PHS gene for improving ready-to-eat property of fruits and application of PHS gene
By overexpressing the PHS gene in plants such as kiwi fruit and tomato, the problem of insufficient ready-to-eat fruit is solved, and the fruit starch degradation is achieved more fully and the content of soluble solids is significantly improved.
Patent Information
- Application Number
- CN202510580179.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-07
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-05-07
AI Technical Summary
The prior art is difficult to effectively improve the ready-to-eat properties of fruits such as kiwi fruit, especially during the softening process after low-temperature pretreatment.
By studying and applying the α-glucan phosphorylase (PHS) gene, the expression vector is constructed and transformed into Agrobacterium, and then the recombinant expression strain is transformed into plants such as kiwi fruit and tomato, so as to achieve overexpression of the PHS gene, thereby promoting the degradation of fruit starch and the increase of soluble solids.
Through the overexpression of the PHS gene, the soluble solid content of the fruit is significantly improved, the titrable acid content is reduced, and the maturity and ready-to-eat nature of the fruit is promoted.
Smart Images

Figure CN120099047A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of biotechnology, and in particular to a PHS gene for improving the edible quality of fruits and its application. Background Art
[0002] Alpha-glucan phosphorylase (PHS) is mainly used to catalyze the reversible phosphorylation of starch into glucose-1-phosphate. It is also commonly referred to as starch phosphorylase in plant tissues. PHS is similar to glycogen phosphorylase in structure and function, and is found in plants, animals, and bacteria, indicating that PHS plays an important role in the carbohydrate metabolism of different life forms. Studies have found that PHS can effectively degrade branched glucans due to the lack of L78 insertion, and may directly act on starch granules and participate in the degradation of starch stored in plant organs.
[0003] There have been many reports on the cloning and expression characteristics of the two subtypes of PHS enzyme genes in horticultural plants such as pumpkin, cassava, banana, corn, and mango. The sugar accumulation mode of kiwifruit is a typical starch conversion type, and the content of soluble sugar depends largely on the conversion rate of starch during the ripening process. However, there are few reports on the research of kiwifruit PHS enzyme genes and their role in promoting the softening of kiwifruit fruit in response to low temperature pretreatment. In view of this, the present invention provides a PHS gene and application for improving the edibleness of fruits. Summary of the invention
[0004] The technical problem to be solved by the present invention is to provide a PHS gene and application for improving the edible quality of fruits. The purpose is to study the PHS gene and apply it to the cultivation of transgenic plants such as kiwifruit and tomatoes for improving the edible quality of fruits.
[0005] The technical solution of the present invention to solve the above technical problems is as follows: In a first aspect, a PHS gene for improving the edible quality of fruits, the nucleotide sequence of the PHS gene is shown in SEQ ID NO: 1.
[0006] In a second aspect, an expression vector of a PHS gene for improving the edible quality of fruits is provided, wherein the expression vector comprises an initial expression vector and the PHS gene for improving the edible quality of fruits.
[0007] Furthermore, the initial expression vector comprises at least one of pBWA(V)HS-GLosgfp, pEarleyGate101, and pCAMBIA1300. The initial expression vector can stably transform and overexpress the PHS gene.
[0008] In a third aspect, a recombinant expression strain of a PHS gene for improving the ready-to-eat quality of fruits is provided. The recombinant expression strain is obtained by transforming an expression vector of a PHS gene for improving the ready-to-eat quality of fruits into Agrobacterium.
[0009] Furthermore, the Agrobacterium includes at least one of Agrobacterium GV3101 and EHA105.
[0010] In a fourth aspect, the PHS gene for improving the edibleness of fruits, or the expression vector of the PHS gene for improving the edibleness of fruits, or the recombinant expression strain of the PHS gene for improving the edibleness of fruits is used in the cultivation of transgenic plants for improving the edibleness of fruits.
[0011] In a fifth aspect, a method for cultivating a transgenic plant with improved fruit edibility comprises the following steps: (1) using the PHS gene for improving the instant edibility of fruits to construct an expression vector for the PHS gene for improving the instant edibility of fruits, and transferring it into Agrobacterium to obtain a recombinant expression strain; (2) Transforming the recombinant expression strain into the plant to be cultivated, and screening to obtain a transgenic strain with stable inheritance of the PHS gene sequence.
[0012] Furthermore, the PHS gene in step (1) is obtained by the following method: using cDNA of Actinidia chinensis fruit as a template, PCR amplification of the full-length coding region of the PHS gene is performed.
[0013] Furthermore, the nucleotide sequence of the primer pair for PCR amplification of the full-length coding region of the PHS gene is shown in SEQ ID NO: 2-3.
[0014] Among them, PHS-F1: ATGGCTACTACAGCAGATGCCAA (SED ID NO: 2); PHS-R1: TTATGGTACACAGCACTCCTCTATTTTCCA (SED ID NO: 3).
[0015] Furthermore, the plant to be cultivated includes any one of kiwi fruit and tomato.
[0016] The beneficial effects of the present invention are as follows: the present invention discloses a PHS gene for improving the edibleness of fruits, and an application thereof in regulating the edibleness of fruits. The edibleness of fruits can be improved by stably transforming and overexpressing the gene. Starch degradation in fruits of the overexpressing PHS strain is more complete during the ripening period, the soluble solids content is significantly increased, and the titratable acid is significantly reduced, providing a reference for cultivating kiwifruit germplasm resources that are ready to eat. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1The amino acid sequence encoded by the PHS gene; Figure 2 This is the map of the PHS gene overexpression vector; Figure 3 The expression pattern of PHS gene and the diagram of different developmental stages of fruit; A is the expression pattern of PHS gene, and B is the diagram of different developmental stages of fruit; Figure 4 The figures are the fruit phenotypes and physicochemical indicators of tomato PHS overexpression strains; A is a complete picture of wild-type and overexpression tomato fruits, B is the expression analysis of wild-type and overexpression tomato PHS genes at 35DPA, C is the expression analysis of wild-type and overexpression tomato PHS genes at 47DPA, D is a cross-section picture of wild-type and overexpression tomato fruits, E is the expression analysis of wild-type and overexpression tomato PHS genes at 41DPA, F is the starch content analysis of wild-type and overexpression tomato, G is the ripening time analysis of wild-type and overexpression tomato fruits, H is the soluble solids content analysis of wild-type and overexpression tomato, and I is the titratable acid content analysis of wild-type and overexpression tomato; Figure 5 It is an indicator of the organic acid content in the fruit of tomato PHS overexpression strain; A is malic acid, B is citric acid, C is quinic acid, and D is oxalic acid; Figure 6 The figure shows the sequencing results. DETAILED DESCRIPTION
[0018] The principles and features of the present invention are described below, and the examples are only used to explain the present invention and are not used to limit the scope of the present invention. If no specific technology or conditions are specified in the embodiments, the technology or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels.
[0019] Sources of materials and reagents: RNA Kit MagZol TM Reagent (Cat. No.: R4801-02); Agilent 2100 Bioanalyzer (Shanghai Yajing Biotechnology Co., Ltd.); reverse transcription kit PrimeScript 1 stStrand cDNA Synthesis Kit (Takara); pBWA(V)HS-GLosgfp (NTCC Type Culture Collection); DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.); Escherichia coli DH5α (Shanghai Weidi Biotechnology Co., Ltd.); Agrobacterium tumefaciens GV3101 (Shanghai Weidi Biotechnology Co., Ltd.); wild-type MT tomato seeds were provided by Wuhan Boyuan Biotechnology Co., Ltd.; MS medium, screening medium, differentiation medium, and rooting medium were all purchased from Qingdao Haibo Biotechnology Co., Ltd.
[0020] Example 1. Obtain the PHS gene.
[0021] Using RNA Kit MagZol TM Reagent (Cat. No.: R4801-02) was used to extract RNA from Actinidia chinensis fruit (collected from Fengxin County, Yichun City, Jiangxi Province); the integrity of total RNA was detected using Agilent 2100 Bioanalyzer. st cDNA was synthesized using the Strand cDNA Synthesis Kit. Full-length primers PHS-F1 (ATGGCTACTACAGCAGATGCCAA, SED ID NO: 2) and PHS-R1 (TTATGGTACACAGCACTCCTCTATTTTCCA, SED ID NO: 3) were designed using Primer Premier 5.1 software. PCR amplification was performed using cDNA as a template.
[0022] Specifically, the cDNA of Actinidia chinensis fruit was used as a template, and the above primers were used to perform PCR amplification of the full-length coding region of the PHS gene. The PCR product was purified using a DNA purification kit. The PCR product was subjected to Sanger sequencing ( Figure 6 ), which clarifies the sequence nucleotide arrangement information.
[0023] Figure 1 The predicted phosphorylation sites in the sequence are shown (NetPhos 3.1a: predicted phosphorylation sites in Seguence). Figure 1 The middle horizontal axis is sequence position, phosphorylation potential, and the icons are serine, threonine, tyrosine, and threshold. The protein encoded by the PHS gene is α-glucan phosphorylase, which consists of 850 amino acids.
[0024] 2. Cultivation of transgenic plants with improved edible fruits.
[0025] A method for cultivating transgenic plants with improved fruit edibility comprises the following steps: (1) Construction of an expression vector for the PHS gene that improves fruit edibility ( Figure 2 ), transformed into Agrobacterium to obtain a recombinant expression strain; (2) Transforming the recombinant expression strain into the plant to be cultivated, and screening to obtain a transgenic strain with stable inheritance of the PHS gene sequence.
[0026] Specifically, in this embodiment, (1) the PHS gene was purified, connected to the pBWA(V)HS-GLosgfp overexpression vector by homologous recombination, transformed into Escherichia coli by heat shock method, screened by plate, and the resistance was kanamycin. After positive identification, the PHS-positive Agrobacterium genetic engineering bacteria were constructed; (2) Transforming the PHS-positive Agrobacterium genetic engineering bacteria into the plants to be cultivated, for example, using the Agrobacterium-mediated leaf disc transformation method, cultivating and screening to obtain transgenic strains with stable inheritance of the target gene sequence. The plants to be cultivated include kiwi fruit and tomato.
[0027] 3. The application of genetically modified tomato cultivation to improve the edible quality of fruits.
[0028] A method for cultivating transgenic tomatoes with improved fruit edibility comprises the following steps: (1) After the PCR product was purified by a DNA purification kit, it was connected to the pBWA(V)HS-GLosgfp vector by homologous recombination method, transformed into Escherichia coli DH5α by heat shock method, and screened by plate. The resistance was kanamycin. Single clones were selected and sequenced for identification ( Figure 6 ) and then extract the plasmid, introduce it into Agrobacterium GV3101 by heat shock method, and culture it at 28℃ for 48 hours, then pick the plaque for bacterial liquid PCR verification to obtain the Agrobacterium strain that can be used for genetic transformation. The forward primer and reverse primer used for bacterial liquid PCR verification are as follows: Forward primer: ttcatttggagagaacacgggggac (SED ID NO: 4), Reverse primer: TTGCCAAAACGCTGCTTG (SED ID NO: 5).
[0029] (2) The positive Agrobacterium strain was transformed into the cotyledons of wild-type tomato MicroTom (Wildtype, WT) using the Agrobacterium-mediated leaf disc transformation method. The conventional process of the leaf disc transformation method was used, including: pre-culture (using MS culture medium), transformation (the Agrobacterium concentration OD value was about 0.1, and the tomato explants pre-cultured for 2-3 days were placed in the Agrobacterium suspension for infection for about 10 minutes, and then co-cultured.), callus induction and screening (the explants after 2 days of co-culture were transferred to the screening culture medium), differentiation and rooting (using differentiation culture medium), rooting (using rooting culture medium), detection (PCR amplification, and agarose gel electrophoresis to determine the positive seedlings and the positive rate). The wild-type tomato was used as a control, and the totipotency of plant cells was used to obtain the T0 generation overexpression tomato; the genomic DNA of the T0 generation plant was extracted using the CTAB method and used as a template. After PCR amplification, sequencing and identification were performed to screen positive plants. Self-pollination was performed to obtain T0 generation seeds; (3) Sowing T0 generation seeds, culturing in a greenhouse, and obtaining T1 generation plants. The same method is used to identify and screen positive plants, self-pollinate and obtain T1 generation seeds; (4) Sowing T1 seeds to obtain T2 plants, tracking and counting the maturity time of T2 fruit (i.e., MT-35S:AcPHS transgenic tomatoes) and wild-type fruit, and measuring the starch content, soluble solids content, and titratable acid content of the fruit. The starch content was measured using the starch content test kit of Solebow; the soluble solids content was measured using a digital handheld refractometer (Atago, Tokyo, Japan); and the titratable acid content was measured using a handheld refractometer (ATAGO PAL-BXIACID8).
[0030] Depend on Figure 3 From AB, we can see that the expression pattern of PHS gene is consistent with the fruit ripening process. The higher the fruit maturity, the higher the expression level of PHS gene. Figure 4 From AI, we know that PHS is a positive regulatory factor for fruit ripening, promoting fruit ripening; Figure 5 As can be seen from AD, PHS overexpression affected the acid content of the fruit, and the titratable acid was significantly lower than that of the wild-type MT.
[0031] In summary, compared with the wild type, the MT-35S:AcPHS transgenic tomato fruit matured 6 days earlier than the wild type, and the starch content decreased rapidly from 35DPA to 38DPA, 3 days earlier than the control, and the final starch degradation was more complete. At fruit maturity (43DPA), the soluble solid content of MT-35S:AcPHS was significantly higher than that of wild-type MT, and the titratable acid was significantly lower than that of wild-type MT. These results indicate that the PHS gene has a positive regulatory effect on fruit ripening.
[0032] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.
Claims
1. A PHS gene for improving the edible quality of fruit, characterized in that: The nucleotide sequence of the PHS gene is shown in SEQ ID NO:
1.
2. An expression vector of a PHS gene for improving the edible quality of fruit, characterized in that: The expression vector comprises an initial expression vector and the PHS gene for improving the edible quality of fruits as claimed in claim 1.
3. The expression vector of the PHS gene for improving the edible quality of fruits according to claim 2, characterized in that: The initial expression vector includes at least one of pBWA(V)HS-GLosgfp, pEarleyGate101, and pCAMBIA1300.
4. A recombinant expression strain of the PHS gene for improving the ready-to-eat quality of fruits, characterized in that: The recombinant expression strain is obtained by transforming the expression vector of the PHS gene for improving the ready-to-eat quality of fruits as described in any one of claims 2 to 3 into Agrobacterium.
5. The recombinant expression strain of the PHS gene for improving the ready-to-eat quality of fruits according to claim 4, characterized in that: The Agrobacterium includes at least one of Agrobacterium GV3101 and EHA105.
6. The PHS gene for improving the edible properties of fruits as described in claim 1, or the expression vector of the PHS gene for improving the edible properties of fruits as described in any one of claims 2 to 3, or the recombinant expression strain of the PHS gene for improving the edible properties of fruits as described in any one of claims 4 to 5 is used in the cultivation of transgenic plants for improving the edible properties of fruits.
7. A method for cultivating transgenic plants with improved fruit edibility, characterized in that: The steps include: (1) using the PHS gene for improving the ready-to-eat quality of fruits as described in claim 1 to construct an expression vector for the PHS gene for improving the ready-to-eat quality of fruits, and transferring it into Agrobacterium to obtain a recombinant expression strain; (2) Transforming the recombinant expression strain into the plant to be cultivated, and screening to obtain a transgenic strain with stable inheritance of the PHS gene sequence.
8. The method for cultivating transgenic plants for improving the edible quality of fruits according to claim 7, characterized in that: The PHS gene in step (1) is obtained by the following method: using cDNA of Actinidia chinensis fruit as a template, PCR amplification of the full-length coding region of the PHS gene is performed.
9. The method for cultivating transgenic plants for improving the edible quality of fruits according to claim 8, characterized in that: The nucleotide sequence of the primer pair for PCR amplification of the full-length coding region of the PHS gene is shown in SEQ ID NO: 2-3.
10. The method for cultivating transgenic plants with improved fruit edibility according to claim 7, characterized in that: The plant to be cultivated includes any one of kiwi fruit and tomato.
Citation Information
Patent Citations
Kiwi fruit gene capable of improving tomato fruit nutrition quality and use thereof
CN104004768A
Application of LecRK27 gene in improving uniformity and yield of fruits
CN117511975A
Polynucleotide, protein, biological material and application thereof in improving plant fruit quality
CN118207227A
Fruit and seed development regulating gene
KR1020050078972A
Transgenic expression cassettes for expressing nucleic acid sequences in sink tissues of plants that store carbohydrate
WO2004024926A2