Cyperus esculentus salt-tolerant gene and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and relates to a cyperus esculentus CeMYB154 gene capable of improving salt tolerance and active oxygen scavenging capacity and application of the cyperus esculentus CeMYB154 gene. The Cyperus esculentus CeMYB154 gene belongs to an MYB transcription factor family, the Cyperus esculentus CeMYB154 gene is screened and transformed into Arabidopsis thaliana through transcriptome sequencing, bioinformatics analysis, gene cloning, overexpression vector construction and recombinant strain overexpression, and analysis finds that under salt stress, compared with a wild type, the root length of a plant with the overexpressed CeMYB154 gene is obviously increased, the growth vigor is better, and the growth rate of the plant with the overexpressed CeMYB154 gene is higher. According to the present invention, the content of MDA and H2O2 is significantly reduced, and the activity of CAT, POD and SOD antioxidant enzymes is significantly enhanced, such that the overexpressed CeMYB154 gene can enhance the salt tolerance and the active oxygen scavenging ability of the plant, and the overexpressed CeMYB154 gene is proved to be the salt tolerance positive regulation factor; the CeMYB154 gene can be used in the field of salt-tolerant stress-resistant breeding of cyperus esculentus, and provides an important gene resource for salt-tolerant molecular breeding.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and more specifically to a cyperus oleifera salt-tolerant gene and application thereof. Background Art

[0002] Soil salinization has become the main abiotic stress affecting plant growth and agricultural production, and is one of the major environmental problems worldwide. The situation of soil salinization in my country is very serious, with the total area of ​​various types of salinized soil reaching about 99 million hm2. 2 , accounting for about 1 / 3 of the country's land area. Excessive salt in salinized soil will cause salt damage, seriously affecting the growth and yield of crops. Due to the lack of suitable salt-tolerant crop varieties, large areas of salinized soil cannot be effectively utilized, causing huge losses to my country's agricultural production.

[0003] Cyperus oleiferus is a new type of cash crop, rich in oil, starch, dietary fiber, trace elements, etc., and has good economic value in terms of food, oil, animal husbandry, and feed. At the same time, Cyperus oleiferus is native to North Africa and the Mediterranean coast, has strong adaptability, and can tolerate drought, waterlogging, barrenness, and salinity to a certain extent. It is expected to become a high-value crop suitable for the improvement and utilization of salinized soils. However, the research foundation of Cyperus oleiferus salt tolerance is relatively weak, and salt-tolerant directional breeding is seriously lagging behind. Therefore, it is of great significance to discover the salt-tolerant functional genes of Cyperus oleiferus and analyze the salt-tolerant molecular mechanisms of related genes, which will provide a technical and molecular basis for the selection and utilization of salt-tolerant varieties of Cyperus oleiferus in my country.

[0004] The MYB transcription factor family exists in all eukaryotic organisms and is the largest class of transcription factors known in plants. It has diverse functions and is involved in many life activities of eukaryotic organisms, such as stress resistance, abiotic stress, growth and development, and secondary metabolism regulation, playing an important role.

[0005] At present, the research on salt tolerance of cyperus oleifera mainly focuses on the evaluation of salt tolerance of cyperus oleifera germplasm resources and the effects of salt stress on the growth, development and physiological traits of cyperus oleifera, while there are few studies on the molecular mechanisms related to salt tolerance of cyperus oleifera and key genes for salt tolerance. It is urgent to explore and identify salt tolerance genes of cyperus oleifera to provide genetic resources and theoretical basis for molecular assisted breeding of cyperus oleifera. Summary of the invention

[0006] 1. Technical issues to be resolved

[0007] In view of the problems existing in the prior art, the present invention excavates and identifies the salt-tolerant gene CeMYB154 of Cyperus oleifera, laying a foundation of gene resources and technology for the creation of new salt-tolerant germplasm and molecular breeding of Cyperus oleifera.

[0008] (II) Technical solution

[0009] To achieve the above object, the present invention provides the following technical solution: a cyperus oleiferus salt-tolerance gene, the nucleotide sequence of the cyperus oleiferus salt-tolerance gene is SEQ ID No.1, and the amino acid sequence of the cyperus oleiferus salt-tolerance gene is SEQ ID No.2; the open reading frame of the cyperus oleiferus salt-tolerance gene is 780 bp, encoding a total of 259 amino acids;

[0010] Application of the salt-tolerance gene of Cyperus oleifera, using the root of Cyperus oleifera as plant material, PCR amplification to obtain the target fragment, constructing an overexpression vector of CeMYB154, which is used for genetic transformation of Arabidopsis thaliana, and analyzing and identifying the salt tolerance of transgenic Arabidopsis thaliana; the sequences of the primers CeMYB154-F and CeMYB154-R are ATGGAGGAAGTGGCATGGAG and CTAGTATAAAGCAAATTCTGCTGCTTGC, respectively; pre-denaturation at 98°C for 30s; denaturation at 98°C for 10s, annealing at 55°C for 10s, and 72°C for 60s, for 34 cycles; post-extension at 72°C for 10min; the expression level of the salt-tolerance gene of Cyperus oleifera increases in Cyperus oleifera after salt stress treatment; the salt-tolerance gene of Cyperus oleifera can be used to improve the salt tolerance of transgenic Arabidopsis thaliana; compared with the wild-type strain, the transgenic strain of Arabidopsis thaliana CeMYB154 has significantly increased plant root length and better growth.

[0011] The present invention also includes the use of the cyperus oleifera salt-tolerant gene CeMYB154 in breeding salt-tolerant cyperus oleifera varieties.

[0012] The purpose of the present invention is to provide a plant salt-tolerant gene CeMYB154 and its encoding protein and application, to improve the existing plant germplasm, and then create a new salt-tolerant germplasm to promote plant adaptation to soil salinization.

[0013] The present invention provides a salt-tolerant gene CeMYB154, and the nucleotide sequence of the CeMYB154 gene is shown as SEQ ID NO.1.

[0014] The present invention also provides a protein encoded by the salt-tolerant gene ZmPCP1 described in the above technical solution, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0015] The present invention also provides a primer pair for amplifying the salt-tolerant gene CeMYB154 described in the above technical solution, characterized in that the primer pair comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is ATGGAGGAAGTGGCATGGAG; the nucleotide sequence of the downstream primer is CTAGTATAAAGCAAATTCTGCTGCTTGC.

[0016] The present invention also provides a recombinant expression vector containing the above encoding gene.

[0017] The present invention also provides a recombinant strain containing the above encoding gene.

[0018] The overexpression recombinant strain was transformed into Arabidopsis thaliana, and CeMYB154 transgenic Arabidopsis thaliana strains were screened and obtained, and the salt tolerance of Arabidopsis thaliana was analyzed and identified.

[0019] (III) Beneficial effects

[0020] Compared with the prior art, the present invention provides a salt-tolerance gene for Cyperus oleifera and its application, which has the following beneficial effects:

[0021] The present invention screened a Cyperus oleifera gene CeMYB154 whose expression level was significantly increased under salt stress through preliminary transcriptome sequencing analysis. After understanding its basic information through bioinformatics analysis, the gene was cloned, an overexpression vector was constructed, and an overexpression recombinant strain was transformed into Arabidopsis to obtain a transgenic Arabidopsis plant CeMYB154-OE. It was confirmed that the growth state of the Arabidopsis plant overexpressing CeMYB154 was less affected, and the MDA and H 2 O 2 The content was significantly lower, while the activities of CAT, POD and SOD antioxidant enzymes were significantly enhanced, showing stronger salt tolerance. The positive regulatory role of CeMYB154 in the salt stress response of Cyperus oleifera was clarified, which can be used in the field of salt-tolerance and stress-resistance breeding of Cyperus oleifera and provide important gene resources for salt-tolerance molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Show the subcellular localization of CeMYB154 protein;

[0023] Figure 2 The results of identification of the transcriptional activation activity of CeMYB154 are shown;

[0024] Figure 3 The identification of the obtained CeMYB154 transgenic Arabidopsis thaliana is shown, wherein A is the screening of T1 transgenic seedlings by kanamycin, B is the PCR identification of T1 transgenic plants, M is the DL2000 marker, 1-10 are transgenic plants, WT is the wild-type plant, and C is the detection of the expression level of CeMYB154 in T2 transgenic Arabidopsis thaliana;

[0025] Figure 4 Shows the identification of salt tolerance of transgenic Arabidopsis thaliana;

[0026] Figure 5 Shows the results of measuring different physiological indicators of wild-type and CeMYB154 transgenic Arabidopsis after salt stress. DETAILED DESCRIPTION

[0027] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application may be combined with each other. The present invention will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0028] It should be noted that, unless otherwise specified, all technical and scientific terms used in this application have the same meanings as commonly understood by ordinary technicians in the technical field to which this application belongs.

[0029] Experimental Materials

[0030] The tested plant materials were the salt-tolerant variety Yuyousha No. 2, wild-type Arabidopsis thaliana, and transgenic Arabidopsis thaliana overexpressing CeMYB154.

[0031] Test strains: Escherichia coli DH5α, Agrobacterium tumefaciens GV3101, and yeast AH109.

[0032] Example 1 Cloning of CeMYB154 gene and analysis of transcription factor characteristics of its encoded protein

[0033] Cloning of CeMYB154 gene

[0034] The cDNA extracted from the root samples of Cyperus oleifera seedlings under 100mmol / L NaCl stress for 24 hours was used as a template. PCR primers were designed, the forward primer was 5′-ATGGAGGAAGTGGCATGGAG-3′, and the reverse primer was 5′-CTAGTATAAAGCAAATTCTGCTGCTTGC-3′, and RT-PCR amplification was performed. The amplified products were subjected to electrophoresis, recovered, connected with T-vectors, and transformed into Escherichia coli DH-5α. After screening positive clones, sequencing was performed to obtain the cloned strains and plasmids with correct sequencing, and the cloning of CeMYB154 gene was completed.

[0035] CeMYB154 protein is localized in the nucleus

[0036] A fusion expression vector of CeMYB154 and EGFP 35S::EGFP-CeMYB154 was constructed, and the vector and the control 35S::EGFP were transformed into Agrobacterium, respectively. Positive bacteria were obtained and shake-cultured, and the collected bacteria were injected into tobacco epidermal cells respectively. After injection, the GFP fluorescence signal was observed using a laser confocal fluorescence microscope for 40-48 hours.

[0037] like Figure 1 As shown, green fluorescence was found in both the nucleus and cell membrane of tobacco epidermal cells transformed with 35S::EGFP, while green fluorescence was only found in the nucleus of tobacco transformed with 35S::EGFP-CeMYB154, indicating that the CeMYB154 protein was localized in the nucleus.

[0038] CeMYB154 protein has transcriptional activation activity

[0039] The pGBKT7-CeMYB154 plasmid was constructed, and pGADT7 / pGBKT7-CeMYB154, negative control pGADT7-LargeT / pGBKT7-LaminC, and positive control pGADT7-LargeT / pGBKT7-p53 were transformed into yeast competent AH109, ​​and the yeast solution was spread on -Trp / -Leu yeast defect plates and cultured in a 30°C constant temperature incubator for 2-3 days. Then, single clones were selected for yeast verification, diluted 1, 102, and 103 times with dd H2O, and spotted on -Trp / -Leu / -His / -Ade yeast defect plates containing X-α-Gal, inverted and cultured at 30°C for 3-4 days, and the yeast growth was observed.

[0040] like Figure 2 The results showed that the yeast co-transformed with pGADT7-LargeT+pGBKT7-P53 in the positive control group and pGADT7+pGBKT7-CeMYB154 in the experimental group could grow normally and turn blue, while the yeast co-transformed with pGADT7-LargeT+pGBKT7-LaminC in the negative control group could not grow, indicating that the CeMYB154 protein of Cyperus oleifera itself has transcriptional activation activity.

[0041] Therefore, the CeMYB154 protein of the present invention is a transcription factor localized in the cell nucleus and having transcription activation activity.

[0042] Example 2 Identification of the salt tolerance function of CeMYB154

[0043] Based on the overexpression vector pCMBIA2300 and the single restriction site of Sal I endonuclease, homologous recombination primers of CeMYB154 CDS sequence were designed, and the overexpression vector 35S::CeMYB154 was constructed by homologous recombination. The 35S::CeMYB154 vector plasmid was transformed into Columbia ecotype Arabidopsis thaliana (WT) by Agrobacterium-mediated floral dip method. The different transgenic Arabidopsis lines obtained were identified respectively, and the identification results are shown in Figure 3 After identification, the cells were cultured to the T3 generation and the homozygous transgenic lines were obtained for the following experiments.

[0044] Arabidopsis seedlings one week after germination were transplanted into MS solid culture medium containing 0, 50 and 100 mmol / L NaCl, respectively, and cultured horizontally and vertically in a light incubator. The morphological changes of the plants were observed after 2 weeks.

[0045] like Figure 4As shown in the figure, under salt stress treatment, compared with WT plants, the three transgenic lines grew better, had larger and greener leaves, suffered less damage from salt stress, and showed better salt tolerance. Similarly, when cultured upright, under salt stress conditions, there was a significant difference in the root growth state (especially length) between transgenic Arabidopsis and WT plants, and transgenic Arabidopsis plants were able to resist salt stress well.

[0046] The above results showed that compared with WT, the salt tolerance of Arabidopsis plants overexpressing CeMYB154 was greatly improved, indicating that CeMYB154 can positively regulate the salt tolerance of plants.

[0047] Example 3 Stress tolerance mechanism of CeMYB154

[0048] The leaves of transgenic and WT Arabidopsis plants after 24 hours of salt stress were used as materials to measure physiological indicators such as malondialdehyde, hydrogen peroxide, catalase, peroxidase, and superoxide dismutase.

[0049] like Figure 5 As shown, the malondialdehyde and hydrogen peroxide contents of the three transgenic lines were significantly lower than those of the WT plants, while the activities of three antioxidant enzymes (especially peroxidase) were significantly higher than those of the WT plants.

[0050] The above results indicate that CeMYB154 can positively regulate catalase, peroxidase, and superoxide dismutase in Arabidopsis, enhance the reactive oxygen scavenging ability of transgenic Arabidopsis plants under salt stress, and thus improve the salt tolerance of Arabidopsis.

[0051]

[0052]

[0053]

[0054] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A salt-tolerance gene of Cyperus oleifera, characterized in that: The nucleotide sequence of the cyperus oleifera salt-tolerance gene is SEQ ID No.1, and the amino acid sequence of the cyperus oleifera salt-tolerance gene is SEQ ID No.

2.

2. The salt-tolerant gene of Cyperus oleifera according to claim 1, characterized in that: The open reading frame of the salt-tolerant gene is 780 bp and encodes 259 amino acids in total.

3. The application of the salt-tolerant gene of Cyperus oleifera according to claim 2, characterized in that: The roots of Cyperus oleifera were used as plant materials. The target fragment was amplified by PCR and the overexpression vector of CeMYB154 was constructed. The vector was used for genetic transformation of Arabidopsis thaliana and the salt tolerance of transgenic Arabidopsis thaliana was analyzed and identified.

4. The application of the salt-tolerant gene of Cyperus oleifera according to claim 3, characterized in that: The sequences of the primers CeMYB154-F and CeMYB154-R are ATGGAGGAAGTGGCATGGAG and CTAGTATAAAGCAAATTCTGCTGCTTGC, respectively.

5. The application of the salt-tolerant gene of Cyperus oleifera according to claim 3, characterized in that: Pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 55°C for 10 s, and 72°C for 60 s, for 34 cycles; post-extension at 72°C for 10 min.

6. The application of the salt-tolerant gene of Cyperus oleifera according to claim 4, characterized in that: The expression level of the cyperus oleifera salt-tolerance gene increases in cyperus oleifera after salt stress treatment.

7. The application of the salt-tolerant gene of Cyperus oleifera according to claim 6, characterized in that: The cyperus oleifera salt-tolerance gene can be used to improve the salt tolerance of transgenic Arabidopsis thaliana.

8. The application of the salt-tolerant gene of Cyperus oleifera according to claim 7, characterized in that: Compared with the wild-type strain, the Arabidopsis thaliana CeMYB154 transgenic strain has significantly increased plant root length and better growth potential.

9. Use of the Cyperus oleifera salt-tolerance gene CeMYB154 according to claim 1 or 2 in breeding salt-tolerant Cyperus oleifera varieties.

Images