Haemaphysalis unguiculata Ir1 gene and application thereof

Abstract

The invention discloses a haemaphysalis unguiculata Ir1 gene. A gene sequence of the haemaphysalis unguiculata Ir1 gene comprises a nucleotide sequence for coding an amino acid sequence shown in SEQ ID NO.1. The invention also discloses a substance for inhibiting the expression of the haemaphysalis unguiculata Ir1 gene. After dsRNA expression inhibition, the haemaphysalis unguiculata Ir1 gene can inhibit the chemosensory response of the haemaphysalis unguiculata Ir1 gene and is suitable for being used as a prevention and control target of haemaphysalis unguiculata, and the dsRNA of the haemaphysalis unguiculata Ir1 gene can be used as a related preparation and product for preventing and controlling ticks and has a wide application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to an Ir1 gene of Haemaphysalis longicornis and an application thereof. Background Art

[0002] Ticks are a type of arthropod that can transmit a variety of pathogens. Their life cycle requires them to maintain their growth and development by biting the host and sucking blood. During their bites, they can transmit a variety of pathogens including viruses, bacteria, protozoa, anaplasmas, spirochetes, etc., which directly endanger the health of humans and animals. The long-horned blood tick (Haemaphysalis longicornis) has the characteristics of strong survival and adaptability. It has become a dominant species in many regions and is also one of the most widely distributed tick species in my country.

[0003] For tick prevention and control, we can only rely on agricultural insect repellents at present. Finding new prevention and control targets and developing tick-specific repellents remain urgent tasks. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a Haemaphysalis longicornis Ir1 gene (HLIr1), which can be used to develop biological products for tick control.

[0005] In order to solve the above technical problems, the present invention is achieved through the following technical solutions:

[0006] In one aspect of the present invention, a Haemaphysalis longicornis Ir1 gene is provided, the gene sequence of which comprises: a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.1.

[0007] Preferably, the nucleotide sequence of the Ir1 gene of Haemaphysalis longicornis is shown as SEQ ID NO.2.

[0008] In another aspect of the present invention, a Haemaphysalis longicornis Ir1 protein is provided, having an amino acid sequence shown in SEQ ID NO.1.

[0009] In another aspect of the present invention, a substance for inhibiting the expression of the Ir1 gene of the above-mentioned Haemaphysalis longicornis is also provided.

[0010] The substance comprises: dsRNA which inhibits the expression of Ir1 gene of the above-mentioned Haemaphysalis longicornis.

[0011] Preferably, the dsRNA is a double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO.17 and its reverse complementary sequence.

[0012] In another aspect of the present invention, the use of the above-mentioned Haemaphysalis longicornis Ir1 gene in the preparation of biological products for controlling ticks is also provided.

[0013] In another aspect of the present invention, there is provided a use of a substance for inhibiting the expression of the Ir1 gene of the above-mentioned Haemaphysalis longicornis in the preparation of a biological product for controlling ticks.

[0014] In another aspect of the present invention, a biological product for controlling ticks is provided, comprising a substance that inhibits the expression of the Ir1 gene of the above-mentioned Haemaphysalis longicornis.

[0015] The Ir1 gene of the longhorned tick of the present invention has been proved by RNA interference experiments that the dsRNA sequence of the Ir1 gene can be injected into the nymph of the parthenogenetic longhorned tick to inhibit its chemical sensory response to cinnamaldehyde, indicating that the Ir1 gene can be used as a control target for the longhorned tick, and its dsRNA can be used as a related preparation and product for tick control, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0017] Figure 1 This is a diagram showing the result of PCR amplification of the Ir1 gene of the longicorn tick in Example 1 of the present invention;

[0018] Figure 2 This is a graph showing the electrophoresis result of the synthesized dsRNA of the Ir1 gene of the Haemaphysalis longicornis of Example 2 of the present invention;

[0019] Figure 3 is a schematic diagram of repellency determination in Example 3 of the present invention;

[0020] Figure 4 is a diagram of the repellency measurement result of Example 3 of the present invention;

[0021] Figure 5 This is a graph showing the RT-qPCR detection results of Ir1 in Example 4 of the present invention. DETAILED DESCRIPTION

[0022] In order to find new control targets for ticks and develop tick-specific repellents, the present invention uses the fact that cinnamaldehyde can cause a repellent reaction of ticks as a starting point, clones the glutamate ionotropic receptor Ir1 of the parthenogenetic longhorned tick, designs and synthesizes the dsRNA sequence of the Ir1 gene (SEQ ID NO.17), and injects it into the nymphs of the parthenogenetic longhorned tick. The chemosensory reaction of the longhorned tick to cinnamaldehyde can be inhibited, indicating that the dsRNA of the Ir1 gene of the longhorned tick can play a good effect in the process of tick control.

[0023] Example 1 Molecular cloning and sequence analysis of the Ir1 gene (HLIr1) of Haemaphysalis longicornis

[0024] 1. Materials and Methods

[0025] 1.1 Experimental Sample

[0026] The parthenogenetic Haemaphysalis longicornis samples and Lusiferase plasmid were provided by Shanghai Veterinary Research Institute.

[0027] 1.2 Reagents

[0028] TRIzol, chloroform, isopropanol, 75% ethanol, cinnamaldehyde, and 95% ethanol were purchased from Sinopharm Chemical Reagent Co., Ltd.; reverse transcription kit, Escherichia coli strain DH5α, and qPCR detection kit were purchased from Vazyme; DNA amplification high-fidelity enzyme, PCR product recovery kit, plasmid extraction kit, and A-Tailing ligation kit were purchased from Takara; ampicillin and pMD-18T vector were purchased from Takara Biotechnology (Dalian) Co., Ltd.

[0029] 1.3 Cloning primer design

[0030] Design the following cloning primers:

[0031] Ir1-F:5'-ATGAAGGATGTTCTTAATACATCCTTCG-3' (SEQ ID NO.3);

[0032] Ir1-R:5'-TTACCTTGGGTTGAGATCTGAC-3' (SEQ ID NO.4);

[0033] The primers used were synthesized by Saiheng Biotechnology Co., Ltd.

[0034] 1.4 RNA extraction

[0035] RNA was extracted using the TRIzol method. Several parthenogenetic longhorned ticks were added with 500ul TRIzol and fully ground. Then 200ul chloroform was added, shaken and allowed to stand for 2min, centrifuged at 4℃12000rpm for 10min, the supernatant was added with 500ul isopropanol, centrifuged at 4℃12000rpm for 10min, the supernatant was discarded and 1mL 75% ethanol was added, centrifuged at 4℃12000rpm for 10min, dried and added with double distilled water to dissolve RNA. The RNA was reverse transcribed into cDNA using a reverse transcription kit.

[0036] 1.5 Cloning of Ir1

[0037] The cDNA reverse transcribed in 1.4 was used as a template, and PCR amplification was performed using primers (Ir1-F, Ir1-R) and DNA amplification high-fidelity enzymes. The amplification conditions were 98°C for 1 min; 98°C for 10 s, 57°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 5 min; and stored at 4°C. After 1% agarose gel electrophoresis, the specific fragments were recovered, A-Tailing was added, and after ligation with pMD-18T, they were transformed into DH5α competent cells; the recombinant plasmids identified as positive by bacterial liquid PCR were sent to Saiheng Biotechnology Co., Ltd. for sequencing.

[0038] 2. Results

[0039] The full length of PCR-amplified Ir1 was 1344 bp (SEQ ID NO. 2), encoding 447 amino acids (SEQ ID NO. 1), and its size was consistent with the expected value ( Figure 1 ), and after sequencing, NCBI BLAST analysis revealed that the sequence belonged to a glutamate ionotropic receptor.

[0040] Example 2 RNA interference of Haemaphysalis longicornis Ir1

[0041] 1. Materials and Methods

[0042] 1.1 Experimental Sample

[0043] The parthenogenetic Haemaphysalis longicornis samples and Lusiferase plasmid were provided by Shanghai Veterinary Research Institute.

[0044] 1.2 Reagents

[0045] TRIzol, chloroform, isopropanol, 75% ethanol, cinnamaldehyde, and 95% ethanol were purchased from Sinopharm Chemical Reagent Co., Ltd.; reverse transcription kit, Escherichia coli strain DH5α, and qPCR detection kit were purchased from Vazyme; DNA amplification high-fidelity enzyme, PCR product recovery kit, plasmid extraction kit, and A-Tailing ligation kit were purchased from Takara; and dsRNA synthesis kit was purchased from Promega.

[0046] 1.3dsRNA Primer Design

[0047] RNAi-Lusiferase-F1:GGATCCTAATACGACTCACTATAGGGCTTCCATCTTCCAGGGATACG (SEQ ID NO.5);

[0048] RNAi-Lusiferase-R1:CGTCCACAAACACAACTCCTCC (SEQ ID NO.6);

[0049] RNAi-Lusiferase-F2:GCTTCCATCTTCCAGGGATACG (SEQ ID NO.7);

[0050] RNAi-Lusiferase-R2:GGATCCTAATACGACTCACTATAGGCGTCCACAAACACAACTCCTCC (SEQ ID NO.8);

[0051] RNAi-Ir1-F1:TAATACGACTCACTATAGGATGTTCTTAATACATCCTTCGCT (SEQ ID NO.9);

[0052] RNAi-Ir1-R1: TTCGAAGTTTTTCGACGTGCT (SEQ ID NO. 10);

[0053] RNAi-Ir1-F2:ATGTTCTTAATACATCCTTCGCT (SEQ ID NO. 11);

[0054] RNAi-Ir1-R2:TAATACGACTCACTATAGGTTCGAAGTTTTCGACGTGCT (SEQ ID NO. 12);

[0055] The primers used were synthesized by Saiheng Biotechnology Co., Ltd.

[0056] 1.4 RNA interference of Ir1

[0057] The positive bacterial solution in 1.5 of Example 1 was resuscitated, and the HL-Ir plasmid was extracted using a plasmid extraction kit; the extracted plasmid was used as a cDNA template and PCR amplification was performed using primers (RNAi-Ir1-F1, RNAi-Ir1-R1, RNAi-Ir1-F2, RNAi-Ir1-R2) and a DNA amplification high-fidelity enzyme; Lusiferase plasmid was taken as a template, and PCR amplification was performed using primers (RNAi-Lusiferase-F1, RNAi-Lusiferase-R1, RNAi-Lusiferase-F2, RNAi-Lusiferase-R2) and a DNA amplification high-fidelity enzyme, and the amplification conditions were the same as those in 1.5 of Example 1; after the amplified fragment was recovered, the dsRNA was synthesized using a dsRNA synthesis kit, and the Nanoject II instrument was used for microinjection, 40 parthenogenetic longhorned blood ticks were injected into each group, and the tubes were placed in a humid box for storage at room temperature, and each group was repeated 3 times.

[0058] 2. Results

[0059] The lengths of the synthesized dsRNAs are: Lusiferase: about 600 bp ( Figure 2 1 channel in), dsIr1 (SEQ ID NO.17): about 464 bp ( Figure 2 2 channels in ).

[0060] Example 3 Repellency assay of Haemaphysalis longicornis Ir1

[0061] 1. Methods

[0062] like Figure 3 As shown, a behavioral choice test was performed on parthenogenetic longicorn tick nymphs after RNA interference using a "Y"-shaped tube device. Filter paper pieces with 10ul of 95% ethanol and 2% cinnamaldehyde (diluted with 95% ethanol) were placed on the upper end of the "Y"-shaped tube, and nymphs injected for 24 hours were placed on the lower end. Ticks were counted at both ends of the "Y"-shaped tube at 15 minutes, 30 minutes, and 60 minutes, respectively.

[0063] Repellency = (the number of ticks at the 95% ethanol end - the number of ticks at the 2% cinnamaldehyde end) / the number of ticks at the 95% ethanol end

[0064] The results were analyzed using Excel and Graphpad.

[0065] 2. Results

[0066] After testing and calculation, the repellency rate of cinnamaldehyde to microinjection of Lusiferase at 15min, 30min, and 60min was 100%, while the repellency rate to microinjection of dsIr1 decreased to 55%, 60%, and 65%, respectively, and the repellency effect decreased significantly (P<0.01) ( Figure 4 ).

[0067] Example 4 RT-qPCR detection of Ir1 of Haemaphysalis longicornis

[0068] 1. Methods

[0069] 1.1 RT-qPCR primer design for Haemaphysalis longicornis Ir1 and internal reference molecule ELFIA

[0070] qPCR-Ir1-F:TGAGGACTGACTTCGCCTTG (SEQ ID NO. 13);

[0071] qPCR-Ir1-R: CACAATAGTGGACACGCGGA (SEQ ID NO. 14);

[0072] qPCR-ELFIA-F:CGTCTACAAGATTGGTGGCATT (SEQ ID NO. 15);

[0073] qPCR-ELFIA-R: CTCAGTGGTCAGGTTGGCAG (SEQ ID NO. 16);

[0074] The primers used were synthesized by Saiheng Biotechnology Co., Ltd.

[0075] 1.2 RT-qPCR detection of Ir1

[0076] The parthenogenetic longicorn ticks injected with dsRNA and subjected to repellent assay were collected, and RNA was extracted and reverse transcribed into cDNA. RT-qPCR was performed using cDNA as a template with primers (qPCR-Ir1-F, qPCR-Ir1-R) and qPCR detection kit. The RT-qPCR detection conditions were 95℃30s; 95℃5s, 60℃30s, 40 cycles. The results were analyzed using Excel and Graphpad. -△△Ct Method to analyze the data.

[0077] 2. Results

[0078] After microinjection of Lusiferase and dsIr1, the transcriptional levels of Ir1 gene in the two groups were detected. The results showed that the transcriptional level of dsIr1 in the microinjection group was significantly lower than that in the microinjection group (P<0.05). Figure 5 ).

[0079] The above-mentioned embodiments only express the implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims.

Claims

1. An Ir1 gene of Haemaphysalis longicornis, wherein the gene sequence comprises: a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.

1.

2. The Ir1 gene of Haemaphysalis longicornis according to claim 1, characterized in that The nucleotide sequence of the Ir1 gene of Haemaphysalis longicornis is shown in SEQ ID NO.

2.

3. A Haemaphysalis longicornis Ir1 protein having the amino acid sequence shown in SEQ ID NO.

1.

4. A substance that inhibits the expression of the Ir1 gene of the Haemaphysalis longicornis according to claim 1 or 2.

5. The substance according to claim 4, characterized in that The substance comprises: dsRNA that inhibits the expression of the Ir1 gene of the Haemaphysalis longicornis according to claim 1 or 2.

6. The substance according to claim 5, characterized in that The dsRNA is a double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO.17 and its reverse complementary sequence.

7. Use of the Ir1 gene of Haemaphysalis longicornis according to claim 1 or 2 in the preparation of biological products for controlling ticks.

8. Use of the substance according to any one of claims 4 to 6 in the preparation of biological products for controlling ticks.

9. A biological product for controlling ticks, characterized in that: The invention comprises a substance that inhibits the expression of the Ir1 gene of the Haemaphysalis longicornis according to claim 1 or 2.

10. The biological product for controlling ticks according to claim 9, characterized in that: The substance comprises: dsRNA that inhibits the expression of the Ir1 gene of the Haemaphysalis longicornis according to claim 1 or 2.

Images