Rice negative regulation grain length gene WRKY51 and application thereof

Abstract

The invention relates to a rice negative regulation grain type gene WRKY51. The gene comprises (a) a nucleotide sequence as shown in SEQ ID No: 1; and (b) a nucleotide sequence which is generated by adding, substituting or deleting one or more basic groups from the nucleotide sequence as shown in SEQ ID No: 1 and is used for coding the rice grain type functional protein. The invention belongs to the technical field of gene engineering. By knocking out the gene, the grain length of the rice is shortened.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a rice negative regulation grain length gene WRKY51 and an application thereof. Background Art

[0002] Rich rice resources contain many grain-type genes. Discovering and identifying excellent genes can broaden the gene sources for rice breeding and enrich the genetic background. Discovering and utilizing rice grain-type genes is an effective way to increase rice yield. Grain-type genes need to be verified by transgenic verification or by constructing populations, near-isogenic lines, and other methods. It is difficult to discover grain-type genes obtained through natural variation in rice. Summary of the invention

[0003] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a rice negative regulation grain length gene WRKY51 and its application.

[0004] To achieve the above object, the technical solution adopted by the present invention is:

[0005] In a first aspect, the present invention provides a rice grain shape regulating gene WRKY51, wherein the gene has the following nucleotide sequence (a) or (b):

[0006] (a) having a nucleotide sequence as shown in SEQ ID No: 1;

[0007] (b) The nucleotide sequence shown in SEQ ID No: 1 is generated by adding, substituting or deleting one or more bases, and encodes a nucleotide sequence of a rice grain-type functional protein.

[0008] In a second aspect, the present invention provides use of the WRKY51 gene described in the first aspect in regulating rice grain shape.

[0009] As a preferred embodiment of the second aspect, the grain length of rice is shortened by knocking out the WRKY51 gene.

[0010] In a third aspect, the present invention provides a protein that negatively regulates rice grain shape, wherein the protein is encoded by the gene described in the first aspect.

[0011] In a fourth aspect, the present invention provides use of the protein described in the third aspect in regulating rice grain shape.

[0012] In a fifth aspect, the present invention provides a recombinant vector, which removes the nucleotide fragment amplified by the primers with sequences as shown in SEQ ID No: 5 to 8, and the recombinant vector makes the gene described in the first aspect lose its function.

[0013] In a sixth aspect, the present invention provides a biomaterial comprising the recombinant vector described in the fifth aspect.

[0014] As a preferred embodiment of the sixth aspect, the biological material is a recombinant microorganism, a transgenic plant cell line or a transgenic plant tissue; the recombinant microorganism is a bacterium, a yeast, an algae or a fungus; the bacterium is one of Escherichia, Erwinia, Agrobacterium tumefaciens, Flavobacterium, Alcaligenes, Pseudomonas or Bacillus.

[0015] In a seventh aspect, the present invention provides use of the recombinant vector described in the fifth aspect or the recombinant microorganism described in the sixth aspect in regulating rice grain shape.

[0016] In an eighth aspect, the present invention provides a method for cultivating transgenic rice with shortened grain length, wherein the method utilizes a gene knockout tool to knock out the WRKY51 gene in the recipient rice, thereby reducing the expression level of the WRKY51 gene in the recipient rice, and obtaining transgenic rice with short grains.

[0017] As a preferred embodiment of the eighth aspect, the gene knockout tool knocks out the nucleotide sequence in the WRKY51 gene as shown in SEQ ID No: 2-3. The target sequence for knocking out the WRKY51 gene of the present invention is shown in SEQ ID No: 2-3.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention identifies the gene WRKY51 encoding the length of rice grain type. When the function of the gene WRKY51 encoding the length of rice grain type is lost, short-grain rice will be obtained, proving that the protein of the gene encoding the length of rice grain type or its protein plays an important role in controlling the grain type of rice. The present invention not only provides a basis for further clarifying the molecular mechanism of rice grain type, but also provides new gene resources and breeding resources for rice breeding. The transgenic rice with the WRKY51 gene lost obtained by the present invention can be used as a new rice germplasm material to study the mechanism of rice grain type and discover more genes regulating rice grain type, and has important application value for effectively regulating rice grain type by using the gene resources through genetic breeding and genetic engineering methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a schematic diagram of the sequencing results of WRKY51 gene knockout rice;

[0021] Figure 2 Schematic diagram of grain length data of plants with different WRKY51 gene knockouts. DETAILED DESCRIPTION

[0022] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0023] Example 1

[0024] The technical scheme for constructing the knockout vector of the rice grain growth and development-related coding gene WRKY51 is as follows:

[0025] Using the reverse transcribed cDNA of the rice variety Nipponbare as a template, PCR amplification was performed with the following primers to obtain the target gene targets Target1 and Target2:

[0026] Target1: CCN AGTTCAAGAAGGTGATCTCC (SEQ ID No: 2)

[0027] Target2:GGCCACGCGCGGTTCCGGCG NGG(SEQ ID No:3)

[0028] T2-reverse: CCN CGCCGGAACCGCGCGTGGCC (SEQ ID No: 4)

[0029] MT1-BsF:ATATATGGTCTCTGGCGAGTTCAAGAAGGTGATCTCGTT(SEQ ID No:5)

[0030] MT1-BsR:GAGTTCAAGAAGGTGATCTCGTTTTAGAGCTAGAAATAGC (SEQ ID No: 6)

[0031] MT2-F0:AACCGCCGGAACCGCGCGTGGCCCGCTTCTTGGTGCC(SEQ IDNo:7)

[0032] MT2-R0:ATTATTGGTCTCTAAACCGCCGGAACCGCGCGTGGCC(SEQ ID No:8)

[0033] WRKY51 gene nucleotide sequence:

[0034] ATGATTACCATGGATCTGATGGGTGGGTACGGGCGGGTGGACGAGCAGGTGGCCATCCAGGAGGCGGCGGCGGCGGGGCTAAGGGGGATGGAGCATCTTATTCTGCAGCTGTCCCAGACTGGGACGAGCGAGAGGTCGCCGGCGCCGGCGCAGGAGCAGCAGCAACAGGTGGACTGCAGGGAGATCACGGACATGACGGTGTCCAAGTTCAAGAAGGTGATCTCCATGCTGAACCGCACCGGCCACGCGCGGTTCCGGCGGGGCCCGGTGGTGGCGCAGTCGTCGGGCCCGGCGGCGTCCGAGCCGGCGCCGGTGAGGTCGTCCCCGTCGGCGGTGTCGAGGCCCATGACGCTCGACTTCACCAAGGCGGCGTCCGGGTACGGCAAGGACGCCGGGTTCAGCGTCTCCGGCATCTCCGCCGCGAGCTCGTCCTTCCTCTCGTCGGTCACCGGCGACGGCAGCGTGTCCAACGGGCGCGGCGGCGGGTCATCCTCCCTGATGCTTCCCCCGCCGCCGGCGACCAGCTGCGGCAAGCCACCGCTGTCCTCCGCCGCCGCCGCCATGTCAGCCGGCGCAGGCCACAAGCGCAAGTGCCACGACCACGCGCACTCCGAGAACGTCGCCGGCGGCAAGTACGGATCCACCGGCGGCCGCTGCCACTGCTCCAAGCGCCGGAAGCATCGGGTGAAGAGGACGATCCGCGTGCCGGCGATAAGCTCGAAGGTGGCGGACATCCCCGCCGACGACTTCTCGTGGCGGAAGTACGGGCAGAAGCCCATCAAGGGCTCCCCCTTCCCACGAGGATACTACAAGTGTAGCACGCTGCGCGGTTGCCCGGCGAGGAAGCACGTGGAGCGCGACCCGACCGACCCGTCCATGCTCATCGTCACCTACGAGGGCGAGCACCGCCACTCCCCCTCCGCCGCCGGCCAGGACCACCCGCCGGCGCCGCCTCCGCCGCTGGCGCTGCCGCTCGCCTGA(SEQ ID No:1)

[0035] 1. CRISPR / Cas9 vector construction

[0036] (1) Primer design: Two target sites were screened on the first exon of the WRKY51 gene using an online website (http: / / crispor.tefor.net / ). Primers MT1-BsF / BsR were designed based on target site 1 (Target1), and MT2-F0 / R0 was designed based on target site 2 (Target2) (Note: the 19-nt sequence in Target1 was replaced with the 19-nt in the amplification product of primers MT1-BsF / BsR; the inverted complementary sequence of 19-nt in Target2 was replaced with the 19-nt in the amplification product of MT2-F0 / R0).

[0037] (2) Obtaining the target fragment: Four-primer PCR amplification was performed using the intermediate vector pCBC-MT1T2 (from Shanghai Shizhi Biotechnology) diluted 100 times as a template (MT1-BsF / MT2-F0 primers were at normal primer concentrations; MT1-BsR / MT2-R0 primers were diluted 20 times), using the Tks Gflex DNA polymerase PCR amplification system and program.

[0038] (3) Recover the target PCR product by agarose gel electrophoresis using a DNA gel recovery kit.

[0039] (4) Establishing an enzyme digestion-ligation system

[0040] Enzyme digestion-ligation system (15 μL): 2 μL PCR recovery fragment (964 bp), 2 μL pBUE411 plasmid, 1.5 μL 10×T4 Buffer, 1.5 μL T4 Ligase, 1 μL BsaI, 1 μL 10×Cutsmart buffer, make up the volume to 15 μL. Reaction conditions: 37℃5hours; 50℃5min; 80℃10min.

[0041] (5) Heat shock method to transform Escherichia coli

[0042] Take 5 μL of the ligation product in (4) and transform Escherichia coli using the heat shock method. The specific steps refer to the Tiangen transformation kit.

[0043] (6) Bacterial liquid PCR verification

[0044] A single colony was picked as a template for PCR amplification in an ultra-clean workbench, using the Taq DNA polymerase PCR amplification system and procedure.

[0045] (7) Extracting plasmid: Extract the plasmid and detect the concentration according to the instructions of Tiangen Plasmid Extraction Kit to obtain the CRISPR / Cas9-WRKY51 gene editing CRISPR / cas9 plasmid vector.

[0046] 2. PCR identification of CRISPR / Cas9-WRKY51 transgenic plants with knockout of WRKY51, a gene encoding rice grain shape

[0047] 1. Cultivation of CRISPR / Cas9-WRKY51 transgenic plants:

[0048] The recombinant vector CRISPR / Cas9-WRKY51 was transformed into Nipponbare japonica rice through Agrobacterium tumefaciens EHA105 to obtain T0 generation seedlings of plants transformed with CRISPR / Cas9-WRKY51 (abbreviated as KO1 and KO2 in the figure, transformation events transformed into different callus tissues).

[0049] 2. Identification of CRISPR / Cas9-WRKY51 transgenic plants:

[0050] The genomic DNA of the T0 generation seedlings of KO1 and KO2 plants and the seedlings of the recipient parent rice Nipponbare japonica rice plants (referred to as Nip in the attached figure) were extracted, and the positive seedlings were identified by PCR molecular detection using the following primers, and sequence verification was performed. The homozygous plants with sequence mutations, namely the KO1 and KO2 mentioned above ( Figure 1 );

[0051] WRKY51-Detection F: GTGGACTGCAGGGAGATCAC (SEQ ID No: 9)

[0052] WRKY51-detection R: GTCATGGGCCTCGACACC (SEQ ID No: 10)

[0053] PCR system:

[0054] PCR SuperMix (+ dye) 5 μl, 100 ng / ml primer 3 1 μl, primer 4 1 μl, DNA 1 μl, ddH2O 2 μl Amplification program:

[0055] 94℃ 2min;

[0056] ↓

[0057] 98℃ 10sec;

[0058] 55℃ 30sec;

[0059] 68℃ 1min. / kb 25~40cycles.

[0060] 3. Identification of WRKY51 expression levels in transgenic plants with WRKY51 knockout, a gene encoding rice grain shape:

[0061] RNA was extracted from leaves of KO1, KO2 plants and recipient parent rice Nipponbare plants (referred to as Nip), and WRKY51 gene-specific primers WRKY51-detect-F and WRKY51-detect-R were used for PCR amplification, and sequence mutations of WRKY51 genes in different transgenic plants were detected by sequencing.

[0062] The results show that ( Figure 1 ), the WRKY51 gene lost its function in the positive plants transformed with the recombinant vector Cas9-WRKY51. The above primers are as follows:

[0063] WRKY51-Detection F: 5'-GTGGACTGCAGGGAGATCAC-3' (SEQ ID No: 9)

[0064] WRKY51-Detection R: 5'-GTCATGGGCCTCGACACC-3' (SEQ ID No: 10)

[0065] 4. Phenotypic identification of transgenic plants with knockout of WRKY51, a gene encoding rice grain shape

[0066] The above-mentioned KO1, KO2 plants and the recipient parent rice Nipponbare were planted in the Hainan experimental base, and the rice was harvested and the grain length was measured after it matured.

[0067] The measurement results are shown in Table 1. Figure 2 Compared with the recipient parent rice Nipponbare plant (NiP), the WRKY51 knockout plants KO1 and KO2 both showed a phenotype of rice grain length significantly shorter than that of the control group (NiP) (P < 0.05), which proved that the WRKY51 gene is involved in controlling the grain shape of rice, that is, the WRKY51 gene is a rice grain shape-related gene, and knocking out the WRKY51 gene can regulate the grain shape of rice, specifically, knocking out this gene can shorten the length of rice grains.

[0068] Table 1: Grain length performance of rice plants with WRKY51 gene knockout

[0069] serial number Grain length (%) Standard error of grain length (%) Nip 7.63 1.3％ KO1 7.11 1.0％ KO2 7.16 1.2％

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A rice negative regulation gene WRKY51, characterized in that: The gene has the following nucleotide sequence (a) or (b): (a) having a nucleotide sequence as shown in SEQ ID No: 1; (b) The nucleotide sequence shown in SEQ ID No: 1 is generated by adding, substituting or deleting one or more bases, and encodes a nucleotide sequence of a rice grain-type functional protein.

2. Use of the WRKY51 gene according to claim 1 in regulating rice grain shape.

3. The use according to claim 2, characterized in that: The grain length of rice was shortened by knocking out the WRKY51 gene.

4. A protein that negatively regulates rice grain shape, characterized in that: The protein is encoded by the gene according to claim 1.

5. Use of the protein according to claim 4 in regulating rice grain shape.

6. A recombinant vector, characterized in that: The nucleotide fragment amplified by the primers with sequences as shown in SEQ ID Nos: 5 to 8 is removed, and the recombinant vector causes the gene of claim 1 to lose its function.

7. A biomaterial, characterized in that: Contains the recombinant vector as claimed in claim 6.

8. The biomaterial according to claim 7, characterized in that The biological material is a recombinant microorganism, a transgenic plant cell line or a transgenic plant tissue; the recombinant microorganism is a bacterium, a yeast, an algae or a fungus; the bacterium is one of Escherichia, Erwinia, Agrobacterium tumefaciens, Flavobacterium, Alcaligenes, Pseudomonas or Bacillus.

9. Use of the recombinant vector according to claim 6 or the recombinant microorganism according to claim 7 in regulating rice grain shape.

10. A method for cultivating transgenic rice with shortened grain length, characterized in that: The method utilizes a gene knockout tool to knock out the WRKY51 gene in the recipient rice, so that the WRKY51 gene in the recipient rice loses its function, thereby obtaining short-grain transgenic rice.

Images