Nucleic acid molecule and application thereof as specific promoter

The recombinant promoter obtained through artificial transformation specifically expresses exogenous genes in retinal structural cells, solving the problem of difficult to control exogenous gene expression in the prior art, and achieving the effect of efficiently expressing larger exogenous genes in AAV vectors.

CN120098992APending Publication Date: 2025-06-06YUNZHOU BIOSCIENCES (GUANGZHOU) INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411187019.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-05
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The prior art is difficult to specifically control the expression of exogenous genes in non-targeted cells, resulting in an impact on other normal tissues and organs. The genome capacity of the AAV vector is limited and a shorter length promoter is required.

Method used

The recombinant promoter obtained by artificial modification can specifically express exogenous genes in the retinal structural cells of the eye, reducing expression in non-targeted cells. The length of the recombinant promoter provided is no more than 500 bp, which is suitable for expressing larger exogenous genes in AAV vectors.

Benefits of technology

It realizes the specific expression of exogenous genes in retinal structural cells, reduces the impact on other normal tissues and organs, and is suitable for the need to express larger exogenous genes in AAV vectors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005014721310000011
    Figure HDA0005014721310000011
  • Figure HDA0005014721310000012
    Figure HDA0005014721310000012
  • Figure HDA0005014721310000021
    Figure HDA0005014721310000021
Patent Text Reader

Abstract

The invention relates to the field of gene engineering, in particular to a nucleic acid molecule and application thereof as a specific promoter. The present invention provides a nucleic acid molecule having a nucleotide sequence of any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9. The recombinant promoter obtained through artificial modification can specifically express exogenous genes in retina structural cells of eyes, expression in non-targeted cells is reduced, and the influence on other normal tissues and organs can be reduced. The length of the recombinant promoter provided by the invention is not more than 500bp, so that the recombinant promoter is suitable for the requirement of expressing a larger exogenous gene in an AAV vector, and has a wider application range. The partial promoter provided by the invention has higher expression intensity in PR cells, and is also applicable to some scenes with higher requirements on the expression quantity of target genes.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application claims a divisional of a Chinese patent application filed with the China Patent Office on December 5, 2023, with application number 202311663547.5 and invention name “Nucleic Acid Molecules and Their Application as Specific Promoters”, all contents of which are incorporated by reference into this application. Technical Field

[0002] The present invention relates to the field of genetic engineering, in particular to nucleic acid molecules and their application as specific promoters. Background Art

[0003] Promoter is a DNA sequence located upstream of the 5' end of the structural gene, which can activate RNA polymerase, make it bind accurately to the template DNA and have the specificity of transcription initiation. According to its mode of action and function, it can be divided into three categories: constitutive promoter, tissue-specific promoter and inducible promoter. Constitutive promoter has the activity of continuously expressing exogenous genes in most or all tissues, and is generally used for the extensive expression of exogenous genes. Tissue-specific promoters can often limit the expression of genes only in certain specific tissues or organs, and at the same time show characteristics such as developmental regulation. Therefore, it overcomes the waste caused by the non-specific, continuous and efficient expression of exogenous genes initiated by constitutive promoters in recipient cells / tissues, increases the effect of transgenics, and therefore people pay more and more attention to the research and application of specific promoters.

[0004] Gene therapy refers to a biological treatment method that introduces exogenous normal genes into target cells through gene transfer technology to correct or compensate for diseases caused by gene defects and abnormalities, and ultimately achieve the purpose of treatment. Inherited retinal diseases (IRDs) are a general term for a group of retinal diseases caused by genetic factors. Such diseases can be caused by more than 300 different gene mutations associated with retinal pathology. The correct expression of these genes is essential for the function of photoreceptors (PR) and retinal pigment epithelium (RPE). Once these genes are not expressed correctly, progressive cell death will occur, causing blindness in patients. For such genetic diseases, the most ideal and effective treatment method is to correct the pathogenic genes through gene enhancement, editing or silencing techniques.

[0005] Although specific exogenous genes can be delivered to the vicinity of target cells through in situ injection, tissue-specific serotype AAV delivery, etc., it is still difficult to avoid infection of other non-target tissues or cells. At this time, specific promoters are needed to specifically control the expression of exogenous genes, further reduce the expression of exogenous genes in non-target tissues or cells, and thus reduce the impact on other normal tissues and organs.

[0006] The genome capacity of AAV is about 4.7kb, and the length of the packaged and delivered gene is limited. Therefore, in most cases, a shorter promoter is needed to drive the expression of the exogenous gene. In order to achieve a better therapeutic effect, the promoter used should preferably be a promoter specifically expressed in PR or RPE layer cells. In addition, the expression strength of the promoter needs to be considered. Therefore, considering these three aspects, it is almost difficult to find a suitable promoter sequence as a promoter for the expression of exogenous genes. Summary of the invention

[0007] In view of this, the present invention provides nucleic acid molecules and their use as specific promoters. The recombinant promoter obtained by artificial modification of the present invention can specifically express exogenous genes in the retinal structural cells of the eye, reduce the expression in non-targeted cells, and reduce the impact on other normal tissues and organs. The length of the recombinant promoter provided by the present invention does not exceed 500bp, which is suitable for the needs of expressing larger exogenous genes in AAV vectors and has a wide range of applications. Some promoters provided by the present invention have a high expression intensity in PR cells and are also applicable in certain scenarios where the expression amount of the target gene is required to be high.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a nucleic acid molecule having:

[0010] (1), a nucleotide sequence as shown in any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9; or

[0011] (2) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (1); or

[0012] (3) A nucleotide sequence having at least 85% sequence homology with the nucleotide sequence described in (1) or (2).

[0013] In some embodiments of the present invention, the above-mentioned nucleic acid molecule has:

[0014] (1), a nucleotide sequence as shown in any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9; or

[0015] (2) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (1); or

[0016] (3) A nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% sequence homology with the nucleotide sequence described in (1) or (2).

[0017] In some embodiments of the present invention, the sequence of SEQ ID NO: 1 is: GCCCTAATCATTAGCAGAGCCGGTGAAGGCCCCTGGGAGACCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGGCCCCTTCCTCCAAGGGGCCGCCTCACTTTTCCCCTGAGAAGGACAAACAACCACCAGGCTTCTGGGGCCCAA. (RetinaE11)

[0018] In some embodiments of the invention, the sequence of SEQ ID NO:2 is: CCTGGCCACT AATCTGTGATCACTTATCCGTTGCCTTTGTGTATTTGGAATGGATATCCAACCATTGGATTTTCATTTTTGCAGAGAACAAGAATAGGGTTGGGAGGAAGGGGCCGGGCAGAATGATCTAATCGGATTCCAAGCAGCTCAGGGGATTGTCTTCCTCTCCCTCTTGACCGAGATTCCCCTTCTGTCTAGAGG GAGATAAGCAACTCTGAGGCCATTCAGAGGATTGTGGATATAAGAGGCTGGGAGGCCAGCCCGGGCAGAGCAGAGGGCCGCTGACATTGGGATATCAAGACTGTACCGAGTAGGGGGCGGCCCCTTGGAGGAAGGGGCCGGGCAGAATGATCTAATCGGATTCCAAGCAGCTCAGGGGAATGAAGCGATCGC. (Retina2A11)

[0019] In some embodiments of the present invention, the sequence of SEQ ID NO:3 is: CCCTTTTTGAC TTCTGACCTTCCTACCTCGTTCACTAATCTGTTTTCCAAACTCTTGGCCCTTTGTATAGAAAAGTTGAGAGGCAGGCCGAGTTTGAGGCCAGCCTGGTCTACACAGGCGTTCTAGGAGAACCTGTCTCCCGGCCCCTTCCTCCAAGGGGCCGCCTCACTTTTCCCCTGGTTGCTAAGCTGGAGACCGGGCCCTGTCGAGGGTTCCTGGGGACCACTGGGAAGCCCCTGGGAGACCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGCAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGG. (RetinaB3)

[0020] In some embodiments of the present invention, the sequence of SEQ ID NO:4 is: TAGAAAAAGA CAATCCCCTGAGCTGCTTGAGGGCTAACAGAAGATCAAGTCCCATTTTAGCCTCCCTAGCTCTGGCCTACCTCCTCAGTTAGAAAAAGACAATCCCCT GAGCTGCTTGGAATCCGATTAGATCCCTGGCTCATCTCTCAGGATGCCTATCTTGTCCTTAGCACGATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGCTAGAAAAAGACAATCCCCGCCTGGCCCGGATCACTTATCCGTTGCCTTTGTGTATTTGGAGGCTGGGAGGCCAGCTGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGATGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTA. (RetinaC8)

[0021] In some embodiments of the invention, the sequence of SEQ ID NO:5 is: CCCAGGGGCT TCCCAGTGGTCCCCAGGAACCCTCGACAGGCTGGCCTGTGGGATCAGCCCGGGCCTCTTCACCTTAAAAGCTCCCAAACCCCCTCCAGCTCTGGTTGCTAAGCTGGCCTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGGCCCTTCCTCCAAGGGGCCGGACAGAGTGTG TGCAGAGAGACTGACTGTGTGTGCTTCTTCCCATTCCGGAGGTGGCAGAGGTGGGACATAAACACAGAGAGGGCCCCTTGCTGGACGAGAGAGACCGGGCCCTGTCGAGACTTATACGTTGCCTTTGTGTATTTGGAATGGATATCCAACCATTGGATTTTCATTTTTGTGTGGTTAAACATCATTTGTTCCCTTTTTGACTTCTGACCTTCC. (RetinaD9) In some embodiments of the present invention, the sequence of SEQ ID NO: 6 is: CACAGCACCA GGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAA GGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGAT CATTCTGCCCGG. (RetinaA12)

[0022] In some embodiments of the present invention, the sequence of SEQ ID NO:7 is: CCTACAGCAG CCAGGGTGAGATTACATGAAACGGAAGCTCTGTCCTCATGAAACACCCATGCCCTTTCCCCACCCCTCAGCCTCCTGCACCCACCCTTCTATTCCTATGCATTTGGGAGCTCTGAGTGCAATCCTACGGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCCGGCCCCTTCCTCCAAGGGGCCGCCTCACTTTTCCGTGGATATAAGAGGCTGGGAGGCC. (RetinaB4)

[0023] In some embodiments of the present invention, the sequence of SEQ ID NO: 8 is: TGTGAGATAGAGGAAAAATATGTTAGGATAGAGTAACATTCTCTTCTTCCCGTAAAAGCTGGGCGAGAGTGCGGACCGGTGGTGCTTGCCTACCTTGCCTT GAGACTCCTTACCCGAGCTGGAGAGCTCCTTCCTAATCCGGGGATTGTCCCCTAAATCTGATCTGCTAGTAGGTCACAGAGAGCTGACAGATGAGGTGGGTTCCGTGTCTGTGAAATTCCGATTCTCCTGCTTCCGCTTTCC. (Reti naL02)

[0024] In some embodiments of the present invention, the sequence of SEQ ID NO:9 is: ACAAGTCCAA CATCTAATCTTCCACCCTGGCCAGGGCCCCAGCTGGCAGCGAGGGTGGGAGACTCCGGGCAGAGCAGAGGGCGCTGACATTGGGGCCCGGCCTGGCTTGGGTCCCTCTGGCCTTTCCCCAGCCTATCTTGTCCTTAGCACGATGAGGAGGAGGCCTGGCCTCCAGCTCTGGTTGACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGGGAGGAGGCCTGG. (RetinaA2)

[0025] In some embodiments of the present invention, the size of the above-mentioned nucleic acid molecule is no greater than 500 bp.

[0026] The present invention also provides the use of the nucleic acid molecule as a promoter.

[0027] The present invention also provides a recombinant expression vector, comprising: the above nucleic acid molecule and a target gene.

[0028] In some embodiments of the present invention, the above-mentioned recombinant expression vector further includes: fluorescent protein.

[0029] In some embodiments of the present invention, in the above-mentioned recombinant expression vector, the fluorescent protein includes nuclear-importing green fluorescent protein and / or nuclear-importing red fluorescent protein.

[0030] In some embodiments of the present invention, in the above-mentioned recombinant expression vector, the nuclear-importing green fluorescent protein includes: NLS-EGFP.

[0031] In some embodiments of the present invention, in the above-mentioned recombinant expression vector, the nuclear-importing red fluorescent protein includes: NLS-mCherry.

[0032] The present invention also provides a method for constructing the above-mentioned recombinant expression vector, and the recombinant expression vector is obtained by connecting the nucleic acid molecule and the target gene.

[0033] The present invention also provides virus particles, transformation and / or transfection of the above recombinant expression vector and / or the recombinant expression vector obtained by the above construction method.

[0034] The present invention also provides a method for preparing the above-mentioned virus particles, which comprises taking the recombinant expression vector for virus packaging, collecting the virus, purifying the virus, and obtaining the virus particles.

[0035] In some embodiments of the present invention, in the above preparation method, the cells include: 293T cells.

[0036] In some embodiments of the present invention, in the above preparation method, the virus includes AAV.

[0037] In some embodiments of the present invention, in the above preparation method, the purification uses cesium chloride.

[0038] The present invention also provides the use of the above nucleic acid molecule, the above recombinant expression vector, the recombinant expression vector obtained by the above construction method, the above lentiviral particle and / or the virus particle obtained by the above preparation method in cells that specifically express retinal structures.

[0039] In some embodiments of the present invention, the retinal structure includes: photoreceptors and / or retinal pigment epithelium

[0040] The present invention also provides the use of the above nucleic acid molecule, the above recombinant expression vector, the recombinant expression vector obtained by the above construction method, the above virus particle and / or the virus particle obtained by the above preparation method in the preparation of products for treating and / or preventing inherited retinal diseases.

[0041] The present invention also provides a product, including: the above nucleic acid molecule, the above recombinant expression vector, the recombinant expression vector obtained by the above construction method, the above virus particle and / or the virus particle obtained by the above construction method.

[0042] The present invention provides a nucleic acid molecule having:

[0043] (1), a nucleotide sequence as shown in any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9; or

[0044] (2) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (1); or

[0045] (3) A nucleotide sequence having at least 85% sequence homology with the nucleotide sequence described in (1) or (2).

[0046] The beneficial effects of the present invention include:

[0047] (1) The recombinant promoter obtained by artificial modification in the present invention can specifically express exogenous genes in the retinal structural cells of the eye, reduce the expression in non-target cells, and reduce the impact on other normal tissues and organs.

[0048] (2) The length of the recombinant promoter provided by the present invention does not exceed 500 bp, which is suitable for expressing larger exogenous genes in AAV vectors and has a wide range of applications.

[0049] (3) Some promoters provided by the present invention have high expression intensity in PR cells and are also applicable in certain scenarios where higher expression levels of target genes are required. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0051] Figure 1 Vector 1 is shown, wherein: the upstream is each recombinant promoter (the example uses the CAG promoter), and the downstream is the expression vector structure of the nuclear green fluorescent protein (NLS-EGFP);

[0052] Figure 2 Vector 2 is shown, wherein: the upstream is each recombinant promoter (the example uses the CAG promoter), and the downstream is the expression vector structure of the nuclear red fluorescent protein (NLS-mCherry);

[0053] Figure 3The following are the results of mouse eye slices after subretinal injection of AAV expressing downstream fluorescent proteins with different recombinant promoters, and the slices were immunofluorescently stained using Anti-Arrestin C antibody as the primary antibody, and photographed and recorded; among them: the left shows the slices taken at the annotated exposure time (1000ms / 500ms), which are mainly used for comparison of expression intensity; the middle shows the merged image of two photos obtained by taking photos after cell expression of fluorescence and immunofluorescence staining (the exposure time of each channel has been adjusted); the right shows the merged image of three photos obtained by taking photos after cell expression of fluorescence, immunofluorescence staining, and DAPI staining (the exposure time of each channel has been adjusted);

[0054] Figure 4 The figure shows the statistical results obtained by semi-quantitative analysis of the brightness of the slices of the group expressing nuclear green fluorescent protein using Image J software;

[0055] Figure 5 The figure shows the statistical results obtained by semi-quantitative analysis of the brightness of the slices of the group expressing red fluorescent protein translocated into the nucleus using Image J software;

[0056] Figure 6 The figure shows the use of CAG promoter as a representative example of a broad-spectrum expression promoter, and the expression profiles are compared with those of different recombinant promoters obtained. DETAILED DESCRIPTION

[0057] The invention discloses nucleic acid molecules and the application thereof as specific promoters.

[0058] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0059] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0060] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0061] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0062] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0063] The present invention obtains nine shorter recombinant promoters by artificially recombining and modifying hRO, hRK, mCAR and ProA1 promoters, all of which are less than 500 bp in length and are basically or mostly specifically expressed only in PR or RPE layer cells, and these specific promoter elements have been verified in animal experiments.

[0064] In Example 1 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0065] The present invention will be further described below in conjunction with embodiments:

[0066] Example 1

[0067] 1. Expression vector 1 and vector 2 (vector framework as shown in Figure 1 and Figure 2 The links are https: / / en.vectorbuilder.com / vector / VB211226-1096bhj.html and https: / / en.vectorbuilder.com / vector / VB900129-0788gfe.html, and conventional restriction enzyme cutting and ligation methods are used to replace the CAG promoter with the recombinant promoter, respectively, to construct a gene expression vector with each recombinant promoter as the upstream.

[0068] 2. Each expression vector containing a recombinant promoter is packaged into AAV virus, and the virus is harvested and purified with cesium chloride to finally obtain virus particles for in vivo animal verification experiments.

[0069] 3. The same dose was injected into the subretinal space of mice, and the virus injection dose was 1E+10GC / eye.

[0070] 4. After 2 weeks, the samples were sliced ​​and immunofluorescently stained: the primary antibody used in the immunofluorescence process was Anti-Arrestin C antibody, which is a rabbit anti-mouse polyclonal antibody that can specifically bind to the cone surface protein in the PR layer, thereby effectively distinguishing cones from rods. If the recombinant promoter is downstream of the nuclear green fluorescent protein (NLS-EGFP), the secondary antibody for subsequent immunofluorescence staining uses red fluorescence; if the promoter uses nuclear red fluorescent protein (NLS-mCherry) downstream, the secondary antibody uses green fluorescence. At the same time, DAPI is used to stain the nuclei of cells in each layer, and the image is blue.

[0071] 5. Take photos of the slices to finally obtain the expression slice diagrams of each recombinant promoter.

[0072] like Figure 3 As shown, the slice image results are explained: each recombinant promoter shows films taken at two magnifications (100x / 200x), and there are three films at each magnification. The first film is taken at the annotated exposure time (1000ms / 500ms), which is mainly used for comparison of expression intensity; the second film is a merged image of two photos obtained by taking pictures after cell expression fluorescence and immunofluorescence staining (the exposure time of each channel is adjusted); the third film is a merged image of three photos obtained by taking pictures after cell expression fluorescence, immunofluorescence staining and DAPI staining (the exposure time of each channel is adjusted).

[0073] 6. Use Image J software to semi-quantitate the brightness of each group of slices and draw a chart as shown in the figure. Figure 4 and Figure 5 As shown;

[0074] 7. Compare and summarize the slice results and Image J software. The results are shown in Table 1:

[0075] Table 1

[0076] Serial number Recombinant promoter Length bp PR cell expression intensity PR cell expression specificity 1 RetinaE11 244 +++ +++ 2 Retina2A11 392 + +++ 3 RetinaB3 408 ++ +++ 4 RetinaC8 373 +++ +++ 5 RetinaD9 437 ++ +++ 6 RetinaA12 118 +++ + 7 RetinaB4 262 + ++ 8 RetinaL02 249 + ++ 9 RetinaA2 279 + +

[0077] Result analysis: The animal slice results showed that most of the above promoters showed the ability to express specifically in photoreceptor cells, and further analysis by Image J software showed that the expression specificity and intensity of promoters RetinaE11, RetinaB3, RetinaC8 and RetinaA12 were relatively strong. Different promoters can be selected according to different application requirements.

[0078] Example 2

[0079] 1. Vector 1 and vector 2, i.e., vectors expressing nuclear green fluorescent protein and nuclear red fluorescent protein respectively under the CAG promoter, were packaged with AAV viruses, and the viruses were harvested and purified with cesium chloride to finally obtain virus particles for in vivo animal verification experiments.

[0080] 2. Mix the two viruses obtained in step 1 in a ratio of 1:1, and then inject them into the subretinal space of mice. The virus injection dose is 2E+9GC / eye.

[0081] 3. After 2 weeks, the mouse eyes were sampled and sliced, and DAPI staining was performed to obtain the expression slice map of the CAG promoter.

[0082] like Figure 6 As shown, the slice results are explained as follows: CAG promoter shows films taken at two magnifications (100x / 200x), with three films at each magnification. The first film is taken in the red channel at the annotated exposure time (1000ms / 500ms), which is mainly used to observe the expression of red fluorescent protein entering the nucleus; the second film is taken in the green channel at the annotated exposure time (1000ms / 500ms), which is mainly used to observe the expression of green fluorescent protein entering the nucleus; the third film is a merged picture of three photos taken after cells expressed two different colors of fluorescence and DAPI staining (the exposure time of each channel was adjusted). Other recombinant promoters only have pictures expressing one nuclear fluorescent protein and merged pictures after DAPI staining.

[0083] Analysis of results: The results of animal slices showed that CAG was strongly expressed in INL, RPE and PR layer cells, while the promoters RetinaE11, RetinaB3, RetinaC8 and RetinaD9 all showed higher expression specificity than the broad-spectrum expression promoter CAG, and were basically only expressed in the PR layer or mainly in the PR layer, and a very small part was specifically expressed in the RPE layer cells.

[0084] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Nucleic acid molecules, It is characterized in that It has: (1), a nucleotide sequence as shown in any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9; or (2) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (1); or (3) A nucleotide sequence having at least 85% sequence homology with the nucleotide sequence described in (1) or (2).

2. Use of the nucleic acid molecule as claimed in claim 1 as a promoter.

3. Recombinant expression vector, It is characterized in that include: The nucleic acid molecule and target gene as claimed in claim 1.

4. The method for constructing the recombinant expression vector according to claim 3, It is characterized in that After the nucleic acid molecule and the target gene are connected, the recombinant expression vector is obtained.

5. Virus particles, It is characterized in that Transform and / or transfect the recombinant expression vector according to claim 3 and / or the recombinant expression vector obtained by the construction method according to claim 4.

6. The method for preparing the virus particles according to claim 5, It is characterized in that The recombinant expression vector is taken for virus packaging, and then the virus is collected and purified to obtain the virus particles.

7. Use of the nucleic acid molecule according to claim 1, the recombinant expression vector according to claim 3, the recombinant expression vector obtained by the construction method according to claim 4, the viral particle according to claim 5 and / or the viral particle obtained by the preparation method according to claim 6 in cells that specifically express retinal structures.

8. The use according to claim 7, It is characterized in that The retinal structure includes: photoreceptors and / or retinal pigment epithelium.

9. Use of the nucleic acid molecule according to claim 1, the recombinant expression vector according to claim 3, the recombinant expression vector obtained by the construction method according to claim 4, the virus particle according to claim 5 and / or the virus particle obtained by the preparation method according to claim 6 in the preparation of products for treating and / or preventing retinal diseases.

10. Products, It is characterized in that include: The nucleic acid molecule according to claim 1, the recombinant expression vector according to claim 3, the recombinant expression vector obtained by the construction method according to claim 4, the virus particle according to claim 5 and / or the virus particle obtained by the construction method according to claim 6.