L.195 engineered meganuclease.
[0212] SEQ ID NO:48 shows the amino acid sequence of the DMD35-36L.282 engineered meganuclease.
[0213] SEQ ID NO:49 shows the amino acid sequence of the DMD35-36L.349 engineered meganuclease.
[0214] SEQ ID NO:50 shows the amino acid sequence of the DMD 35-36L.376 engineered meganuclease.
[0215] SEQ ID NO:51 shows the amino acid sequence of the DMD 35-36L.457 engineered meganuclease.
[0216] SEQ ID NO:52 shows the amino acid sequence of the DMD 35-36L.469 engineered meganuclease.
[0217] SEQ ID NO:53 shows the amino acid sequence of the DMD 37-38x.15 engineered meganuclease.
[0218] SEQ ID NO:54 shows the amino acid sequence of the DMD 37-38x.66 engineered meganuclease.
[0219] SEQ ID NO:55 shows the amino acid sequence of the DMD 37-38x.79 engineered meganuclease.
[0220] SEQ ID NO:56 shows the amino acid sequence of the DMD 37-38x.166 engineered meganuclease.
[0221] SEQ ID NO:57 shows the amino acid sequence of the DMD 37-38L.478 engineered meganuclease.
[0222] SEQ ID NO:58 shows the amino acid sequence of the DMD 37-38L.512 engineered meganuclease.
[0223] SEQ ID NO:59 shows the amino acid sequence of the DMD 37-38L.528 engineered meganuclease.
[0224] SEQ ID NO:60 shows the nucleic acid sequence encoding the DMD 19-20x.13 engineered meganuclease.
[0225] SEQ ID NO:61 shows the nucleic acid sequence encoding the DMD 19-20x.87 engineered meganuclease.
[0226] SEQ ID NO:62 shows the nucleic acid sequence encoding the DMD 19-20L.249 engineered meganuclease.
[0227] SEQ ID NO:64 shows the nucleic acid sequence encoding the DMD 19-20L.302 engineered meganuclease.
[0228] SEQ ID NO:64 shows the nucleic acid sequence encoding the DMD 19-20L.309 engineered meganuclease.
[0229] SEQ ID NO:65 shows the nucleic acid sequence encoding the DMD 19-20L.374 engineered meganuclease.
[0230] SEQ ID NO:66 shows the nucleic acid sequence encoding the DMD 19-20L.375 engineered meganuclease.
[0231] SEQ ID NO:67 shows the nucleic acid sequence encoding the DMD 19-20L.431 engineered meganuclease.
[0232] SEQ ID NO:68 shows the nucleic acid sequence encoding the DMD 19-20L.458 engineered meganuclease.
[0233] SEQ ID NO:69 shows the nucleic acid sequence encoding the DMD 35-36x.63 engineered meganuclease.
[0234] SEQ ID NO:70 shows the nucleic acid sequence encoding the DMD 35-36x.81 engineered meganuclease.
[0235] SEQ ID NO:71 shows the nucleic acid sequence encoding the DMD 35-36L.195 engineered meganuclease.
[0236] SEQ ID NO:72 shows the nucleic acid sequence encoding the DMD 35-36L.282 engineered meganuclease.
[0237] SEQ ID NO:73 shows the nucleic acid sequence encoding the DMD 35-36L.349 engineered meganuclease.
[0238] SEQ ID NO:74 shows the nucleic acid sequence encoding the DMD 35-36L.376 engineered meganuclease.
[0239] SEQ ID NO:75 shows the nucleic acid sequence encoding the DMD 35-36L.457 engineered meganuclease.
[0240] SEQ ID NO: 76 shows the nucleic acid sequence encoding the DMD 35-36L.469 engineered meganuclease.
[0241] SEQ ID NO: 77 shows the nucleic acid sequence encoding the DMD 37-38x.15 engineered meganuclease.
[0242] SEQ ID NO: 78 shows the nucleic acid sequence encoding the DMD 37-38x.66 engineered meganuclease.
[0243] SEQ ID NO: 79 shows the nucleic acid sequence encoding the DMD 37-38x.79 engineered meganuclease.
[0244] SEQ ID NO:80 shows the nucleic acid sequence encoding the DMD 37-38L.166 engineered meganuclease.
[0245] SEQ ID NO:81 shows the nucleic acid sequence encoding the DMD 37-38L.478 engineered meganuclease.
[0246] SEQ ID NO:82 shows the nucleic acid sequence encoding the DMD 37-38L.512 engineered meganuclease.
[0247] SEQ ID NO:83 shows the nucleic acid sequence encoding the DMD 37-38L.528 engineered meganuclease.
[0248] SEQ ID NO:84 shows the amino acid sequence of the DMD 19-20x.13 engineered meganuclease DMD19 binding subunit.
[0249] SEQ ID NO:85 shows the amino acid sequence of the DMD 19-20x.87 engineered meganuclease DMD19 binding subunit.
[0250] SEQ ID NO:86 shows the amino acid sequence of the DMD 19-20L.249 engineered meganuclease DMD19 binding subunit.
[0251] SEQ ID NO:87 shows the amino acid sequence of the DMD 19-20L.302 engineered meganuclease DMD19 binding subunit.
[0252] SEQ ID NO:88 shows the amino acid sequence of the DMD 19-20L.329 engineered meganuclease DMD19 binding subunit.
[0253] SEQ ID NO:89 shows the amino acid sequence of the DMD 19-20L.374 engineered meganuclease DMD19 binding subunit.
[0254] SEQ ID NO:90 shows the amino acid sequence of the DMD 19-20L.375 engineered meganuclease DMD19 binding subunit.
[0255] SEQ ID NO:91 shows the amino acid sequence of the DMD 19-20L.431 engineered meganuclease DMD19 binding subunit.
[0256] SEQ ID NO:92 shows the amino acid sequence of the DMD 19-20L.458 engineered meganuclease DMD19 binding subunit.
[0257] SEQ ID NO:93 shows the amino acid sequence of the DMD 35-36x.63 engineered meganuclease DMD35 binding subunit.
[0258] SEQ ID NO:94 shows the amino acid sequence of the DMD 35-36x.81 engineered meganuclease DMD35 binding subunit.
[0259] SEQ ID NO:95 shows the amino acid sequence of the DMD 35-36L.195 engineered meganuclease DMD35 binding subunit.
[0260] SEQ ID NO:96 shows the amino acid sequence of the DMD 35-36L.282 engineered meganuclease DMD35 binding subunit.
[0261] SEQ ID NO:97 shows the amino acid sequence of the DMD 35-36L.349 engineered meganuclease DMD35 binding subunit.
[0262] SEQ ID NO:98 shows the amino acid sequence of the DMD 35-36L.376 engineered meganuclease DMD35 binding subunit.
[0263] SEQ ID NO:99 shows the amino acid sequence of the DMD 35-36L.457 engineered meganuclease DMD35 binding subunit.
[0264] SEQ ID NO: 100 shows the amino acid sequence of the DMD 35-36L.469 engineered meganuclease DMD35 binding subunit.
[0265] SEQ ID NO: 101 shows the amino acid sequence of the DMD 37-38x.15 engineered meganuclease DMD37 binding subunit.
[0266] SEQ ID NO: 102 shows the amino acid sequence of the DMD 37-38x.66 engineered meganuclease DMD37 binding subunit.
[0267] SEQ ID NO: 103 shows the amino acid sequence of the DMD 37-38x.79 engineered meganuclease DMD37 binding subunit.
[0268] SEQ ID NO: 104 shows the amino acid sequence of the DMD 37-38L.166 engineered meganuclease DMD37 binding subunit.
[0269] SEQ ID NO: 105 shows the amino acid sequence of the DMD 37-38L.478 engineered meganuclease DMD37 binding subunit.
[0270] SEQ ID NO: 106 shows the amino acid sequence of the DMD 37-38L.512 engineered meganuclease DMD37 binding subunit.
[0271] SEQ ID NO: 107 shows the amino acid sequence of the DMD 37-38L.528 engineered meganuclease DMD37 binding subunit.
[0272] SEQ ID NO: 108 shows the amino acid sequence of the DMD 19-20x.13 engineered meganuclease DMD20 binding subunit.
[0273] SEQ ID NO: 109 shows the amino acid sequence of the DMD 19-20x.87 engineered meganuclease DMD20 binding subunit.
[0274] SEQ ID NO: 110 shows the amino acid sequence of the DMD 19-20L.249 engineered meganuclease DMD20 binding subunit.
[0275] SEQ ID NO: 111 shows the amino acid sequence of the DMD 19-20L.302 engineered meganuclease DMD20 binding subunit.
[0276] SEQ ID NO: 112 shows the amino acid sequence of the DMD 19-20L.329 engineered meganuclease DMD20 binding subunit.
[0277] SEQ ID NO: 113 shows the amino acid sequence of the DMD 19-20L.374 engineered meganuclease DMD20 binding subunit.
[0278] SEQ ID NO: 114 shows the amino acid sequence of the DMD 19-20L.375 engineered meganuclease DMD20 binding subunit.
[0279] SEQ ID NO: 115 shows the amino acid sequence of the DMD 19-20L.431 engineered meganuclease DMD20 binding subunit.
[0280] SEQ ID NO: 116 shows the amino acid sequence of the DMD 19-20L.458 engineered meganuclease DMD20 binding subunit.
[0281] SEQ ID NO: 117 shows the amino acid sequence of the DMD 35-36x.63 engineered meganuclease DMD36 binding subunit.
[0282] SEQ ID NO: 118 shows the amino acid sequence of the DMD 35-36x.81 engineered meganuclease DMD36 binding subunit.
[0283] SEQ ID NO: 119 shows the amino acid sequence of the DMD 35-36L.195 engineered meganuclease DMD36 binding subunit.
[0284] SEQ ID NO: 120 shows the amino acid sequence of the DMD 35-36L.282 engineered meganuclease DMD36 binding subunit.
[0285] SEQ ID NO: 121 shows the amino acid sequence of the DMD 35-36L.349 engineered meganuclease DMD36 binding subunit.
[0286] SEQ ID NO: 122 shows the amino acid sequence of the DMD 35-36L.376 engineered meganuclease DMD36 binding subunit.
[0287] SEQ ID NO: 123 shows the amino acid sequence of the DMD 35-36L.457 engineered meganuclease DMD36 binding subunit.
[0288] SEQ ID NO: 124 shows the amino acid sequence of the DMD 35-36L.469 engineered meganuclease DMD36 binding subunit.
[0289] SEQ ID NO: 125 shows the amino acid sequence of the DMD 37-38x.15 engineered meganuclease DMD38 binding subunit.
[0290] SEQ ID NO: 126 shows the amino acid sequence of the DMD 37-38x.66 engineered meganuclease DMD38 binding subunit.
[0291] SEQ ID NO: 127 shows the amino acid sequence of the DMD 37-38x.79 engineered meganuclease DMD38 binding subunit.
[0292] SEQ ID NO: 128 shows the amino acid sequence of the DMD 37-38L.166 engineered meganuclease DMD38 binding subunit.
[0293] SEQ ID NO: 129 shows the amino acid sequence of the DMD 37-38L.468 engineered meganuclease DMD38 binding subunit.
[0294] SEQ ID NO: 130 shows the amino acid sequence of the DMD 37-38L.512 engineered meganuclease DMD38 binding subunit.
[0295] SEQ ID NO: 131 shows the amino acid sequence of the DMD 37-38L.528 engineered meganuclease DMD38 binding subunit.
[0296] SEQ ID NO: 132 shows the amino acid sequence of the linker sequence.
[0297] SEQ ID NO: 133 shows the nucleic acid sequence of a probe used in a ddPCR assay for detecting INDELs at the DMD 19-20 recognition sequence.
[0298] SEQ ID NO: 134 shows the nucleic acid sequence of the forward PCR primer used in the ddPCR assay for detecting INDELs at the DMD 19-20 recognition sequence.
[0299] SEQ ID NO: 135 shows the nucleic acid sequence of the forward PCR primer used in the ddPCR assay for detecting INDELs at the DMD 19-20 recognition sequence.
[0300] SEQ ID NO: 136 shows the nucleic acid sequence of a probe used as a reference in a ddPCR assay for detecting INDELs.
[0301] SEQ ID NO: 137 shows the nucleic acid sequence of a forward PCR primer used as a reference in a ddPCR assay for detecting INDELs.
[0302] SEQ ID NO: 138 shows the nucleic acid sequence of a forward PCR primer used as a reference in a ddPCR assay for detecting INDELs.
[0303] SEQ ID NO: 139 shows the nucleic acid sequence of a probe used in a ddPCR assay for detecting INDELs at the DMD 37-38 recognition sequence.
[0304] SEQ ID NO: 140 shows the nucleic acid sequence of the forward PCR primer used in the ddPCR assay for detecting INDELs at the DMD 37-38 recognition sequence.
[0305] SEQ ID NO: 141 shows the nucleic acid sequence of the forward PCR primer used in the ddPCR assay for detecting INDELs at the DMD 37-38 recognition sequence.
[0306] SEQ ID NO: 142 shows the nucleic acid sequence of a probe used in a ddPCR assay for detecting INDELs at the DMD 35-36 recognition sequence.
[0307] SEQ ID NO: 143 shows the nucleic acid sequence of the forward PCR primer used in the ddPCR assay for detecting INDELs at the DMD 35-36 recognition sequence.
[0308] SEQ ID NO: 144 shows the nucleic acid sequence of the forward PCR primer used in the ddPCR assay for detecting INDELs at the DMD 35-36 recognition sequence.
[0309] SEQ ID NO: 145 shows the nucleic acid sequence of a probe used in a ddPCR assay for detecting INDELs at the DMD 29-30 recognition sequence.
[0310] SEQ ID NO: 146 shows the nucleic acid sequence of the forward PCR primer used in the ddPCR assay for detecting INDELs at the DMD 29-30 recognition sequence.
[0311] SEQ ID NO: 147 shows the nucleic acid sequence of the forward PCR primer used in the ddPCR assay for detecting INDELs at the DMD 29-30 recognition sequence.
[0312] SEQ ID NO: 148 shows the nucleic acid sequence of the forward PCR primer used in a PCR amplification assay for the recognition sequence for ligation of DMD 19-20 to DMD 35-36.
[0313] SEQ ID NO: 149 shows the nucleic acid sequence of the reverse PCR primer used in the PCR amplification assay for the recognition sequence for ligation of DMD 19-20 to DMD 35-36.
[0314] SEQ ID NO: 150 shows the nucleic acid sequence of the forward PCR primer used in a PCR amplification assay for the recognition sequence for ligation of DMD 19-20 to DMD 35-36.
[0315] SEQ ID NO: 151 shows the nucleic acid sequence of the reverse PCR primer used in the PCR amplification assay for the recognition sequence for ligation of DMD 19-20 to DMD 35-36.
[0316] SEQ ID NO: 152 shows the nucleic acid sequence of the forward PCR primer used in a PCR amplification assay for the recognition sequence for ligation of DMD 19-20 to DMD 29-30.
[0317] SEQ ID NO: 153 shows the nucleic acid sequence of the reverse PCR primer used in the PCR amplification assay for the recognition sequence for ligation of DMD 19-20 to DMD 29-30.
[0318] SEQ ID NO: 154 shows the nucleic acid sequence of the forward PCR primer used in a PCR amplification assay for the recognition sequence for ligation of DMD 19-20 to DMD 29-30.
[0319] SEQ ID NO: 155 shows the nucleic acid sequence of the reverse PCR primer used in a PCR amplification assay for the recognition sequence for ligation of DMD 19-20 to DMD 29-30.
[0320] SEQ ID NO: 156 shows the nucleic acid sequence of the forward PCR primer used in a PCR amplification assay for the recognition sequence for ligation of DMD 19-20 to DMD 37-38.
[0321] SEQ ID NO: 157 shows the nucleic acid sequence of the reverse PCR primer used in the PCR amplification assay for the recognition sequence for ligation of DMD 19-20 to DMD 37-38.
[0322] SEQ ID NO: 158 shows the nucleic acid sequence of the forward PCR primer used in a PCR amplification assay for the recognition sequence for ligation of DMD 19-20 to DMD 37-38.
[0323] SEQ ID NO: 159 shows the nucleic acid sequence of the reverse PCR primer used in the PCR amplification assay for the recognition sequence for ligation of DMD 19-20 to DMD 37-38.
[0324] SEQ ID NO: 160 shows the nucleic acid sequence of a probe used in a ddPCR assay for recognition sequences for ligation of DMD 19-20 to DMD 37-38.
[0325] SEQ ID NO: 161 shows the nucleic acid sequence of the forward PCR primer used in the ddPCR assay for the recognition sequence for ligation of DMD 19-20 to DMD 37-38.
[0326] SEQ ID NO: 162 shows the nucleic acid sequence of the reverse PCR primer used in the ddPCR assay for the recognition sequence for ligation of DMD 19-20 to DMD 37-38.
[0327] SEQ ID NO: 163 shows the nucleic acid sequence of a probe used in a ddPCR assay for the recognition sequence for ligation of DMD 19-20 to DMD 35-36.
[0328] SEQ ID NO: 164 shows the nucleic acid sequence of the forward PCR primer used in the ddPCR assay for the recognition sequence for ligation of DMD 19-20 to DMD 35-36.
[0329] SEQ ID NO: 165 shows the nucleic acid sequence of the reverse PCR primer used in the ddPCR assay for the recognition sequence for ligation of DMD 19-20 to DMD 35-36.
[0330] SEQ ID NO: 166 shows the nucleic acid sequence of a probe used in a ddPCR assay for the recognition sequence for ligation of DMD 19-20 to DMD 29-30.
[0331] SEQ ID NO: 167 shows the nucleic acid sequence of the forward PCR primer used in the ddPCR assay for the recognition sequence for ligation of DMD 19-20 to DMD 29-30.
[0332] SEQ ID NO: 168 shows the nucleic acid sequence of the reverse PCR primer used in the ddPCR assay for the recognition sequence for ligation of DMD 19-20 to DMD 29-30.
[0333] SEQ ID NO: 169 shows the nucleic acid sequence of the C5-12 promoter sequence.
[0334] SEQ ID NO: 170 shows the nucleic acid sequence of the mouse MCK promoter and enhancer sequence.
[0335] SEQ ID NO: 171 shows the nucleic acid sequence of human MCK promoter sequence.
[0336] SEQ ID NO: 172 shows the nucleic acid sequence of the wild-type MCK enhancer sequence.
[0337] SEQ ID NO: 173 shows the nucleic acid sequence of the modified MCK enhancer sequence.
[0338] SEQ ID NO: 174 shows the nucleic acid sequence of the spc 5-12 promoter sequence.
[0339] SEQ ID NO: 175 shows the nucleic acid sequence of the MHCK7 promoter sequence.
[0340] SEQ ID NO: 176 shows the nucleic acid sequence of the CK8 promoter sequence.
[0341] SEQ ID NO: 177 shows the nucleic acid sequence of the SK-CRM4 promoter sequence.
[0342] SEQ ID NO: 178 shows the nucleic acid sequence of the SP-301 promoter sequence.
[0343] SEQ ID NO: 179 shows the nucleic acid sequence of the SP-817 promoter sequence.
[0344] SEQ ID NO: 180 shows the nucleic acid sequence of the SP-905 promoter sequence.
[0345] SEQ ID NO: 181 shows the nucleic acid sequence of the muscle hybrid promoter sequence.
[0346] SEQ ID NO: 182 shows the amino acid sequence of the rh.74 AAV capsid.
[0347] SEQ ID NO: 183 shows the amino acid sequence of AAV9 capsid.
[0348] SEQ ID NO: 184 shows the nucleic acid sequence of the forward primer.
[0349] SEQ ID NO: 185 shows the nucleic acid sequence of the reverse primer.
[0350] SEQ ID NO: 186 shows the nucleic acid sequence of the probe.
[0351] SEQ ID NO: 187 shows the nucleic acid sequence of the forward primer.
[0352] SEQ ID NO: 188 shows the nucleic acid sequence of the reverse primer.
[0353] SEQ ID NO: 189 shows the nucleic acid sequence of the probe.
[0354] SEQ ID NO: 190 shows the nucleic acid sequence of the forward primer.
[0355] SEQ ID NO: 191 shows the nucleic acid sequence of the reverse primer.
[0356] SEQ ID NO: 192 shows the nucleic acid sequence of the probe.
[0357] SEQ ID NO: 193 shows the nucleic acid sequence of the reverse primer. DETAILED DESCRIPTION
[0358] 1.1 References and Definitions
[0359] The patents and scientific literature mentioned herein establish the knowledge available to those skilled in the art. The issued U.S. patents, issued applications, published foreign applications and references including GenBank database sequences cited herein are incorporated herein by reference to the same extent as if each was specifically and individually indicated to be incorporated by reference.
[0360] The present invention can be implemented in different forms and should not be interpreted as being limited to the embodiments listed herein. On the contrary, these embodiments are provided to make the present disclosure detailed and complete, and to fully convey the scope of the present invention to those skilled in the art. For example, features shown in relation to one embodiment may be incorporated into other embodiments, and features shown in relation to a particular embodiment may be deleted from the embodiment. In addition, according to the present disclosure, many changes and additions to the embodiments proposed herein will be apparent to those skilled in the art, without departing from the present invention.
[0361] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. The terms used in the description of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.
[0362] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.
[0363] As used herein, "a / an" or "the" may refer to one or more than one. For example, "a" cell may refer to a single cell or a plurality of cells.
[0364] As used herein, unless specifically indicated otherwise, the word "or" is used in the inclusive sense of "and / or" rather than the exclusive sense of "either / or."
[0365] As used herein, the terms "nuclease" and "endonuclease" are used interchangeably and refer to naturally occurring or engineered enzymes that cleave phosphodiester bonds within polynucleotide chains. Engineered nucleases may include, but are not limited to, engineered meganucleases, zinc finger nucleases, TALENs, compact TALENs, CRISPR system nucleases, and meganucleases. In addition, any engineered nuclease that is capable of generating an overhang at its cleavage site is contemplated.
[0366] As used herein, the term "cleavage" or "cleavage" refers to the hydrolysis of phosphodiester bonds within the backbone of a recognition sequence within a target sequence, resulting in a double-stranded break within the target sequence, referred to herein as a "cleavage site."
[0367] As used herein, the term "meganuclease" refers to an endonuclease that binds to double-stranded DNA at a recognition sequence greater than 12 base pairs. In some embodiments, the recognition sequence for the meganuclease of the present disclosure is 22 base pairs. A meganuclease can be an endonuclease derived from I-Crel (SEQ ID NO: 1), and can refer to an engineered variant of I-Crel that has been modified in, for example, DNA binding specificity, DNA cleavage activity, DNA binding affinity, or dimerization properties relative to native I-Crel. Methods for producing such modified I-Crel variants are known in the art (e.g., WO2007 / 047859, incorporated by reference as a whole). As used herein, a meganuclease binds to double-stranded DNA as a heterodimer. A meganuclease can also be a "single-chain meganuclease" in which a pair of DNA binding domains are connected to a single polypeptide using a peptide linker. The term "homing endonuclease" is synonymous with the term "meganuclease". When expressed in the target cells described herein, the meganucleases of the present disclosure are substantially non-toxic, such that cells can be transfected and maintained at 37°C without observing deleterious effects on cell viability or significant reduction in meganuclease cleavage activity (when measured using the methods described herein).
[0368] As used herein, the term "single-chain meganuclease" refers to a polypeptide comprising a pair of nuclease subunits connected by a linker. Single-chain meganucleases have the following organizational structure: N-terminal subunit-linker-C-terminal subunit. The two meganucleases subunits are usually different in amino acid sequence and will bind to different DNA sequences. Therefore, single-chain meganucleases usually cut pseudo-palindromic or non-palindromic recognition sequences. Single-chain meganucleases can be referred to as "single-chain heterodimers" or "single-chain heterodimeric meganucleases", despite the fact that they are not dimeric. For clarity, unless otherwise indicated, the term "meganuclease" may refer to a dimer or a single-chain meganuclease.
[0369] As used herein, the term "joint" refers to an exogenous peptide sequence used to connect two nuclease subunits into a single polypeptide. The joint may have a sequence found in a natural protein, or may be an artificial sequence not found in any natural protein. The joint may be flexible and lack a secondary structure, or may have a tendency to form a specific three-dimensional structure under physiological conditions. The joint may include, but is not limited to, those covered by U.S. Patent Nos. 8,445,251, 9,340,777, 9,434,931, and 10,041,053, each of which is incorporated by reference in its entirety. In some embodiments, the linker can have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 132, which sets forth residues 154-195 of any one of SEQ ID NOs: 36-59.
[0370] As used herein, with respect to proteins, the term "recombinant" or "engineered" refers to having an altered amino acid sequence as a result of applying genetic engineering techniques to nucleic acids encoding the protein and cells or organisms expressing the protein. With respect to nucleic acids, the term "recombinant" or "engineered" refers to having an altered nucleic acid sequence as a result of applying genetic engineering techniques. Genetic engineering techniques include, but are not limited to, PCR and DNA cloning techniques; transfection, transformation, and other gene transfer techniques; homologous recombination; site-directed mutagenesis; and gene fusion. According to this definition, a protein having the same amino acid sequence as a naturally occurring protein but produced by cloning and expression in a heterologous host is not considered to be recombinant or engineered.
[0371] As used herein, the term "wild type" refers to the most common naturally occurring allele (i.e., polynucleotide sequence) in the allele population of the same type of gene, wherein the polypeptide encoded by the wild-type allele has its original function. The term "wild type" also refers to a polypeptide encoded by a wild-type allele. Wild-type alleles (i.e., polynucleotides) and polypeptides are distinguishable from mutants or variant alleles and polypeptides, which comprise one or more mutations and / or substitutions relative to the wild-type sequence. In view of the fact that wild-type alleles or polypeptides can confer normal phenotypes on an organism, in some cases, mutants or variant alleles or polypeptides can confer a changed phenotype. Wild-type nucleases are distinguishable from recombinant or non-naturally occurring nucleases. The term "wild type" can also refer to cells, organisms, and / or subjects with wild-type alleles of a particular gene, or cells, organisms, and / or subjects for comparison purposes.
[0372] As used herein, the term "genetically modified" refers to a cell or organism in which or in its ancestors the genomic DNA sequence has been intentionally modified by recombinant technology. As used herein, the term "genetically modified" encompasses the term "transgenic".
[0373] As used herein, with respect to recombinant proteins, the term "modification" refers to any insertion, deletion or substitution of amino acid residues in the recombinant sequence relative to a reference sequence (eg, a wild-type or native sequence).
[0374] As used herein, the term "recognition sequence" or "recognition site" refers to a DNA sequence that is bound and cleaved by a nuclease. In the case of a meganuclease, the recognition sequence comprises a pair of inverted 9 base pair "half sites" separated by 4 base pairs. In the case of a single-chain meganuclease, the N-terminal domain of the protein contacts the first half site and the C-terminal domain of the protein contacts the second half site. A four base pair 3' "overhang" is produced by meganuclease cleavage. "Overhangs" or "sticky ends" are short single-stranded DNA fragments that can be produced by endonuclease cleavage of a double-stranded DNA sequence. In the case of the meganuclease and single-chain meganuclease derived from I-Crel, the overhang comprises bases 10-13 of the 22 base pair recognition sequence.
[0375] As used herein, the term "target site" or "target sequence" refers to a region of cellular chromosomal DNA that contains a nuclease recognition sequence.
[0376] As used herein, the term "DNA binding affinity" or "binding affinity" refers to the propensity of a meganuclease to non-covalently associate with a reference DNA molecule (e.g., a recognition sequence or an arbitrary sequence). Binding affinity is measured by the dissociation constant, Kd. As used herein, a nuclease has an "altered" binding affinity if its Kd for a reference recognition sequence is increased or decreased by a statistically significant percentage change relative to the reference nuclease.
[0377] As used herein, the term "specificity" refers to the ability of a nuclease to recognize and cut a double-stranded DNA molecule only at a specific base pair sequence called a recognition sequence or only at a set of specific recognition sequences. The set of recognition sequences will share certain conserved positions or sequence motifs, but may be degenerate at one or more positions. Highly specific nucleases are able to cut only one or very few recognition sequences. Specificity can be determined by any method known in the art.
[0378] As used herein, the term "dystrophin gene" refers to a gene associated with the National Center for Biotechnology Information (NCBI) gene ID 1756 and its naturally occurring variants. The term "dystrophin" refers to a polypeptide encoded by a dystrophin gene. The dystrophin subtype expressed in muscle cells and muscle precursor cells is called the Dp427m dystrophin variant. The amino acid sequence of the full-length wild-type Dp427m dystrophin polypeptide is shown in SEQ ID NO:4. NCBI reference numbers NM_004006.3 and NP_003997.2 show dystrophin Dp427m mRNA and polypeptide, respectively. In some embodiments described herein, a pair of engineered meganucleases are used to edit the dystrophin gene, resulting in the excision of dystrophin gene exons 45-55 and subsequent perfect connection. Removing exons 45-55 from the wild-type dystrophin gene can produce a dystrophin polypeptide comprising an amino acid sequence as shown in SEQ ID NO:5.
[0379] As used herein, the term "perfect connection" refers to that after being cut by the engineered meganuclease of the present invention, all four bases of the 3' overhang of the first cleavage site in the dystrophin gene are connected (i.e., annealed) with all four bases of the complementary 3' overhang of the second cleavage site. The recognition sequence targeted by the disclosed engineered meganuclease has the same four base pair central sequence (e.g., GTAT) so that the first and second cleavage sites will have complementary four base pairs of 3' overhangs. Therefore, each base pair of the first 3' overhang is paired with its complementary base pair on the second 3' overhang, and the connection occurs by DNA ligase. Examples of sequences produced by this perfect connection are shown in SEQ ID NO:32 (i.e., perfect connection of DMD 19-20 and DMD 35-36 recognition sequences) and SEQ ID NO:34 (i.e., perfect connection of DMD 19-20 and DMD37-38 recognition sequences).
[0380] As used herein, the term "Becker muscular dystrophy phenotype" refers to a less severe form of muscular dystrophy than DMD. Individuals with Becker muscular dystrophy still contain a mutation in the dystrophin gene, but express more functional dystrophin in muscle cells (e.g., muscle precursor cells, skeletal muscle cells, and cardiomyocytes) than individuals with DMD, generally resulting in a better clinical prognosis.
[0381] As used herein, the term "homologous recombination" or "HR" refers to a natural cellular process in which double-stranded DNA breaks are repaired using homologous DNA sequences as repair templates (see, e.g., Cahill et al., (2006) Front. Biosci. 11: 1958-76). The homologous DNA sequence can be an endogenous chromosomal sequence or an exogenous nucleic acid delivered to the cell.
[0382] As used herein, the term "non-homologous end joining" or "NHEJ" refers to a natural cellular process in which double-stranded DNA breaks are repaired by directly joining two non-homologous DNA fragments (see, e.g., Cahill et al., (2006)). DNA repair by non-homologous end joining is error-prone and often results in non-templated additions or deletions of DNA sequences at the repair site. In some cases, cleavage at the target recognition sequence results in NHEJ at the target recognition site. Nuclease-induced cleavage of a target site in a gene coding sequence followed by DNA repair by NHEJ can introduce mutations that disrupt gene function, such as frameshift mutations, into the coding sequence. Therefore, engineered meganucleases can be used to effectively knock out genes in a cell population.
[0383] As used herein, the term "homology arms" or "sequences homologous to sequences flanking a meganuclease cleavage site" refers to sequences flanking the 5' and 3' ends of a nucleic acid molecule that facilitate insertion of the nucleic acid molecule into the cleavage site produced by a meganuclease. In general, the length of a homology arm can be at least 50 base pairs, preferably at least 100 base pairs, and up to 2000 base pairs or more, and can have at least 90%, preferably at least 95% or more sequence homology with its corresponding sequence in the genome. In some embodiments, the homology arm is about 500 base pairs.
[0384] As used herein with respect to both amino acid sequences and nucleic acid sequences, the terms "percent identity," "sequence identity," "percent similarity," "sequence similarity," and the like refer to a measure of the degree of similarity of two sequences based on a sequence alignment that maximizes the similarity between the compared amino acid residues or nucleotides, and which varies with the number of identical or similar residues or nucleotides, the total number of residues or nucleotides, and the presence and length of gaps in the sequence alignment. A variety of algorithms and computer programs can be used to determine sequence similarity using standard parameters. As used herein, sequence similarity is measured using the BLASTp program for amino acid sequences and the BLASTn program for nucleic acid sequences, both of which are available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ) and described, for example, in Altschul et al., (1990) J. Mol. Biol. 215:403-10; Gish & States (1993) Nature Genet. 3:266-72; Madden et al., (1996) Meth. Enzymol. 266:131-41; Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402; and Zhang et al., (2000) J. Comput. Biol. 7:203-14. As used herein, the percentage similarity of two amino acid sequences is a score based on the following parameters of the BLASTp algorithm: word length=3; gap gap penalty=-11; gap extension penalty=-1; and scoring matrix=BLOSUM62. As used herein, the percentage similarity of two nucleic acid sequences is a score based on the following parameters of the BLASTn algorithm: word length=11; gap gap penalty=-5; gap extension penalty=-2; match reward=1; and mismatch penalty=-3.
[0385] As used herein with respect to modifications of two proteins or amino acid sequences, the term "corresponding to" is used to indicate that the specified modification in the first protein is a replacement of the same amino acid residue as in the modification of the second protein, and that when the two proteins are subjected to a standard sequence alignment (e.g., using the BLASTp program), the modified amino acid position in the first protein corresponds or aligns with the modified amino acid position in the second protein. Thus, if residues X and Y correspond to each other in the sequence alignment, a modification of residue "X" to amino acid "A" in the first protein will correspond to a modification of residue "Y" to amino acid "A" in the second protein, even though X and Y may be numbered differently.
[0386] As used herein, the term "recognition half-site", "recognition sequence half-site" or simply "half-site" refers to a nucleic acid sequence in a double-stranded DNA molecule that is recognized and bound by a monomer of a homodimeric or heterodimeric meganuclease or a subunit of a single-chain meganuclease or a subunit of a single-chain meganuclease.
[0387] As used herein, the term "hypervariable region" refers to a local sequence within a meganuclease monomer or subunit that includes amino acids with relatively high variability. The hypervariable region may include about 50-60 continuous residues, about 53-57 continuous residues, or preferably about 56 residues. In some embodiments, the residues in the hypervariable region may correspond to positions 24-79 or positions 215-270 of any one of SEQ ID NO:36-59. The hypervariable region may include one or more residues that contact the DNA bases in the recognition sequence, and may be modified to change the base preference of a monomer or subunit. When the meganuclease is combined with a double-stranded DNA recognition sequence, the hypervariable region may also include one or more residues that are combined with the DNA backbone. These residues may be modified to change the binding affinity of the meganuclease to the DNA backbone and the target recognition sequence. In different embodiments of the present invention, the hypervariable region may include 1-20 residues that exhibit variability and may be modified to affect base preference and / or DNA binding affinity. In a specific embodiment, the hypervariable region comprises about 15-20 residues that exhibit variability and can be modified to affect base preference and / or DNA binding affinity. In some embodiments, the variable residues within the hypervariable region correspond to one or more of positions 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 36-59. In certain embodiments, the variable residues within the hypervariable region may also correspond to residues 48, 50, and 71-73 of any one of SEQ ID NOs: 36-59. In other embodiments, the variable residues within the hypervariable region correspond to one or more of positions 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 239, 241, 259, 261, 262, 263, 264, 266, and 268 of one or more of SEQ ID NOs: 36-59. In certain embodiments, the variable residues within the hypervariable region may also correspond to residues 239, 241, and 263-265 of any one of SEQ ID NOs: 36-59.
[0388] In the context of dystrophin or mRNA levels, the term "increase" refers to any increase in the expression level of dystrophin or mRNA relative to a reference level when compared to a reference level or control, including an increase in the expression of dystrophin or mRNA by at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100% or more. In some embodiments, an increase in dystrophin or mRNA levels refers to an increase in shortened dystrophin polypeptides or mRNA transcripts compared to a wild-type dystrophin polypeptide or gene, for example, a portion of a polypeptide encoded by at least one exon is deleted (e.g., a portion encoded by exons 45-55) or a portion of an mRNA corresponding to exons 45-55 is deleted.
[0389] As used herein, the term "reference level" in the context of dystrophin or mRNA levels refers to the level of dystrophin or mRNA measured at a previous time point in, for example, a control cell, a control cell population, or a control subject, a control cell population, or a subject being treated (e.g., a pre-dose baseline level obtained from a control cell, a control cell population, or a subject), or a predefined threshold level of dystrophin or mRNA (e.g., a threshold level identified by previous experiments).
[0390] As used herein, "control" or "control cell" refers to a cell that provides a reference point for determining changes in the genotype or phenotype of a genetically modified cell. Control cells can include, for example: (a) wild-type cells, i.e., cells with the same genotype as the starting material for the genetic alteration used to produce the genetically modified cell; (b) cells with the same genotype as the genetically modified cell but transformed with an invalid construct (i.e., a construct with no known effect on the target trait); or (c) cells that are genetically identical to the genetically modified cell but are not exposed to conditions or stimuli or further genetic modifications that will induce the expression of the altered genotype or phenotype. Control subjects can include, for example: wild-type subjects, i.e., subjects with the same genotype as the initial subject of the genetic alteration that led to the genetically modified subject (e.g., subjects with the same mutation in the dystrophin gene), who are not exposed to conditions or stimuli or further genetic modifications that will induce the expression of the altered genotype or phenotype in the subject.
[0391] As used herein, the terms "recombinant DNA construct", "recombinant construct", "expression cassette", "cassette", "expression construct", "chimeric construct", "construct" and "recombinant DNA fragment" are used interchangeably herein and are single-stranded or double-stranded polynucleotides. Recombinant constructs comprise artificial combinations of nucleic acid fragments, including but not limited to regulatory sequences and coding sequences that are not found together in nature. For example, a recombinant DNA construct may comprise regulatory sequences and coding sequences derived from different sources, or regulatory sequences and coding sequences derived from the same source and arranged in a manner different from that found in nature. Such constructs may be used alone or in combination with a vector.
[0392] As used herein, a "vector" or "recombinant DNA vector" may be a construct comprising a replication system and a sequence capable of transcribing and translating a polypeptide coding sequence in a given host cell. If a vector is used, the choice of the vector depends on the method for transforming the host cell well known to those skilled in the art. The vector may include, but is not limited to, a plasmid vector and a recombinant AAV vector, or any other vector known in the art suitable for delivering a gene to a target cell. Those skilled in the art are familiar with the genetic elements that must be present on the vector to successfully transform, select, and amplify host cells containing any isolated nucleotides or nucleic acid sequences of the present invention. In some embodiments, a "vector" also refers to a viral vector. Viral vectors may include, but are not limited to, retroviral vectors, lentiviral vectors, adenoviral vectors, and AAV.
[0393] As used herein, the term "operably connected" is intended to represent a functional connection between two or more elements. For example, an operable connection between a nucleic acid sequence encoding a nuclease described herein and a regulatory sequence (e.g., a promoter) is a functional connection that allows the nucleic acid sequence encoding the nuclease to be expressed. Operably connected elements can be continuous or non-continuous. When used to refer to the connection of two protein coding regions, operably connected refers to the coding regions being in the same reading frame.
[0394] As used herein, the term "treatment" or "treatment of a subject" refers to administering an engineered meganuclease as described herein, or a polynucleotide encoding an engineered meganuclease as described herein, or a pair of such engineered meganucleases or polynucleotides to a subject suffering from DMD to increase the level of dystrophin in the subject. In some embodiments, expression of a shortened form of dystrophin (e.g., lacking amino acids encoded by multiple exons) is increased. In some embodiments, expression of a form of dystrophin lacking amino acids encoded by exons 45-55 is increased. In some embodiments, this treatment converts the DMD phenotype to a Becker muscular dystrophy phenotype.
[0395] As used herein, the term "gc / kg" or "gene copies / kilogram" refers to the number of copies of a nucleic acid encoding an engineered meganuclease described herein per kilogram of body weight of a subject to which the nucleic acid encoding the engineered meganuclease is administered.
[0396] As used herein, the term "effective amount" or "therapeutically effective amount" refers to an amount sufficient to achieve a beneficial or desired biological and / or clinical outcome. The therapeutically effective amount will vary depending on the formulation or composition used, the disease and its severity, and the age, weight, physical condition, and responsiveness of the subject to be treated. In a specific embodiment, an effective amount of an engineered meganuclease or a pair of engineered meganucleases described herein, or a polynucleotide or a pair of polynucleotides encoding the same, or a pharmaceutical composition disclosed herein, increases the expression level of dystrophin (e.g., a shortened dystrophin lacking the amino acids encoded by exons 45-55) and improves at least one symptom associated with DMD.
[0397] As used herein, the term "lipid nanoparticle" refers to a lipid composition having a typical spherical structure with a mean diameter of 10-1000 nanometers. In some preparations, the lipid nanoparticle may include at least one cationic lipid, at least one non-cationic lipid and at least one conjugated lipid. Lipid nanoparticles suitable for encapsulating nucleic acids (such as mRNA) known in the art are contemplated for use in the present invention.
[0398] As used herein, the description of the numerical range of a variable is intended to convey that the disclosure can be practiced with a variable equal to any value within the range. Therefore, for an inherently discrete variable, the variable can be equal to any integer value within the numerical range, including the endpoints of the range. Similarly, for an inherently continuous variable, the variable can be equal to any real value within the numerical range, including the endpoints of the range. As an example and not a limitation, if the variable is inherently discrete, the variable described as having a value between 0 and 2 can take on the value 0, 1, or 2, and if the variable is inherently continuous, it can take on the value 0.0, 0.1, 0.01, 0.001, or any other real value of ≥0 and ≤2.
[0399] 2.1 Principle of the invention
[0400] The present disclosure is based in part on the hypothesis that certain deletions in the dystrophin gene that cause the DMD phenotype can be compensated by using endonucleases to strategically delete exons of the dystrophin gene to restore the normal reading frame within the gene. The DMD-Leiden database shows that most mutations that cause DMD are deletions of one or more complete exons, resulting in a shift in the reading frame. In many cases, the reading frame can be restored by eliminating exons immediately before or after the mutation. As shown in Table 3, 29 different Duchenne-causing mutations account for approximately 65% of patients and can be compensated by deleting a single exon near the mutation.
[0401] Table 3:
[0402]
[0403] For example, a patient with a disease due to deletion of exon 45 (occurring in about 7% of patients) could be treated with a therapeutic that deletes exon 46. A therapeutic that deletes exon 51 or exon 45 could be used to treat 15% and 13% of patients, respectively.
[0404] It is noteworthy that more than 50% of DMD-associated mutations within the dystrophin gene are contained in exons 45 to 55. Therefore, in a specific embodiment of the present invention, exons 45 to 55 of the dystrophin gene will be removed to restore the normal reading frame of the gene. As disclosed herein, exon removal is achieved by expressing a pair of engineered meganucleases in muscle cells or muscle precursor cells (e.g., cardiomyocytes or skeletal muscle cells) that produce a pair of cleavage sites in introns upstream of exon 45 and downstream of exon 55, thereby allowing the excision of the genomic region during. According to this method, genetically modified cells (e.g., muscle cells in a treated subject) will be able to produce a certain amount of shortened dystrophin from a Becker-type phenotype, which is similar to the micro-dystrophin approach without having to express a micro-dystrophin transgene. This shortened dystrophin may be sufficient to permanently rescue the disease, unlike other therapies that require multiple consecutive treatment regimens.
[0405] Thus, it is conceivable that a single treatment would permanently delete the exon from a certain percentage of a subject's cells. In some embodiments, these cells would be myoblasts (i.e., muscle cells) or other muscle precursor cells that are capable of replicating and producing full muscle fibers that express functional (or semi-functional) dystrophin. However, if the frequency of exon deletions is low, multiple treatments per patient would be necessary.
[0406] 2.2 Meganucleases that bind and cleave recognition sequences within the dystrophin gene Identification sequence
[0407] It is well known in the art that site-specific nucleases can be used to perform DNA breaks in the genome of living cells, and such DNA breaks can be repaired by mutagenic NHEJ or lead to permanent modification of the genome by homologous recombination with transgenic DNA sequences. NHEJ can produce mutations at the cleavage site, resulting in inactivation of alleles. NHEJ-related mutations may inactivate alleles by generating early stop codons, frameshift mutations that produce abnormal non-functional proteins, or may trigger mechanisms such as meaningless mediated mRNA decay. Inducing mutations using nucleases through NHEJ can be used to target specific mutations or sequences present in wild-type alleles. In addition, it is known that the use of nucleases to induce double-strand breaks in the target locus will stimulate homologous recombination, particularly homologous recombination of transgenic DNA sequences flanked by homologous sequences to genomic targets. In this way, exogenous polynucleotides can be inserted into the target locus. Such exogenous polynucleotides can encode any sequence or polypeptide of interest.
[0408] In a particular embodiment, the engineered meganucleases of the invention can be designed to bind and cut DMD19-20 recognition sequences (SEQ ID NO:6), DMD 35-36 recognition sequences (SEQ ID NO:10), or DMD 37-38 recognition sequences (SEQ ID NO:12). Exemplary meganucleases that bind and cut DMD 19-20 recognition sequences are provided in SEQ ID NO:36-44. Exemplary meganucleases that bind and cut DMD 35-36 recognition sequences are provided in SEQ ID NO:45-52. Exemplary meganucleases that bind and cut DMD 37-38 recognition sequences are provided in SEQ ID NO:53-59. The sequence of each recognition sequence is provided in Table 4 below, as well as the four base pair 3' overhangs that are generated when cut by the engineered meganucleases described herein.
[0409] Table 4: Engineered meganuclease recognition sequences
[0410] Identification sequence SEQ ID NO: 4 bp 3' overhang AAGGATTATGTATTACCTCCCG 6 GTAT TAAGATTGGGTATGAGGGATAG 8 GTAT CTACATGGTGTATCTGACTAAG 10 GTAT CTGGCCGAAGTATAGGAATATG 12 GTAT
[0411] In order to modify the dystrophin gene according to the present disclosure, a pair of engineered meganucleases as described herein are used together in the same cell. This engineered meganuclease pair is designed to produce a first cleavage site in the intron upstream of exon 45 and a second cleavage site in the intron downstream of exon 55 so as to remove the genomic sequence during. Surprisingly, it was observed that the excision of this genomic region from a dystrophin gene greater than 500,000 bp in size can be completed efficiently. In addition, a meganuclease recognition sequence with complementary four base pairs of 3' overhangs after cutting was selected, and it was observed that the dystrophin gene can be repaired with high frequency by perfect connection of the 3' overhangs of the two cleavage sites. This perfect connection recognition sequence involved in this article is provided in Table 5 below.
[0412] Table 5: Ligation recognition sequences
[0413]
[0414] These recognition sequences were further selected to be within intronic sequences that are normally spliced out during post-transcriptional modification of the cell. This reduces the likelihood of mutations being introduced into the dystrophin gene and the encoded polypeptide.
[0415] Exemplary Engineered Meganucleases
[0416] The engineered meganuclease of the present invention comprises a first subunit containing an HVR1 region and a second subunit containing an HVR2 region. In addition, the first subunit binds to a first recognition half site (e.g., a DMD19 half site) in a recognition sequence, and the second subunit binds to a second recognition half site (e.g., a DMD20 half site) in a recognition sequence.
[0417] In a specific embodiment, the meganuclease used to implement the present invention is a single-chain meganuclease. The single-chain meganuclease comprises an N-terminal subunit and a C-terminal subunit (i.e., the first and second subunits discussed above) connected by a linker peptide. Each of the two subunits recognizes and binds to the half-site of the recognition sequence, and the DNA cleavage site is located in the middle of the recognition sequence, near the interface of the two subunits. As discussed, the DNA strand break is offset by four base pairs, so that the DNA is cut by the meganuclease to produce four base 3' single-stranded overhang pairs.
[0418] In embodiments where the engineered meganuclease is a single-chain meganuclease, the first and second subunits may be oriented such that the first subunit comprising the HVR1 region and binding the first half site is positioned as the N-terminal subunit, and the second subunit comprising the HVR2 region and binding the second half site is positioned as the C-terminal subunit. In alternative embodiments, the first and second subunits may be oriented such that the first subunit comprising the HVR1 region and binding the first half site is positioned as the C-terminal subunit, and the second subunit comprising the HVR2 region and binding the second half site is positioned as the N-terminal subunit.
[0419] Exemplary DMD meganucleases of the invention are provided in SEQ ID NOs: 36-59 and summarized in Tables 6-8.
[0420] Table 6: Exemplary engineered meganucleases that bind and cleave the DMD 19-20 recognition sequence (SEQ ID NO: 6)
[0421]
[0422] "DMD19 Subunit %" and "DMD 20 Subunit %" indicate the amino acid sequence identity between the DMD19-binding and DMD20-binding subunit regions of each meganuclease and the DMD19-binding and DMD22-binding subunit regions of the DMD19-20x.13 meganuclease, respectively.
[0423] Table 7: Exemplary engineered meganucleases that bind and cleave the DMD 35-36 recognition sequence (SEQ ID NO: 10)
[0424]
[0425] "DMD35 Subunit %" and "DMD36 Subunit %" indicate the amino acid sequence identity between the DMD35-binding and DMD36-binding subunit regions of each meganuclease and the DMD35-binding and DMD36-binding subunit regions of the DMD 35-36x.63 meganuclease, respectively.
[0426] Table 8: Exemplary engineered meganucleases that bind and cleave the DMD 37-38 recognition sequence (SEQ ID NO: 12)
[0427]
[0428] "DMD37 Subunit %" and "DMD38 Subunit %" indicate the amino acid sequence identity between the DMD37-binding and DMD38-binding subunit regions of each meganuclease and the DMD37-binding and DMD38-binding subunit regions of the DMD 37-38x.15 meganuclease, respectively.
[0429] In certain embodiments of the invention, the engineered meganuclease binds and cleaves a recognition sequence comprising SEQ ID NO:6 within the dystrophin gene (i.e., a DMD 19-20 recognition sequence), wherein the engineered meganuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises an HVR1 region, and wherein the second subunit binds to a second recognition half-site of the recognition sequence and comprises an HVR2 region. An exemplary DMD 19-20 meganuclease is shown below.
[0430] DMD 19-20x.13 (SEQ ID NO: 36)
[0431] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 36. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 36. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 36. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 36. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 36 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 36.
[0432] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 36. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 36. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 36. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 36. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:36 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:36.
[0433] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 36. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 36 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:36.
[0434] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 36. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 36. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 36. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 36. In some embodiments, the second subunit comprises a residue corresponding to residue 220 of SEQ ID NO: 36. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:36 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:36.
[0435] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to SEQ ID NO:36. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:36. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to the nucleic acid sequence shown in SEQ ID NO:50. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:50.
[0436] DMD 19-20x.87 (SEQ ID NO: 37)
[0437] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 37. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 37. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 37. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 37. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 37 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 37.
[0438] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 37. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 37. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 37. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 37. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:37 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:37.
[0439] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 37. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 37 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:37.
[0440] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 37. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 37. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 37. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 37. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 37 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 37.
[0441] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:37. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:37. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:51. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:51.
[0442] DMD 19-20L.249 (SEQ ID NO: 38)
[0443] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 38. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 38. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 38. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 38. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 38 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 38.
[0444] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 38. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 38. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 38. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 38. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 38. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:38 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:38.
[0445] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 38. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 38. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 38. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 38. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 38. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 38 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 38.
[0446] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 38. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 38. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 38. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 38. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 38 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 38.
[0447] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to SEQ ID NO:38. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:38. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to the nucleic acid sequence shown in SEQ ID NO:52. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:52.
[0448] DMD 19-20L.302 (SEQ ID NO: 39)
[0449] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 39. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 39. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 39. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 39. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 39 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 39.
[0450] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:39. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:39. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:39. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 39 of SEQ ID NO:39. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:39. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:39 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:39.
[0451] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises a residue corresponding to residue 236 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 39. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 39 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 39.
[0452] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 39. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 39. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 39. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 39. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 39 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 39.
[0453] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:39. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:39. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:53. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:53.
[0454] DMD 19-20L.329 (SEQ ID NO: 40)
[0455] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 40. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 40. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 40. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 40. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 40 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 40.
[0456] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 40. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 40. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 40. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 40. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:40 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:40.
[0457] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to amino acid residues corresponding to residues 215-270 of SEQ ID NO: 40. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 40. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 40. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 40. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 40. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 40 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 40.
[0458] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:40. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO:40. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO:40. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO:40. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:40. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 40 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 40.
[0459] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 40. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 40. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO: 54. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO: 54.
[0460] DMD 19-20L.374 (SEQ ID NO: 41)
[0461] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 41. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 41. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 41. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 40. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 41 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 41.
[0462] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 41. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 41. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 41. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 41. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:41 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:41.
[0463] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 41. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 41. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 41. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 41. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 41. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 41 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 41.
[0464] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 41. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 41. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 41. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 41. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 41 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 41.
[0465] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to SEQ ID NO:41. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:41. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to the nucleic acid sequence shown in SEQ ID NO:65. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:65.
[0466] DMD 19-20L.375 (SEQ ID NO: 42)
[0467] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 42. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 42. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 42. In some embodiments, the HVR1 region comprises a Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 42. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:42 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:42.
[0468] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 42. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 42. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 42. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 42. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 42 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 42.
[0469] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 42. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 42. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 42. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 42. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 42. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 42 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 42.
[0470] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 42. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 42. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 42. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 42. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 42 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 42.
[0471] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:42. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:42. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:66. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:66.
[0472] DMD 19-20L.431 (SEQ ID NO:43)
[0473] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 43. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 43. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 43. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 43. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 43 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 43.
[0474] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 43. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 43. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 43. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 43. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 43. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 43 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 43.
[0475] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 43. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 43. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 43. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 43. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 43. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 43 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 43.
[0476] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 43. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 43. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 43. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 43. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 43. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 43 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 43.
[0477] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:43. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:43. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:67. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:67.
[0478] DMD 19-20L.458 (SEQ ID NO: 44)
[0479] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 44. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 44. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 44. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 44. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 44.
[0480] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 44. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 44. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 44. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 44. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 44.
[0481] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 44. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 44. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 44. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 44. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 44. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 44 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 44.
[0482] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 44. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 44. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 44. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 44. In some embodiments, the second subunit comprises a residue corresponding to residue 220 of SEQ ID NO: 44. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 44 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 44.
[0483] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to SEQ ID NO:44. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:44. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity to the nucleic acid sequence shown in SEQ ID NO:68. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence shown in SEQ ID NO:68.
[0484] In certain embodiments of the invention, the engineered meganuclease binds and cleaves a recognition sequence comprising SEQ ID NO: 10 within the dystrophin gene (i.e., a DMD 35-36 recognition sequence), wherein the engineered meganuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and wherein the second subunit assembles to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region. An exemplary DMD 35-36 meganuclease is shown below.
[0485] DMD 35-36x.63 (SEQ ID NO:45)
[0486] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 45. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 45. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 45. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 45. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 45 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 45.
[0487] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:45. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:45. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:45. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO:45. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:45. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 45 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 45.
[0488] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 45. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises a residue corresponding to residue 250 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:45. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:45 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:45. In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with residues 198-344 of SEQ ID NO:45. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO:45. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO:45. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:45.In some embodiments, the second subunit comprises residues 98-344 of SEQ ID NO: 45 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 45.
[0489] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 45. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 45. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO: 69. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO: 69.
[0490] DMD 35-36x.81 (SEQ ID NO:46)
[0491] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence of residues 24-79 of SEQ ID NO: 46. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 46. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 46. In some embodiments, the HVR1 region comprises a Y, R, K, or D at a residue corresponding to residue 66 of SEQ ID NO: 46. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:46 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:46.
[0492] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153a of SEQ ID NO:46. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:46. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:46. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO:46. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:46. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 46 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 46.
[0493] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 46. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 46. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:46. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO:46. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO:46. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:46. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:46. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:46. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:46 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:46.
[0494] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 46. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 46. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 46. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 46. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 46 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 46.
[0495] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:46. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:46. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:70. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:70.
[0496] DMD 35-36L.195 (SEQ ID NO: 47)
[0497] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 47. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 47. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 47. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 47. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 47 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 47.
[0498] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 47. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 47. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 47. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 47. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 47. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 47 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 47.
[0499] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 47. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 47 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:47.
[0500] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 47. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 47. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 47. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 47. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 47 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 47.
[0501] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 47. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 47. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO: 71. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO: 71.
[0502] DMD 35-36L.282 (SEQ ID NO: 48)
[0503] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 48. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 48. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 48. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 48. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 48 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 48.
[0504] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 48. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 48. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 48. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 48. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO: 48. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 48 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 48.
[0505] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 48. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 48. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 48. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 48. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 48. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 48. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 48. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 48 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:48.
[0506] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 48. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 48. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 48. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 48. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 48 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 48.
[0507] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 48. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 48. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO: 72. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence shown in SEQ ID NO: 72. DMD 35-36L.349 (SEQ ID NO: 49)
[0508] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 49. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 49. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 49. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 49. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 49 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 49.
[0509] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:49. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:49. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:49. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO:49. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:49. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 49 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 49.
[0510] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 49. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 49 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:49.
[0511] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 49. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 49. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 49. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 49. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 49 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 49.
[0512] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 49. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO: 49. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO: 73. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO: 73.
[0513] DMD 35-36L.376 (SEQ ID NO: 50)
[0514] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 50. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 50. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 50. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO:50. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:50 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:50.
[0515] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:50. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:50. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:50. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO:50. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:50. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:50 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:50.
[0516] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 50. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 50. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:50. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO:50. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO:50. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:50. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:50. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:50 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:50.
[0517] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 50. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO: 50. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO: 50. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 50. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:50 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:50.
[0518] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:50. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:50. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:74. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:74.
[0519] DMD 35-36L.457 (SEQ ID NO: 51)
[0520] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 51. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 51. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 51. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO:51. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:51 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:51.
[0521] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:51. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:51. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:51. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO:51. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:51. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:51 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:51.
[0522] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 51. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 51. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:51. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO:51. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO:51. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:51. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:51. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:51 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:51.
[0523] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 51. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 51. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 51. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 51. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:51 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:51.
[0524] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:51. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:51. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:75. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:75.
[0525] DMD 35-36L.469 (SEQ ID NO: 52)
[0526] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 52. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 52. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 52. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 52. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 52.
[0527] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 52. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 52. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 52. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 52. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:52 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:52.
[0528] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 52. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 52 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:52.
[0529] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:52. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO:52. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO:52. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO:52. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:52. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:52 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:52.
[0530] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:52. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:52. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:76. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:76.
[0531] In certain embodiments of the invention, the engineered meganuclease binds and cleaves a recognition sequence comprising SEQ ID NO: 12 within the dystrophin gene (i.e., a DMD 37-38 recognition sequence), wherein the engineered meganuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and wherein the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region. An exemplary DMD 37-38 meganuclease is shown below.
[0532] DMD 37-38x.15 (SEQ ID NO:53)
[0533] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 53. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 53. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 53. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 53. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 53 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 53.
[0534] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:53. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:53. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:53. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO:53. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:53. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:53 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:53.
[0535] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 53. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 53 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:53.
[0536] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 53. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 53. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 53. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 53. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:53 having at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:53.
[0537] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:53. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:53. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:77. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:77.
[0538] DMD 37-38x.66 (SEQ ID NO:54)
[0539] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 54. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 54. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 54. In some embodiments, the HVR1 region comprises Y, R, K or D at a residue corresponding to residue 66 of SEQ ID NO:54. In some embodiments, the HVR1 region comprises a residue corresponding to residue 66 of SEQ ID NO:54. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:54 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises 24-79 of SEQ ID NO:54.
[0540] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:54. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:54. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:54. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO:54. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:54. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:54 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:54.
[0541] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 54. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 54. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 54. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO: 54. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO: 54. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO: 54. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 54 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO: 54.
[0542] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 54. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 54. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 54. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 54. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 54 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 54.
[0543] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:54. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:54. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:78. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:78.
[0544] DMD 37-38x.79 (SEQ ID NO: 55)
[0545] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 55. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 55. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 55. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 55. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 55 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 55.
[0546] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:55. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:55. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:55. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO:55. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:55. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:55 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:55.
[0547] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 55. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:55. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO:55. In some embodiments, the HVR2 region comprises a residue corresponding to residue 239 of SEQ ID NO:55. In some embodiments, the HVR2 region comprises a residue corresponding to residue 241 of SEQ ID NO:55. In some embodiments, the HVR2 region comprises a residue corresponding to residue 255 of SEQ ID NO:55. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:55. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:55 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:55.
[0548] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO:55. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO:55. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO:55. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO:55. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO:55. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:55 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:55.
[0549] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:55. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:55. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:79. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:79.
[0550] DMD 37-38L.166 (SEQ ID NO: 56)
[0551] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 56. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 56. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 56. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 56. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 56 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 56.
[0552] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 56. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO: 56. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO: 56. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO: 56. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:56 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:56.
[0553] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 56. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 56. In some embodiments, the HVR2 region comprises residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:56. In some embodiments, the HVR2 region comprises Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO:56. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:56. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:56. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:56 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:56.
[0554] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 56. In some embodiments, the second subunit comprises a G, S or A at a residue corresponding to residue 210 of SEQ ID NO: 56. In some embodiments, the second subunit comprises an E, Q or K at a residue corresponding to residue 271 of SEQ ID NO: 56. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 56. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 56. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:56 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:56.
[0555] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:56. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:56. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:80. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:80.
[0556] DMD 37-38L.478 (SEQ ID NO: 57)
[0557] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 24-79 of SEQ ID NO: 57. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 57. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 57. In some embodiments, the HVR1 region comprises Y, R, K, or D at the residue corresponding to residue 66 of SEQ ID NO: 57. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:57 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO:57.
[0558] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO:57. In some embodiments, the first subunit comprises a G, S, or A at a residue corresponding to residue 19 of SEQ ID NO:57. In some embodiments, the first subunit comprises a residue corresponding to residue 19 of SEQ ID NO:57. In some embodiments, the first subunit comprises an E, Q, or K at a residue corresponding to residue 80 of SEQ ID NO:57. In some embodiments, the first subunit comprises a residue corresponding to residue 80 of SEQ ID NO:57. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:57 with at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO:57.
[0559] In some embodiments, the HVR2 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 57. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 57. In some embodiments, the HVR2 region comprises one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO:57. In some embodiments, the HVR2 region comprises a Y, R, K, or D at a residue corresponding to residue 257 of SEQ ID NO:57. In some embodiments, the HVR2 region comprises a residue corresponding to residue 263 of SEQ ID NO:57. In some embodiments, the HVR2 region comprises a residue corresponding to residue 264 of SEQ ID NO:57. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:57 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region comprises residues 215-270 of SEQ ID NO:57.
[0560] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 57. In some embodiments, the second subunit comprises a G, S, or A at a residue corresponding to residue 210 of SEQ ID NO: 57. In some embodiments, the second subunit comprises an E, Q, or K at a residue corresponding to residue 271 of SEQ ID NO: 57. In some embodiments, the second subunit comprises a residue corresponding to residue 271 of SEQ ID NO: 57. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 57. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:57 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO:57.
[0561] In some embodiments, the engineered meganuclease is a single-chain meganuclease comprising a linker, wherein the linker covalently joins the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO:57. In some embodiments, the engineered meganuclease comprises an amino acid sequence of SEQ ID NO:57. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO:81. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence shown in SEQ ID NO:81.
[0562] DMD 37-38L.512 (SEQ ID NO: 58)
[0563] In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to an amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 58. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 58. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 58. In some embodiments, the HVR1 region comprises Y, R, K or D at the residue corresponding to residue 66 of SEQ ID NO: 58. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 58 with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 58.
[0564] In some embodiments, the first sub...
Claims
1. An engineered meganuclease that binds to and cleaves a recognition sequence in a dystrophin gene, wherein the engineered meganuclease comprises a first subunit and a second subunit, wherein the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and wherein the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region.
2. The engineered meganuclease of claim 1, wherein the recognition sequence comprises SEQ ID NO:
6.
3. The engineered meganuclease of claim 1, wherein the recognition sequence comprises SEQ ID NO:
10.
4. The engineered meganuclease of claim 1, wherein the recognition sequence comprises SEQ ID NO:
12.
5. A polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease according to any one of claims 1-4.
6. A recombinant virus comprising a polynucleotide comprising a nucleic acid sequence encoding the engineered meganuclease according to any one of claims 1 to 4.
7. A polynucleotide comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease, wherein the first engineered meganuclease is an engineered meganuclease according to claim 2, and wherein the second engineered meganuclease is an engineered meganuclease according to claim 3 or 4. A recombinant virus comprising the polynucleotide according to claim 7.
9. A method for producing a genetically modified eukaryotic cell comprising a modified dystrophin gene, the method comprising: include: introducing one or more polynucleotides comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease into a eukaryotic cell, wherein the first engineered meganuclease is an engineered meganuclease according to claim 2, and wherein the second engineered meganuclease is an engineered meganuclease according to claim 3 or 4, wherein said first engineered meganuclease and said second engineered meganuclease are expressed in said eukaryotic cell, wherein the first engineered meganuclease generates a first cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 6, wherein the second engineered meganuclease generates a second cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10 or SEQ ID NO: 12, wherein the first cleavage site and the second cleavage site have complementary 3' overhangs, wherein the intermediate genomic DNA between the first cleavage site and the second cleavage site is excised from the dystrophin gene, and wherein the dystrophin gene is annealed to produce the modified dystrophin gene.
10. A method for modifying a dystrophin gene in a target cell of a subject, wherein the dystrophin gene is characterized by a mutation that changes the reading frame of the dystrophin gene from wild type, the method include: delivering one or more polynucleotides to the target cell, the polynucleotides comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease, wherein the first engineered meganuclease is an engineered meganuclease according to claim 2, wherein the second engineered meganuclease is an engineered meganuclease according to claim 3 or 4, wherein said first engineered meganuclease and said second engineered meganuclease are expressed in said target cell, wherein the first engineered meganuclease generates a first cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 6, wherein the second engineered meganuclease generates a second cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10 or SEQ ID NO: 12, wherein the first cleavage site and the second cleavage site have complementary 3' overhangs, wherein the intermediate genomic DNA between the first cleavage site and the second cleavage site is excised from the dystrophin gene, wherein the dystrophin gene anneals, and wherein a normal reading frame of the dystrophin gene is restored compared to a full-length wild-type dystrophin gene.
11. A method for treating Duchenne muscular dystrophy (DMD) in a subject in need thereof, wherein the DMD is characterized by a mutation in a dystrophin gene that alters the reading frame of the dystrophin gene relative to the full-length wild-type dystrophin gene, the method include: administering to the subject an effective amount of one or more polynucleotides comprising a first nucleic acid sequence encoding a first engineered meganuclease and a second nucleic acid sequence encoding a second engineered meganuclease, wherein the first engineered meganuclease is an engineered meganuclease according to claim 2, wherein the second engineered meganuclease is an engineered meganuclease according to claim 3 or 4, wherein the one or more polynucleotides are delivered to target cells in the subject, wherein said first engineered meganuclease and said second engineered meganuclease are expressed in said target cell, wherein the first engineered meganuclease generates a first cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 6, wherein the second engineered meganuclease generates a second cleavage site in the dystrophin gene at a recognition sequence comprising SEQ ID NO: 10 or SEQ ID NO: 12, wherein the first cleavage site and the second cleavage site have complementary 3' overhangs, wherein the intermediate genomic DNA between the first cleavage site and the second cleavage site is excised from the dystrophin gene, wherein the dystrophin gene anneals, and wherein a normal reading frame of the dystrophin gene is restored compared to a full-length wild-type dystrophin gene.
Citation Information
Patent Citations
Rationally-designed single-chain meganucleases with non-palindromic recognition sequences
US10041053B2
Process for site specific mutagenesis without phenotypic selection
US4873192A
Methods of inactivating bacteria including bacterial spores
US6015832A
Methods of preventing and treating microbial infections
US6506803B1
Non-toxic antimicrobial compositions and methods of use
US6559189B2