Membrane protein Sec61alpha gene and application of dsRNA thereof in pest control

By extracting and utilizing dsRNA of the Sec61α gene of the periartum membrane protein, efficient and specific prevention and control of periartum is achieved, the problem of target screening bottlenecks in the prior art is solved, and a new RNA interference gene target is provided.

CN120099014AActive Publication Date: 2025-06-06SHANXI UNIV
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510263730.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-06
Publication Date
2025-06-06
Estimated Expiration
2045-03-06

AI Technical Summary

Technical Problem

Existing nucleic acid biopesticides have bottlenecks in screening of efficient specific anti-worm dsRNA targets, and it is difficult to effectively prevent and control agricultural pests such as locusts.

Method used

By extracting and utilizing the dsRNA of the Sec61α gene of the miracle membrane protein, the mRNA expression of the pest is silenced through RNA interference technology, thereby inhibiting the growth and development of the pests.

Benefits of technology

The specific prevention and control of periarthria can be achieved, which can cause periarthria to stop feeding and die before molting, providing a new RNA interference gene target, which has important application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099014A_ABST
    Figure CN120099014A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biotechnology and agricultural pest control, and particularly relates to a membrane protein Sec61 alpha gene and application of dsRNA of the membrane protein Sec61 alpha gene in pest control. According to the invention, the Sec61 alpha gene of migratory locust is cloned and sequenced to obtain the Sec61 alpha gene with the sequence of SEQ ID NO: 1; and then the gene segment with the sequence of SEQ ID NO: 2 is selected and used for synthesis of double-stranded RNA (dsRNA). After the dsRNA of the gene is injected into the body cavity of the migratory locust, the specific Sec61alpha gene can be silenced, so that the migratory locust stops ingestion and successively dies before ecdysis. The invention provides a novel specific molecular target for pest control based on RNA interference, and has very important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and agricultural pest control, and specifically relates to the application of membrane protein Sec61α gene and dsRNA thereof in pest control. Background Art

[0002] Nucleic acid biological pesticides use the dsRNA of pests or pathogens to achieve silencing of target gene transcription levels, thereby inhibiting the growth and development of pests or pathogens and achieving the purpose of preventing and controlling pests and diseases. Compared with traditional pesticides, nucleic acid biological pesticides have the advantages of strong insecticide specificity, wide target selection range, and green safety. Nucleic acid biological pesticides have become the core product of the "third revolution in the history of pesticide development". However, the research and development of nucleic acid biological pesticides urgently needs to break through the bottleneck of efficient and specific insect-resistant dsRNA target screening. Membrane proteins play a very important role in many life activities of organisms, such as cell proliferation and differentiation, energy conversion, signal transduction and material transport. It is estimated that about 60% of drug targets are membrane proteins.

[0003] Locusta migratoria is an intercontinental agricultural pest, mainly distributed in Asia, Europe, Africa and Australia. It is characterized by its explosiveness, clustering and migratory nature. Once it occurs, it not only affects a wide range of areas, but also comes with great force and causes serious disasters. Sec61α is a membrane protein. Currently, there is no report on RNA interference technology for pest control through the membrane protein Sec61α gene. Summary of the invention

[0004] In view of this, the purpose of the present invention is to overcome the deficiencies of the above-mentioned prior art and provide the application of the membrane protein Sec61α gene and its dsRNA in pest control.

[0005] To achieve the above object, the technical solution of the present invention is as follows:

[0006] The first aspect of the present invention is a locust membrane protein Sec61α gene, the nucleotide sequence of which is shown in SEQ ID NO: 1. The sequence is obtained by searching the locust transcriptome database, the open reading frame of the sequence is 1431 bp, encoding 476 amino acids.

[0007] The second aspect of the present invention is a locust membrane protein Sec61α gene fragment, the nucleotide sequence of which is shown in SEQ ID NO:2.

[0008] The third aspect of the present invention is a dsRNA of the locust membrane protein Sec61α gene, which is synthesized using the locust membrane protein Sec61α gene fragment described in the second aspect.

[0009] The fourth aspect of the present invention is a method for synthesizing dsRNA of the locust membrane protein Sec61α gene described in the third aspect, comprising the following steps: designing an upstream primer as shown in SEQ ID NO: 3 and a downstream primer as shown in SEQ ID NO: 4 according to the sequence SEQ ID NO: 1, and then obtaining a product as shown in SEQ ID NO: 2 by PCR amplification, which is purified and transcribed to synthesize dsRNA.

[0010] The fifth aspect of the present invention is the use of the dsRNA of the locust membrane protein Sec61α gene described in the third aspect in pest control.

[0011] Furthermore, the dsRNA is prepared into a sprayable insecticide or bait, or the dsRNA is transferred into plants that are fed by pests.

[0012] Furthermore, the pest is a migratory locust.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] After the dsRNA of the locust membrane protein Sec61α gene of the present invention is injected into the body cavity of the locust, the mRNA expression of the locust membrane protein Sec61α gene can be specifically silenced, and the locusts can be caused to stop feeding and die before molting, thereby providing a new specific molecular target for pest control based on RNA interference, and having very important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : Effect of injection of dsRNA synthesized by SEQ ID NO: 2 on the mRNA expression of Sec61α gene in 5th instar locusts (**P<0.005).

[0016] Figure 2 : Effect of injection of dsRNA synthesized by SEQ ID NO: 2 on the phenotype of 5th instar migratory locusts (the left side is the control injected with dsGFP, and the right side is injected with dsRNA synthesized by SEQ ID NO: 2, i.e., dsLmSec61α). DETAILED DESCRIPTION

[0017] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0018] Example 1: Obtaining the full-length cDNA sequence and gene fragments of the locust membrane protein Sec61α gene

[0019] Based on the transcriptome database of locusts, the cDNA sequence of the locust membrane protein Sec61α gene was searched using bioinformatics methods to obtain the full-length cDNA sequence of the locust membrane protein Sec61α gene. The upstream and downstream primers were designed using primer premier 5.0 software to verify the full-length cDNA sequence and sent to Shanghai Bioengineering Co., Ltd. for synthesis. Four healthy, uniform-sized, half-male and half-female 5-year-old locust nymphs were selected and frozen in liquid nitrogen. RNA was extracted according to the TaKaRa RNAiso Plus kit, and the HiScript III qRT SuperMix (Nanjing Novozyme Biotechnology Co., Ltd.) instruction manual was used to reverse transcribe the extracted RNA into the first-strand cDNA. Using this cDNA as a template, combined with the designed upstream and downstream primers, the full-length cDNA sequence of the Sec61α gene was amplified by PCR. The obtained product was purified, cloned and transformed into Escherichia coli, and sent to Shanghai Bioengineering Co., Ltd. for sequencing, and its sequence is SEQ ID NO: 1.

[0020] Example 2: Synthesis of dsRNA of locust membrane protein Sec61α gene

[0021] 1) Design of dsRNA primers for locust membrane protein Sec61α gene

[0022] Based on the sequence SEQ ID NO: 1 of the locust membrane protein Sec61α gene obtained in Example 1, dsRNA primers were designed using primerpremier5.0 software, the primer sequences were SEQ ID NO: 3 and SEQ ID NO: 4, respectively, and the upstream and downstream primers both carried T7 promoter sequences. All primers were synthesized by Shanghai Bioengineering Co., Ltd.

[0023] 2) Synthesis of dsRNA of locust membrane protein Sec61α gene

[0024] PCR amplification was performed using the upstream and downstream primers of SEQ ID NO: 3 and SEQ ID NO: 4 with the cDNA template of Example 1. The amplified PCR product, whose sequence is SEQ ID NO: 2, was purified by FastPure Gel DNA Extraction MiniKit (Vazyme) and then purified by T7 RiboMAX TM Express RNAi System (Promega) kit instructions: In vitro transcription was used to synthesize dsRNA (i.e., dsLmSec61α). Quantification was performed using NANODROP 2000 (Thermo scientific) to a final concentration of 2 μg / μL. The dsRNA was stored in a -80°C ultra-low temperature freezer for future use.

[0025] Example 3: Experiment on killing 5th-instar locusts with dsRNA of locust membrane protein Sec61α gene

[0026] 1) Injection of dsRNA of locust membrane protein Sec61α gene

[0027] The nymphs of uniform size and consistent health status on the third day of the fifth instar were selected for injection of the dsRNA synthesized in Example 2. A 25 μl microsyringe was used for injection. Do not use too much force during injection. Follow the direction of blood flow and the junction of the 2nd and 3rd abdominal segments of the lateral abdomen as the injection point, avoiding the valve. The amount of dsRNA injected was 10 μg, and a control group of dsGFP (10 μg) was set up, with 10 insects in each group, 3 biological replicates, and a total of 30 insects. After the injection, the insects were raised in an artificial climate box with a 1L beaker (light: dark time = 14h:10h, temperature 30±2°C, humidity 60%), given fresh wheat seedlings and appropriate light, and sprayed with water to maintain humidity.

[0028] 2) Detection of silencing gene of membrane protein Sec61α in 5th instar locust

[0029] The nymphs injected with dsGFP and dsLmSec61α were collected 24 hours after injection for total RNA extraction. Four biological replicates were collected for each of the control and dsLmSec61α injection groups, with three test worms in each biological replicate. The RNA was reverse transcribed into the first-strand cDNA. The relative expression levels of the target gene (LmSec61α) and the housekeeping gene (β-actin) were detected by RT-qPCR, and their silencing efficiency was calculated. The results showed that compared with the control group, the expression of the LmSec61α gene in the test worms injected with dsLmSec61α was significantly reduced ( Figure 1 ).

[0030] 3) Observation of the phenotype of the fifth-instar migratory locust after injection of dsRNA

[0031] After the 5th instar nymphs were injected with dsRNA, the dsGFP control group began to molt 7 days later and all successfully molted into adults. After molting into adults, the insect body morphology and vitality were normal. All 30 nymphs in the dsLmSec61α injection group died before molting, and the phenotype was as follows Figure 2 Shown: Intestinal development is significantly atrophied.

[0032] The above description is only for better explaining the embodiments of the present invention, and is not intended to limit the present invention. Any modification or equivalent substitution that does not depart from the spirit and scope of the present invention shall fall within the scope of the present invention.

[0033] SEQ ID NO: 1

[0034]

[0035] SEQ ID NO:2

[0036] MGIKFLEVIKPFCSILPEIAKPERKIQFREKVLWTAITLFIFLVCCQIPLFGIMSSDSADPFYWIRVILASNRGTLMELGISPIVTSGLIMQLLAGAKIIEVGDTPKDRALFNGAQKLFGMVITVGQAIVYVMTGMYGDPSEIGAGVCLLIIIQLFVAGLIVLLLDELLQKGYGLGSGISLFIATNICETIVWKAFSPTTVNTGRGTEFEGAVIALFHLLATRQDKVRALREAFYRQNLPNLMNLLATILVFAIVIYFQGFRVDLPIKSARYRGQYSSYPIKLFYTSNIPIILQSALVSNLYVISQMLAVKFTGNFFVNLLGVWADVGGGGPARAYPVGGLCYYLSPPENIMHILEDPVHALLYIIFMLGSCAFFSKTWIDVSGSSAKDVAKQLKEQQMVMRGHRDNSMIRELNRYIPTAAAFGGLCIGALSVLADFLGAIGSGTGILLAVTIIYQYFEIFVKEQSDMGSMSTLLF

[0037] SEQ ID NO:3

[0038] AGATTGGTGCTGGAGTTT

[0039] SEQ ID NO:4

[0040] CATCAAACATTCCCATTATC

[0041] SEQ ID NO:5

[0042] AGATTGGTGCTGGAGTTTGCCTTTTGATCATAATTCAGCTTTTTGTCGCTGGACTTATAGTCCTTTTGCTCGATGAACTTCTGCAGAAAGGGTATGGACTTGGATCTGGAATTTCACTGTTCATTGCGACAAATATATGTGAAACAATAGTGTGGAAGGCCTTCAGTCCAACTACTGTGAATACAGGACGTGGTACAGAATTTGAAGGAGCTGTGATTGCCCTGTTTCACTTACTGGCAACACGTCAGGACAAAGTTCGAGCCTTAAGGGAAGCATTCTATAGGCAAAACCTGCCTAACCTGATGAATCTGCTTGCAACTATTCTTGTTTTTGCCATTGTAATTTACTTCCAGGGCTTCAGGGTGGATCTGCCAATCAAATCTGCTCGCTATAGAGGCCAGTACAGCAGCTATCCAATAAAGCTGTTTTATACATCAAACATTCCCATTATC

Claims

1. A locust membrane protein Sec61α gene, characterized in that: The nucleotide sequence is shown in SEQ ID NO:

1.

2. A locust membrane protein Sec61α gene fragment, characterized in that: The nucleotide sequence is shown in SEQ ID NO:

2.

3. A dsRNA of the locust membrane protein Sec61α gene, characterized in that: The method is synthesized using the locust membrane protein Sec61α gene fragment described in claim 2.

4. The method for synthesizing dsRNA of the locust membrane protein Sec61α gene according to claim 3, characterized in that: The method comprises the following steps: designing an upstream primer as shown in SEQ ID NO: 3 and a downstream primer as shown in SEQ ID NO: 4 according to the sequence SEQ ID NO: 1, and then obtaining a product as shown in SEQ ID NO: 2 by PCR amplification, which is purified and transcribed to synthesize dsRNA.

5. Use of the dsRNA of the locust membrane protein Sec61α gene according to claim 3 in pest control.

6. The use of dsRNA of the locust membrane protein Sec61α gene according to claim 5, characterized in that: The dsRNA is prepared into a sprayable insecticide or bait, or the dsRNA is transferred into plants that the pests feed on.

7. The use of dsRNA of the locust membrane protein Sec61α gene according to claim 5, characterized in that: The pest is locust.

Citation Information

Patent Citations

  • Migratory locust wing epidermis protein gene and application thereof in pest control

    CN105695476A

  • Migratory locust wing specific cuticle protein gene and application of dsRNA thereof

    CN105755006A

  • Intersegmental membrane epidermis protein gene LmAbd1 of locusta migratoria and application of LmAbd1 in control of locusta migratoria

    CN107699569A

  • Locusta migratoria V-ATPase-V0 structural domain genes and application of dsRNA of locusta migratoria V-ATPase-V0 structural domain genes in pest control

    CN111440810A

  • Control of plant pests using RNA molecules

    CN112770761A