Kiwi fruit AcMYC2 gene as well as encoding protein and application thereof
By regulating the expression of the AcMYC2 gene of kiwi fruit, the problem of accelerated softening of fruit under low-temperature storage conditions after harvest was solved, the effect of extending storage time and improving the resistance to cold damage was achieved, and the tolerance of the fruit was improved.
Patent Information
- Application Number
- CN202510235026.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-28
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-02-28
AI Technical Summary
The fruit softening of kiwi fruit accelerates under low temperature storage conditions after harvest, resulting in a shortening of storage period and deteriorating fruit quality, which makes it difficult to meet the needs of consumers.
By overexpressing or silencing the kiwi AcMYC2 gene, the softening process and cold damage resistance of the fruit under low temperature storage conditions are regulated. Overexpression of the AcMYC2 gene can delay fruit softening and improve cold damage resistance, while silencing the AcMYC2 gene accelerates fruit softening.
By regulating the expression of the AcMYC2 gene, the storage time of kiwi fruits is significantly extended, its resistance to cold damage under low temperature storage conditions, and the storage tolerance of the fruit is improved.
Smart Images

Figure CN120099024A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of crop science, and specifically relates to a kiwifruit AcMYC2 gene and a coded protein and application thereof. Background Art
[0002] Methyl jasmonate (MeJA) is a ubiquitous growth regulator in plants and plays multiple roles in plants. MYC2 is a transcription factor in the jasmonic acid signaling pathway and plays an important role in promoting fruit enlargement and improving crop disease resistance. However, the MYC2 transcription factor in kiwifruit has not been reported, and its molecular mechanism has not been studied.
[0003] Kiwifruit (Actinidia chinensis) belongs to the Actinidiaceae family and is one of the fastest growing high-end fruits in the world in recent years. It is a respiratory climacteric fruit and is often stored at low temperatures to extend its shelf life. Fruit softening is an important indicator of the intrinsic quality of the fruit and an important feature of the fruit during ripening and post-harvest storage. Excessive softening of the fruit after harvest will shorten the storage and shelf life of the fruit, accelerate fruit decay and deterioration, and seriously damage the fruit's commercial value and economic benefits.
[0004] Low temperature storage is the most commonly used method to delay the post-harvest ripening of fruits and vegetables and maintain fruit quality. Low temperature can effectively inhibit the physiological metabolism of kiwifruit, reduce respiration intensity, reduce ethylene release rate, delay the occurrence time of peak respiration rate and peak ethylene release rate, effectively extend the storage period of kiwifruit, and improve the storage quality of the fruit. However, under long-term storage conditions, it is still difficult to maintain the quality of the fruit and meet the needs of consumers. It is also easy to cause chilling damage, resulting in deterioration of fruit quality. Therefore, strengthening the research on low-temperature storage mechanism and analyzing the fruit softening regulation network under low temperature can ensure the quality of kiwifruit after harvest and provide theoretical support for commercial operations. Summary of the invention
[0005] In view of the above-mentioned prior art, the purpose of the present invention is to provide a kiwifruit AcMYC2 gene and its encoded protein and application to regulate the fruit softening process of kiwifruit under post-harvest low-temperature storage conditions and improve the kiwifruit's resistance to chilling damage under post-harvest low-temperature storage conditions.
[0006] To achieve the above object, the present invention adopts the following technical solution:
[0007] In a first aspect, the present invention provides an AcMYC2 gene, wherein the AcMYC2 gene is derived from kiwi fruit, and the CDS nucleotide sequence of the AcMYC2 gene is shown in SEQ ID NO.1.
[0008] The second aspect of the present invention provides the use of the AcMYC2 gene in improving the low-temperature storage performance of fruits.
[0009] The fruit is a kiwi fruit or a tomato fruit.
[0010] The improving the low-temperature storage performance of the fruit includes: regulating the softening process of the fruit under the post-harvest low-temperature storage condition and / or improving the ability of the fruit to resist chilling damage under the post-harvest low-temperature storage condition.
[0011] By overexpressing the kiwifruit AcMYC2 gene, the expression of the AcMYC2 gene is promoted, the softening process of the fruit under post-harvest low-temperature storage conditions is delayed, the fruit's resistance to chilling damage under post-harvest low-temperature storage conditions is improved, and the storage resistance of the post-harvest fruit is positively regulated;
[0012] Alternatively, by silencing the kiwifruit AcMYC2 gene, the expression of the AcMYC2 gene can be inhibited, thereby accelerating the softening process of the fruit under post-harvest low-temperature storage conditions.
[0013] In a third aspect, the present invention provides the use of a protein encoded by the AcMYC2 gene in improving the low-temperature storage performance of fruits, characterized in that the amino acid sequence of the protein encoded by the AcMYC2 gene is shown in SEQ ID NO.2.
[0014] Through the kiwifruit AcMYC2 protein sequence, we searched and collected homologous proteins of kiwifruit and tomato in NCBI, and constructed an evolutionary tree using Mega5.1. We found that AcMYC2 was clustered with tomato SlMYC1 (Solyc10g009290.1.1) and SlMYC2 (Solyc01g096370.4.1) with a homology of 86%.
[0015] By promoting the activity of the protein encoded by the AcMYC2 gene of kiwifruit, the softening process of the fruit during post-harvest low-temperature storage was delayed, the resistance to chilling damage during post-harvest low-temperature storage was improved, and the storage tolerance of the post-harvest fruit was positively regulated.
[0016] Alternatively, the softening process of kiwifruit under postharvest low-temperature storage conditions can be promoted by inhibiting the activity of the protein encoded by the AcMYC2 gene.
[0017] Beneficial effects of the present invention:
[0018] The present invention discovered a gene AcMYC2 in the bHLH gene family from kiwifruit, and its CDS nucleotide sequence is shown in SEQ ID NO.1. Through research, it was found that under post-harvest low-temperature storage conditions, there was a significant positive correlation between the expression of the kiwifruit AcMYC2 gene and fruit storage. The present invention found that by silencing the kiwifruit AcMYC2 gene, the antioxidant enzyme activity in the kiwifruit fruit can be inhibited, the hydrogen peroxide content in the kiwifruit fruit can be significantly increased, and the fruit softening process under post-harvest low-temperature storage conditions can be accelerated; by overexpressing the kiwifruit AcMYC2 gene, the degradation rate of the original pectin content can be significantly reduced, the antioxidant enzyme activity in the fruit can be enhanced, the fruit softening process under post-harvest low-temperature storage conditions can be delayed, the storage time of the post-harvest fruit can be extended, and the fruit's resistance to cold damage under post-harvest low-temperature storage conditions can be improved, and the fruit's storage tolerance can be positively regulated. The research results of the present invention provide a new idea for cultivating storage-resistant fruit varieties, which helps to reduce the storage loss of fruits and improve production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 PCR amplification of the full-length cDNA of the AcMYC2 gene.
[0020] Figure 2 Subcellular localization of AcMYC2 protein.
[0021] Figure 3 Verification of AcMYC2 silencing at the transcriptional level in kiwifruit fruit.
[0022] Figure 4 It is the determination of physiological indexes of kiwi fruit softening; Figure 4 A is the determination of soluble solid content. Figure 4 B is the PG enzyme activity assay, Figure 4 Where C is the mass fraction of soluble pectin, Figure 4 Where D is the mass fraction of original soluble pectin.
[0023] Figure 5 Antioxidant enzyme activities and H in different groups of kiwifruit under two storage conditions 2 O 2 Determination of accumulation; Figure 5 A in the figure is the POD enzyme activity assay. Figure 5 B is the SOD enzyme activity assay. Figure 5 C is the APX enzyme activity assay. Figure 5 Where D is the determination of hydrogen peroxide content.
[0024] Figure 6 It is the determination of physiological indexes of tomato fruit softening; Figure 6 A in the middle is the PG enzyme activity detection, Figure 6 B in the middle is the firmness of the fruit. Figure 6Where C is the mass fraction of original soluble pectin, Figure 6 Where D is the mass fraction of soluble pectin.
[0025] Figure 7 Antioxidant enzyme activities and H in tomato fruits of different groups under two storage conditions 2 O 2 Determination of accumulation; Figure 7 A in the figure is the POD enzyme activity assay. Figure 7 B is the CAT enzyme activity assay, Figure 7 C is the SOD enzyme activity assay, Figure 7 Where D is the determination of hydrogen peroxide content.
[0026] Figure 8 To determine the lycopene content in tomato fruits under two storage conditions. DETAILED DESCRIPTION
[0027] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.
[0028] As mentioned above, kiwifruit is a type of respiratory climacteric fruit, and low-temperature storage is often used to extend the shelf life. However, under long-term low-temperature storage conditions, the quality of the fruit is difficult to maintain, and the fruit is also prone to chilling damage, resulting in deterioration of the fruit quality. AcMYC2 is a new gene in the bHLH gene family discovered in kiwifruit. For gene function research, changes in a single or several bases can affect the function of the gene. In the prior art, the role of the kiwifruit AcMYC2 gene in the storage resistance of the fruit under post-harvest low-temperature storage conditions has not been studied.
[0029] Based on this, the present invention provides a kiwifruit AcMYC2 gene and its encoded protein and application to regulate the softening process of fruits under post-harvest low-temperature storage conditions, improve the fruit's resistance to cold damage under post-harvest low-temperature storage conditions, and positively regulate the fruit's storage tolerance. The present application first discovered a new gene AcMYC2 in the bHLH gene family from kiwifruit, whose CDS nucleotide sequence is shown in SEQ ID NO.1, and is specifically as follows:
[0030] SEQ ID NO.1:
[0031] ATGACGGACTACCGATTACCGACGATGAATCTGTTGACGGACGATGCGGCCTCGATGTTCGTGACCTCCGATCTGACGGCGCTATGGCCGCAGCCGCCGTCATCCTCCGCCTCCAACTCCACCGCCACGGCGCCGCATCCGGCGTTCTTCAACCAGGAGACCCTCCAGCAGCGGCTTCAGGCCCTGATCGAGTGGGCCCGGGAGAGCTGGACCTACGCCATCTTCTGGCAGCCGTCGGCGGACTTCTCAGCTGGCGGATCTGTGCTCGGTTGGGGAGA
[0032] CGGCTACTACAAAGGCGACGAAGACAAGGCCAAGCACGCGGCGGCGGCGCCGTCG
[0033] TCGGAGGAGCAGGCGCACCGTAAGAAGGTCCTCCGCGAGCTAAGCTCGCTGATCTC
[0034] AGACGCACCGCCGTTGGCCGACGACACGGTGGAGGAGGAAGTCACCGACACCGAG
[0035] TGGTTCTTCCTCGTGTCGATGACTCAGTCGTTCGTCAATGGCAGCGGGCTTCCGGGT
[0036] CAGGCCCATTTCAGCTCATCCCCGATTTGGGTCACCGGATCCGAGCGTCTCGCGGCT
[0037] TCGCCCTGCGAGCGAGCGAGACAAGGCCAATTGTTCGGGTTACGGACCATGGTGTG
[0038] TATACCGTCCGTTAACGGAGTCTTGGAATTAGGTTCGACCCAATTGATCTTTCAGAG
[0039] TTCGGATCTGATGAATAAGGTTAGGATTTTATTCAATTTCAATAGTATCGAATCTAT
[0040] CGATACGGGCTCGTGGTCGGTGCCCGAAGAATCCGATCCTTCAACCGTGTATTTAAC
[0041] CGATCCTGCGGCTGAAATCAGAGAATCGGTGAACACTACTTCTCCATCAATTCTATC
[0042] TAATAGTCATCAATTGTCAAAGCACATCGAATTCGAAAACCCTATTGCAATTCAGG
[0043] CTTCAAATCACAACACCCACCCACAAAACCAACAACAATTTGCCAGAAAATTAAAT
[0044] TTTTTTGAATTTGGCCATGACGGGAGTAGTATTCGGAATGATAATTCGTTTTCATGC
[0045] AAGCCCGAGTCCGGTGAGGTATTGAGTTTTGGGGAAAGTAAGAAGAGCTCGTGTAG
[0046] TGCAAATGTCAATCCCTTAACGGGTCATTCCCAATTCGGGGCTGCGAAGGATACGA
[0047] ATAAGAAGAGATCAGTCACTTCCCGGGGTAGCGACGAAGAAGGCATGCTTTCGTTT
[0048] GGCTCGGGTGTGATCTTGCCCTCTTCAGGGGCAGTGAAGTCGAGCTGCGGTGGTGG
[0049] TGGAGATTCAGACCACTCTGATCTCGAAGCATCCGTGATTCGTGAGGCTGAGAGCA
[0050] GCAGAGTCATAGATCCGGAGAAAAAGCCTCGCAAGCGGGGGAGAAAGCCCGCGAA
[0051] TGGAAGGGCAGAGCCATTGAATCACGTTGAGGCTGAAAGGCAGAGGCGAGAAAAG
[0052] CTTAACCAGAGGTTCTATGCGCTCAGGGCGGTGGTTCCAAATGTGTCGAAAATGGA
[0053] CAAAGCTTCGCTTCTTGGAGACGCCATTTCTTACATCAACCAGCTCAAATCCAAGCT
[0054] TCTAGCTGCAGAGTCTGACAAGGAAGAAATGAGGGACCAAATGGAGGCTTTGAAG
[0055] AAAGAATTGGCCAGTGAAAAATCTCGATTTTCAGGTCCACATCCACCTGATAAAAA
[0056] TCTCAAAACACCCAATCACCATGGAAGCCATCTGATAGATGTGGATATTGATGTGA
[0057] AGATAATTGGGAGGGACGCGATGATTCGGATCCAGTGTAACAAGAAGAACCACCCT
[0058] GCAGCGAGGCTAATGTCGGCTCTGAGAGAGCTAGACCTCGATGTGCACCATGCCAG
[0059] TGTGTCGGTAGTGAATGATTTGATGATCCAACAGGCCTCTGTGAAGATGGGTGGTC
[0060] GATTTTACACCCAAGAGCAGCTCAAGCTTGCTCTATCGTCTAAAATTGCTGATATTC
[0061] GATAA。
[0062] The amino acid sequence of the protein encoded by the AcMYC2 gene is shown in SEQ ID NO.2, specifically as follows:
[0063] SEQ ID NO.2:
[0064] .
[0065] Furthermore, the study found that under post-harvest low-temperature storage conditions, there was a significant positive correlation between the expression of the kiwifruit AcMYC2 gene and fruit hardness; by silencing the kiwifruit AcMYC2 gene, the activity of antioxidant enzymes in the kiwifruit fruit can be inhibited, the hydrogen peroxide content in the kiwifruit fruit can be significantly increased, and the fruit softening process under post-harvest low-temperature storage conditions can be accelerated; by overexpressing the kiwifruit AcMYC2 gene, the degradation rate of the protopectin content can be significantly reduced, the activity of antioxidant enzymes in the fruit can be enhanced, the fruit softening process under post-harvest low-temperature storage conditions can be delayed, the storage time of the post-harvest fruit can be extended, and the fruit's resistance to cold damage under post-harvest low-temperature storage conditions can be improved.
[0066] The following detailed description is for illustrative purposes only and is intended to provide further explanation of the present application, rather than to limit the scope of the present invention.
[0067] Example 1: Cloning of the AcMYC2 gene and subcellular localization of the protein encoded by the AcMYC2 gene
[0068] (1) Cloning of AcMYC2 gene
[0069] Extract kiwifruit DNA as template and use Actin as internal reference gene (Yolanda Ferradás, Laura Rey, Martínez,Manuel Rey,M a Victoria González, Identification and validation of reference genes for accurate normalization of real-time quantitative PCR data in kiwifruit, Plant Physiology and Biochemistry, Volume 102, 2016, Pages 27-36.), according to the CDS sequence of AcMYC2 predicted by transcriptome sequencing, primers shown in SEQ ID NO.3-SEQ ID NO.4 were designed to amplify the AcMYC2 gene, and primers shown in SEQ ID NO.5-SEQ ID NO.6 were used to amplify Actin. The amplification results are shown in FIG. Figure 1 As shown, the amplified band was recovered by agarose gel to obtain an AcMYC2 gene fragment with a size of 1911 bp.
[0070] SEQ ID NO.3:
[0071] GAGCTCGGTACCCGGGGATCCATGAATCTGTTGACGGAC;
[0072] SEQ ID NO.4:
[0073] TTCTCCTTTACTCATGTCGACTCGAATATCAGCAATTTTAG.
[0074] SEQ ID NO.5:
[0075] CCACCACGGAGACGGAGCAC;
[0076] SEQ ID NO.6:
[0077] TGCAGATCTTCGTGAAAACC.
[0078] (2) Subcellular localization of the protein encoded by the AcMYC2 gene
[0079] To clarify the localization of AcMYC2 protein in cells, the CDS of AcMYC2 was connected to the 35S::Pzp211-GFP expression vector, and then the constructed fusion plasmid and p35S::GFP plasmid were transformed into Agrobacterium GV3101 and transiently infected with Nicotiana benthamiana. After 2 days of culture, two-photon laser confocal microscopy revealed that the fluorescence of p35S::GFP was distributed in the cytoplasm and nucleus, while the fluorescence of AcMYC2 fusion green protein was localized in the nucleus ( Figure 2 ), the blue fluorescence of nuclear indicator DAPI is localized in the cell nucleus, and the two overlap in the fusion image, indicating that AcMYC2 protein is localized in the cell nucleus.
[0080] Example 2: AcMYC2 gene silencing positive fruit and overexpression positive fruit acquisition
[0081] 1. AcMYC2 gene silencing positive fruit acquisition
[0082] (1) A 360 bp AcMYC2-specific gene fragment was amplified using the primers shown in SEQ ID NO.7-SEQ ID NO.8, and the AcMYC2-specific gene fragment was homologously recombined with the TRV2 vector to obtain TRV2-MYC2.
[0083] pTRV2-F:AGAAGGCCTCCATGGGGATCCAATTAGGTTCGACCCAAT (SEQ ID NO.7);
[0084] pTRV2-R:GGGACATGCCCGGGCCTCGAGAATTATCATTCCGAATACTACT (SEQ ID NO. 8).
[0085] (2) TRV-mediated viral silencing technology was used to transiently silence kiwifruit. The specific method is as follows: 60 kiwifruits of uniform size and free of pests and diseases during the color change period of 'Taishan No. 1' were taken and divided into three equal parts as infection materials. A disposable sterile syringe (1 mL) was used to inject an equal volume of TRV2-MYC2 and TRV1 mixed bacterial suspension, and 100 μL was evenly injected from two horizontal directions perpendicular to the central axis of the fruit. The injection depth was about 2 cm. Fruits injected with sterile water and empty vector were used as negative controls. After the first injection, the injection was repeated at the same pinhole position of the fruit every 1 day, for a total of 2 injections. All fruits were placed in a constant temperature incubator at 25°C away from light and the relative humidity was controlled at 70%.
[0086] 2. AcMYC2 gene overexpression vector positive fruit acquisition
[0087] The constructed AcMYC2-GFP vector (obtained by homologous recombination of the AcMYC2 gene fragment obtained in Example 1 with the p35S::GFP plasmid vector) was used to transform Agrobacterium LBA4404, and genetic transformation of tomato (Solanum lycopersicum, Micro Tom) was performed using the leaf disc method. Positive plants were screened to obtain overexpression strains.
[0088] Example 3: Verification of AcMYC2 silencing at the transcriptional level in fruit
[0089] In order to detect the expression of AcMYC2 gene in postharvest kiwifruit, RNA was extracted from the fruits of wild type (WT), empty vector group (TRV2) and AcMYC2 gene silenced positive plants (AcMYC2-silenced) of kiwifruit by conventional methods and reverse transcribed into cDNA, and then qRT-PCR verification of AcMYC2 gene was performed using primers shown in SEQ ID NO.9-SEQ ID NO.10.
[0090] QRT-AcMYC2-F: GCCGCAGGATCGGTTAAATA (SEQ ID NO.9);
[0091] QRT-AcMYC2-R:CTACTACAAAGGCGACGAAGAC (SEQ ID NO. 10).
[0092] The results show that the relative expression of AcMYC2 gene in the AcMYC2 gene silencing positive plants is the lowest. Taking WT as the control group, the relative expression of AcMYC2 gene in the silencing group decreased by 61.75%, while the relative expression of AcMYC2 gene in the empty group and WT group was almost unchanged ( Figure 3 ).
[0093] Example 4: Effect of AcMYC2 gene silencing on kiwifruit quality
[0094] (1) Cell wall material metabolism
[0095] The fruits of wild-type kiwifruit (WT), empty vector group (TRV2) and AcMYC2 gene silenced positive plants (AcMYC2-silenced) were stored at 4°C for 7 days. The fruits of wild-type kiwifruit (WT), empty vector group (TRV2) and AcMYC2 gene silenced positive plants (AcMYC2-silenced) stored at room temperature for 7 days were used as controls. The soluble solids content, soluble and original soluble pectin mass fractions and PG enzyme activity in the fruits of different treatments were determined.
[0096] According to the test results, after silencing AcMYC2 in kiwifruit, the soluble solid content, soluble and original soluble pectin mass fraction and PG enzyme activity of kiwifruit fruits under low temperature conditions (CT) decreased compared with those under normal temperature storage conditions (NT). Under the same low temperature condition of 4°C, the soluble solid content increased by 9.6% ( Figure 4 A), PG activity increased by more than 28.5% ( Figure 4 B), the mass fraction of soluble pectin increased by more than 26.3% ( Figure 4 These data indicate that the expression level of AcMYC2 gene is negatively correlated with the storage time of 'Taishan No. 1' kiwifruit under low temperature storage conditions.
[0097] (2) Antioxidant enzyme activity and reactive oxygen species
[0098] SOD, POD and APX are antioxidant enzymes in the fruit, which play an important role in removing active oxygen in the fruit and maintaining the normal physiological metabolic activities of kiwi fruit.
[0099] The fruits of wild-type (WT), empty vector group (TRV2) and AcMYC2-silenced plants of kiwifruit were stored at 4℃ for 7 days. The fruits of wild-type (WT), empty vector group (TRV2) and AcMYC2-silenced plants of kiwifruit stored at room temperature for 7 days were used as controls. The antioxidant enzyme activities and H+ / - activity of kiwifruit in each group under the two storage conditions were measured. 2 O 2 to investigate whether AcMYC2 affects the activity of antioxidant enzymes and the accumulation of reactive oxygen species under low-temperature storage.
[0100] The experimental results showed that compared with normal temperature storage conditions (NT), the peroxidase activity in kiwifruit fruits under low temperature conditions (CT) was significantly increased and the reactive oxygen content was reduced, indicating that low temperature storage is helpful to improve the quality of kiwifruit fruits. Under low temperature conditions, silencing AcMYC2 reduced the POD activity in kiwifruit fruits by 45.2% ( Figure 5 A), SOD activity decreased by 43.2% ( Figure 5 B), APX activity decreased by 23.3% ( Figure 5 C). The hydrogen peroxide content increased by 28.6% ( Figure 5 The above results showed that under low temperature conditions, silencing AcMYC2 significantly inhibited the antioxidant enzyme activity in the fruit of 'Taishan No. 1' kiwifruit, significantly increased the hydrogen peroxide content in the fruit of 'Taishan No. 1' kiwifruit, and accelerated the softening process of kiwifruit under low temperature storage conditions after harvest.
[0101] Example 5: Effect of overexpression of AcMYC2 gene on tomato fruit quality
[0102] (1) Effect of overexpression of AcMYC2 on tomato fruit firmness during low-temperature storage
[0103] Tomato fruits of the wild type (WT), empty vector group (35S-GFP) and AcMYC2 overexpression positive plants (OE) that were in the color breaking stage (the transition period from green to red ripe fruit, yellow or light red spots appeared around the navel, and the red surface of the fruit was less than 10%) were picked and stored at 4℃ for 7 days. The tomato fruits of the wild type (WT), empty vector group (35S-GFP) and AcMYC2 overexpression positive plants (OE) stored at room temperature for 7 days (in the color breaking stage for 10 days) were used as controls. The hardness of tomato fruits of the overexpression lines treated at low temperature and room temperature was tested using a CTX texture analyzer, and the soluble pectin, native soluble pectin and PG activity of tomatoes in each group under the two storage conditions were determined.
[0104] The results showed that the firmness of tomato fruit under low temperature storage (CT) was significantly higher than that under normal temperature storage (NT). Under 4°C, overexpression of AcMYC2 reduced the activity of PG enzyme by more than 15.3% ( Figure 6 B), the mass fraction of soluble pectin decreased by more than 28.3% ( Figure 6 D), while the mass fraction of original soluble pectin increased by more than 26.3% ( Figure 6 (C) After AcMYC2 was overexpressed, the degradation rate of protopectin content was significantly reduced during fruit ripening, and the accumulation of soluble pectin was reduced, indicating that overexpression of the AcMYC2 gene inhibited the degradation of protopectin. In summary, under low temperature conditions, increased expression of AcMYC2 is beneficial to enhancing the firmness of tomato fruit, and overexpression of AcMYC2 increases the storage resistance of tomato fruit.
[0105] (2) Effects of overexpression of AcMYC2 on antioxidant enzyme activity and reactive oxygen species in tomatoes under low temperature conditions
[0106] The fruits of wild-type tomato (WT), empty vector group (35S-GFP) and AcMYC2 overexpression positive plants (OE1, 2, 3) were stored at 4℃ for 7 days. The fruits of wild-type tomato (WT), empty vector group (35S-GFP) and AcMYC2 overexpression positive plants (OE) stored at room temperature for 7 days were used as controls. The antioxidant enzyme activities and H2O2 content of tomatoes in each group under the two storage conditions were measured. 2 O 2 accumulation situation.
[0107] The experimental results showed that compared with normal temperature storage conditions (NT), low temperature treatment (CT) significantly increased the activities of SOD, POD and CAT, while the content of reactive oxygen in tomato fruits decreased. Under low temperature treatment conditions, the activities of SOD, POD and CAT in overexpressed tomato fruits were higher than those in the empty group. The results showed that low temperature affected the antioxidant enzyme activity of tomatoes by affecting the expression of AcMYC2.
[0108] (3) Effect of AcMYC2 overexpression on lycopene content in tomato fruit
[0109] Lycopene is an important antioxidant in tomato fruit, with antioxidant, bactericidal and free radical scavenging properties. The fruits of tomato wild type (WT), empty vector group (35S-GFP) and AcMYC2 overexpression positive plants (OE) were stored at 4℃ for 7 days, and the fruits of tomato wild type (WT), empty vector group (35S-GFP) and AcMYC2 overexpression positive plants (OE) stored at room temperature for 7 days were used as controls. The lycopene content of the three groups of fruits, WT, empty vector and AcMYC2 overexpression, under two storage conditions was determined.
[0110] The method for determining the lycopene content is as follows: weigh 1.5 g of tomato fruit, grind it thoroughly in a mortar, transfer it to a 10 mL centrifuge tube, add 6 mL of a mixed solution of n-hexane: acetone: ethanol = 1:1:1, shake it at 150 rpm in a shaker for 30 min, add 2 mL of distilled water after the shaking, centrifuge it at 5000×g for 15 min, and take the supernatant to measure the absorbance at 502 nm.
[0111] The results showed that among all components, the lycopene content in tomato fruits after low-temperature storage was higher than that in normal temperature storage, and low-temperature storage reduced the decrease in lycopene content. Under low-temperature storage conditions, the lycopene content in overexpressing transgenic tomato fruits was 28.4%, 33.1% and 31.6% higher than that in the empty group, which indicates that the increase in AcMYC2 expression increased the lycopene content in tomato fruits.
[0112] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. An AcMYC2 gene, characterized in that: The AcMYC2 gene is derived from kiwi fruit, and the CDS nucleotide sequence of the AcMYC2 gene is shown in SEQ ID NO.
1.
2. Use of the AcMYC2 gene according to claim 1 in improving the low-temperature storage performance of fruits.
3. The use according to claim 2, characterized in that: The fruit is a kiwi fruit or a tomato fruit.
4. The use according to claim 2, characterized in that: The improving the low-temperature storage performance of the fruit includes: regulating the softening process of the fruit under the post-harvest low-temperature storage condition and / or improving the ability of the fruit to resist chilling damage under the post-harvest low-temperature storage condition.
5. The use according to claim 4, characterized in that: By overexpressing the kiwifruit AcMYC2 gene, the expression of the AcMYC2 gene is promoted, the softening process of the fruit under post-harvest low-temperature storage conditions is delayed, the fruit's resistance to chilling damage under post-harvest low-temperature storage conditions is improved, and the storage resistance of the post-harvest fruit is positively regulated; Alternatively, by silencing the kiwifruit AcMYC2 gene, the expression of the AcMYC2 gene can be inhibited, thereby accelerating the softening process of the fruit under post-harvest low-temperature storage conditions.
6. Application of the protein encoded by the AcMYC2 gene in improving the low-temperature storage performance of fruits, characterized in that: The amino acid sequence of the protein encoded by the AcMYC2 gene is shown in SEQ ID NO.
2.
7. The use according to claim 6, characterized in that: By promoting the activity of the protein encoded by the AcMYC2 gene of kiwifruit, the softening process of the fruit during post-harvest low-temperature storage was delayed, the resistance to chilling damage during post-harvest low-temperature storage was improved, and the storage tolerance of the post-harvest fruit was positively regulated. Alternatively, the softening process of kiwifruit under postharvest low-temperature storage conditions can be promoted by inhibiting the activity of the protein encoded by the AcMYC2 gene.
Citation Information
Patent Citations
sweet orange CsMYB120 gene and application thereof
CN110760526A
Application of dihydroxy acid dehydratase AcDHAD in improving disease resistance of kiwi fruits
CN119320796A