CRISPR-Cpf1-based single plasmid gene editing system and application thereof
By developing a single plasmid gene editing system based on CRISPR-Cpf1 in Bacillus subtilis, the problems of complex operation and long cycle of the dual plasmid system were solved, and efficient genome editing was achieved.
Patent Information
- Application Number
- CN202510182270.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-19
- Publication Date
- 2025-06-06
AI Technical Summary
The use of a dual plasmid system in the prior art leads to complex operations and long cycles.
A single plasmid gene editing system based on CRISPR-Cpf1 was developed to simplify gene editing by connecting the crRNA sequence insertion region through the plasmid pcr19 NM vector, gene encoding the Cpf1 protein and NgAgo protein, and replicon pE194ts.
This single plasmid gene editing system can efficiently complete the precise editing of the genome, including complete knockout of 2 genes, base modification of 6 genes or integration of 1 gene, reducing the complexity of operation and gene editing cycle.
Smart Images

Figure CN120099058A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of gene editing, and in particular to a single-plasmid gene editing system based on CRISPR-Cpf1 and applications thereof. Background Art
[0002] The CRISPR-Cas system is an adaptive immune mechanism that is commonly found in bacteria and archaea, and is mainly composed of Cas nucleases and paired RNAs (tracrRNA and crRNA). When bacteria are invaded by exogenous DNA such as viruses, they express tracrRNA and crRNA, and spontaneously pair to form RNA dimers (sgRNA), which bind to Cas nucleases and mediate the cutting of exogenous nucleic acids. The immune response of CRISPR-Cas includes three stages: adaptation, expression, and interference. During the adaptation process, exogenous DNA is integrated into the CRISPR array as a spacer sequence; during the expression process, the CRISPR array is transcribed into precursor crRNA, which is processed by nucleases to generate mature crRNA; in the interference stage, mature crRNA guides the Cas protein to recognize and cut invading DNA or RNA, thereby realizing the defense function.
[0003] Bacillus subtilis (B. subtilis) itself has a certain homologous recombination ability, so its genome can be directly edited using double-stranded DNA fragments containing resistance genes and upstream and downstream homologous arms. Through homologous recombination (HDR), the sequence in the DNA fragment can replace the relevant sequence on the target genome, and the resistance gene is used to screen positive clones. In order to achieve repeated editing of the genome, it is necessary to remove the resistance gene after the editing is completed, thereby removing the resistance marker. Since 2016, a variety of gene editing systems based on CRISPR-Cas9 or CRISPR-Cpf1 have been established in B. subtilis. By optimizing the expression of each component of the gene editing system and introducing exogenous proteins that promote homologous recombination, the gene editing system based on CRISPR-Cas9 or CRISPR-Cpf1 has been greatly improved in the number of operable sites and editing efficiency, providing strong support for the construction of a new generation of microbial cell factories.
[0004] The results of the study showed that Cpf1 has an advantage over Cas9 in genome editing in Bacillus subtilis. In the Cpf1 system, the Cpf1 protein has RNase activity for cutting crRNA arrays in addition to DNase activity for cutting targeted double-stranded DNA. Therefore, the formation of the Cpf1-crRNA complex does not require the participation of tracrRNA and additional ribonucleases; while the Cas9 system requires these elements, or artificially fuses crRNA-tracrRNA to form a single guide RNA (sgRNA). This feature simplifies the construction process of the crRNA array, and can easily achieve multi-gene editing under the guidance of a single crRNA array. Metabolic engineering of strains using the CRISPR system usually involves operations such as continuous gene deletion or insertion, so it is crucial to develop a convenient iterative genome editing method. For iterative genome editing, the plasmid edited in the previous round needs to be removed for the next round of gene editing. At present, there have been a number of studies on the construction and application of multi-gene editing and expression regulation systems based on CRISPR-Cpf1 in Bacillus subtilis, but most of them use a dual-plasmid system, and there has been no report on gene editing and application using a single-plasmid system. The dual-plasmid gene editing system based on CRISPR-Cpf1 requires the separate transformation of plasmids carrying Cpf1 protein and crRNA, and the two plasmids need to be eliminated separately when eliminating the plasmid, which increases the complexity of the operation and prolongs the gene editing cycle. Summary of the invention
[0005] To this end, the technical problem to be solved by the present invention is to overcome the problem in the prior art of using double plasmids for gene editing, which makes the gene editing operation complicated and the cycle long.
[0006] In order to solve the above technical problems, the present invention provides a single plasmid gene editing system based on CRISPR-Cpf1 and its application. The present invention uses plasmid pcr19NM as a vector, connects the crRNA sequence insertion region, the gene encoding Cpf1 protein, the gene encoding NgAgo protein and the replicon pE194ts to pcr19NM, and m1 Regulate the expression of Cpf1 protein and NgAgo protein and adjust the location of Cpf1 protein and NgAgo protein through the constitutive promoter P vegBy regulating the expression of the crRNA sequence insertion region, the recombinant plasmid pWLBE-Pm1Cpf1Ng was obtained. The crRNA array of the target gene is introduced into the crRNA sequence insertion region and the homology arm is connected to the recombinant plasmid pWLBE-Pm1Cpf1Ng, so that the gene can be knocked out, base modified or integrated. At the same time, the introduction of the Bacillus subtilis temperature-sensitive replicon pE194ts on the gene editing plasmid can achieve the rapid elimination of the plasmid after gene editing. Based on the single-plasmid gene editing system of the present invention, precise editing of the genome can be efficiently completed by transforming a single plasmid, including complete knockout of 2 genes, base modification of 6 genes or integration of 1 gene. Compared with the dual-plasmid gene editing system, the single-plasmid gene editing system of the present invention reduces the complexity of the operation and shortens the gene editing cycle.
[0007] The first object of the present invention is to provide a single plasmid gene editing system based on CRISPR-Cpf1, the single plasmid gene editing system comprising plasmid pWLBE-Pm1Cpf1Ng, the pWLBE-Pm1Cpf1Ng using plasmid pcr19NM as a vector, the recombinant plasmid pWLBE-Pm1Cpf1Ng comprising a crRNA sequence insertion region, a gene encoding a Cpf1 protein, a gene encoding a NgAgo protein, a replicon pE194ts, a resistance gene and a replicon colE1;
[0008] The gene encoding Cpf1 protein and the gene encoding NgAgo protein are driven by promoter P m1 Regulating expression, the gene encoding the NgAgo protein is located downstream of the gene encoding the Cpf1 protein, and the RBS sequence is located between the gene encoding the NgAgo protein and the gene encoding the Cpf1 protein;
[0009] The crRNA sequence insertion region upstream contains a constitutive promoter P veg The crRNA sequence insertion region also includes a forward repeat sequence and a BsaI restriction site.
[0010] Furthermore, the NgAgo protein is derived from a truncated 1 variant of the Argonaute (NgAgo) protein in Natronobacterium gregoryi, which is intended to promote homologous recombination and improve the efficiency of gene editing. The replicon pE194ts is a temperature-sensitive replicon that cannot replicate normally above 42°C, so it can be used for rapid elimination of plasmids after genome editing.
[0011] Furthermore, the resistance gene includes a kanamycin resistance gene.
[0012] Furthermore, the gene sequence of the recombinant plasmid pWLBE-Pm1Cpf1Ng is shown in SEQ ID NO.1.
[0013] Furthermore, the upstream of the crRNA sequence insertion region is the constitutive promoter P veg , downstream is the direct repeat (DR) sequence of crRNA and two relative BasI restriction sites, which are mainly used for the construction and expression of crRNA array.
[0014] Furthermore, the gene sequence of the direct repeat (DR) sequence is shown in SEQ ID NO.5.
[0015] Furthermore, the gene ID of NgAgo protein is: GenBank: PLK21409.1.
[0016] Furthermore, the gene ID of Cpf1 protein is: GenBank: ABK90267.1.
[0017] Furthermore, the gene sequence of the replicon pE194ts is shown in SEQ ID NO.2.
[0018] Furthermore, the promoter P m1 The gene sequence is shown in SEQ ID NO.3.
[0019] Furthermore, the constitutive promoter P veg The gene sequence is shown in SEQ ID NO.4.
[0020] Furthermore, the gene sequence of the RBS is shown in SEQ ID NO.6.
[0021] The second object of the present invention is to provide the application of the above-mentioned single plasmid gene editing system in Bacillus subtilis gene editing.
[0022] Furthermore, the single plasmid gene editing system is used for gene knockout, gene mutation or gene integration of Bacillus subtilis.
[0023] Furthermore, the homologous template is connected to the recombinant plasmid pWLBE-Pm1Cpf1Ng. The homologous template is located downstream of the crRNA sequence insertion region, and the upstream and downstream of the homologous template also include two bidirectional terminators.
[0024] The third object of the present invention is to provide an application of the above-mentioned single plasmid gene editing system in the production of acetoin.
[0025] Furthermore, the application is: designing a crRNA array according to knocking out the acetoin reductase gene and the acetoin lyase A gene and inserting the NADH oxidase gene, integrating the crRNA array into the crRNA sequence insertion region, connecting the homology arms to the recombinant plasmid pWLBE-Pm1Cpf1Ng and transforming it into Bacillus subtilis and performing fermentation culture;
[0026] Furthermore, the yodc gene is driven by a promoter P ycec , P odhA or P 556 Regulate expression.
[0027] Beneficial effects of the present invention:
[0028] (1) The present invention expresses Cpf1 and crRNA array on a vector through promoter P m1 By regulating the expression of Cpf1 protein and NgAgo protein, the recombinant plasmid pWLBE-Pm1Cpf1Ng is obtained. The recombinant plasmid pWLBE-Pm1Cpf1Ng can be used to achieve complete knockout of 2 genes, base modification of 6 genes, or knock-in of 1 gene. The vector pWLBE-Pm1Cpf1Ng contains NgAgo protein, which is used to promote RecA-mediated homologous recombination. Introducing the temperature-sensitive replicon pE194ts into the recombinant plasmid pWLBE-Pm1Cpf1Ng can ensure the rapid elimination of the plasmid after gene editing is completed. This single-plasmid gene editing system is easy to operate and can quickly introduce the desired gene modification into the genome by designing different crRNA arrays and homologous templates, expanding the methods that Bacillus subtilis can be used for genetic manipulation;
[0029] (2) The present invention adopts Bacillus subtilis 168 with a relatively clear genetic background, simple gene manipulation and natural metabolic advantages as the starting strain, and uses the Bacillus subtilis single plasmid gene editing system based on CRISPR-Cpf1 to knock out the key genes bdhA and acoA for acetoin decomposition metabolism, overexpress the NADH oxidase gene yodc, and the acetoin production by shake flask fermentation reaches 52 g / L, which is much higher than the acetoin production in the prior art, which is of great significance for large-scale fermentation production of acetoin. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein
[0031] Figure 1 It is a single plasmid gene editing system based on CRISPR-Cpf1 and its working principle;
[0032] Figure 2It is a gene knockout mediated by a single plasmid gene editing system based on CRISPR-Cpf1 in B. subtilis; (A) co-transformation of homologous fragments and Cpf1 and crRNA array expression vectors to achieve single gene knockout, (B) ligation of homologous fragments to the Cpf1 gene and crRNA array expression vector pWLBE-Pm1Cpf1Ng, and transformation of a single plasmid to achieve dual gene knockout at the same time;
[0033] Figure 3 It is partial base editing mediated by the single plasmid gene editing system based on CRISPR-Cpf1 in B. subtilis; (A) Nonsense mutations of 6 genes were simultaneously achieved using the pWLBE-Pm1Cpf1Ng derivative plasmid containing homologous fragments, (B) Nonsense mutations of 6 genes were achieved by co-transformation of homologous fragments and Cpf1 gene and crRNA array expression vectors in 3 times, (C) Skim milk plates were used for verification;
[0034] Figure 4 It is the Sanger sequencing verification of base editing; 1 is the sequencing result of base editing completed in one time using plasmid pWLBE-Pm1Cpf1Ng-6C-NM, and 2 is the sequencing result of base editing completed by co-transformation of homology arms;
[0035] Figure 5 It is a gene knock-in mediated by a single plasmid gene editing system based on CRISPR-Cpf1 in B. subtilis; (A) Gene knock-in is achieved using a pWLBE-Pm1Cpf1Ng-derived plasmid containing homologous fragments, and (B) Gene knock-in is achieved by co-transforming homologous fragments and Cpf1 gene and crRNA array expression vectors;
[0036] Figure 6 The relevant fermentation data of acetoin production by strain B. subtilis 168 and recombinant strain BSA2-6 during shake flask fermentation; (A) The changes in acetoin production and biomass during fermentation after blocking the genes for acetoin decomposition pathway; (B) The changes in acetoin production and biomass during fermentation after overexpressing the NADH oxidase gene yodc;
[0037] Figure 7 It is to adjust the expression intensity of different elements on a single-plasmid gene editing vector and the influence of the expression mode on the gene editing efficiency; (A) directly construct the elements on the dual-plasmid vector onto a single plasmid; (B) optimize the expression intensity of Cpf1 protein; (C) adjust the position of different expression elements. DETAILED DESCRIPTION
[0038] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.
[0039] The shake flask fermentation medium of the present invention includes 12 g / L yeast extract, 6 g / L tryptone, and potassium dihydrogen phosphate (KH 2 PO 4 )2.5g / L, potassium dihydrogen phosphate (K 2 HPO 4 ·4H 2 O) 12.5g / L, trace elements 10mL / L, glucose 100g / L, sterilized at 115℃ for 20min. The formula of trace elements is: FeSO 4 7H 2 O 4g / L, CaCl 2 4g / L, MnSO 4 ·H 2 O 1g / L, CoCl 2 6H 2 O 0.4g / L, NaMoO 4 ·2H 2 O0.2g / L, ZnSO 4 7H 2 O 0.2g / L, AlCl 3 6H 2 O 0.1g / L, CuCl 2 ·2H 2 O 0.1g / L, H 3 BO 4 0.05g / L, citric acid 1g / L.
[0040] Fermentation parameters detected in the present invention: (1) bacterial OD 600 Determination of OD: Take an appropriate amount of the fermentation sample to be tested and dilute it with deionized water to make OD 600 The absorbance of the diluted sample at 600 nm is then measured using a spectrophotometer, which is the OD 600(2) Determination of glucose and acetoin concentrations: This study used high-performance liquid chromatography (HPLC) to determine the concentrations of glucose, acetoin, acetic acid, ethanol, and lactic acid in fermentation samples. An Agilent 1260 HPLC system equipped with a differential detector and an Aminex HPX-87H chromatographic column (300 mm × 7.8 mm) were used to detect the concentrations of glucose and acetoin in the samples. The mobile phase was 5 mM H 2 SO 4 , flow rate was 0.56 mL / min, column temperature was controlled at 40 °C, detector temperature was 35 °C, and injection volume was 10 μL.
[0041] Example 1: Construction of a single plasmid gene editing vector pWLBE-Pm1Cpf1Ng
[0042] Using two plasmids PHTXCR6 and pcrf19NM in the dual-plasmid gene editing system as templates, firstly, the plasmid pcr19NM was linearized by PCR using primers as shown in SEQ ID NO.7-8, and the template DNA was digested with endonuclease DpnI to obtain a linearized fragment pcrf-Ng, which contained colE1 replicon and kanamycin resistance gene; using primers as shown in SEQ ID NO.9-12, the FnCpf1 gene and NgAgo protein were amplified using plasmid PHTXCR6 as a template; the RBS sequence connecting the FnCpf1 gene and the NgAgo protein was shown in SEQ ID NO.6, and due to the short sequence, it was introduced into the fragment by adding to the 5' end of primers Cpf1-F and NgAgo-F; P m1 The sequence of the promoter is shown in SEQ ID NO.3, and the long primers shown in SEQ ID NO.13-14 are used to form short fragments by primer annealing; the primers shown in SEQ ID NO.15-16 are used to amplify the pE194ts replicon with pcrf19NM as a template, and the overlap region between each fragment is set to 20 bp, and the primers are introduced, and finally the P is cloned by a seamless cloning kit. m1 The promoter, FnCpf1 encoding gene, NgAgo protein encoding gene and pE194ts replicon were connected to the linearized vector pcr19NM to obtain the vector pWLBE-Pm1Cpf1Ng.
[0043] Table 1 Primers and their sequences involved in Example 1
[0044]
[0045] Example 2: Gene knockout, gene editing and insertion in Bacillus subtilis based on the CRISPR-Cpf1 single plasmid gene editing system
[0046] When performing gene editing, the required crRNA and homology arms are first designed according to the needs of genome editing, and then added to the plasmid pWLBE-Pm1Cpf1Ng. The plasmid pWLBE-Pm1Cpf1Ng contains the crRNA array insertion region, and the upstream of this region is the constitutive promoter P veg , downstream is the crRNA direct repeat (DR) sequence and two relative BasI restriction sites, which are mainly used for the construction and expression of crRNA array. During the construction, the vector plasmid needs to be linearized using BasI nuclease, and then the complementary crRNA single-stranded primer is annealed to form a double strand, and then the linearized vector and the annealed single-stranded primer are connected. In addition, the plasmid pWLBE-Pm1Cpf1Ng has two adjacent bidirectional terminators after the crRNA array, and the terminators can be used to insert the homologous arms required for gene editing. The homologous arms are inserted using a one-step cloning kit.
[0047] The six main extracellular protease genes aprE, epr, nprE, bpr, mpr and nprB in Bacillus subtilis were selected as target genes for verification. It was verified that if the homology arms were integrated into pWLBE-Pm1Cpf1Ng, two genes could be completely deleted, six sites could be partially mutated or one gene could be inserted at one time; if the homology template was co-transformed with the pWLBE-Pm1Cpf1Ng derivative plasmid inserted with crRNA, only one gene could be knocked out, two sites could be partially mutated or one gene could be integrated at one time. Figure 2As shown, if only a single gene needs to be knocked out, the corresponding homologous template can be co-transformed with the pWLBE-Pm1Cpf1Ng derivative plasmid containing a specific crRNA array; we used the plasmid pWLBE-Pm1Cpf1Ng and the corresponding homologous template (△aprE-HA) to knock out the protease gene aprE, but the number of colonies obtained at this time was significantly less than the number of colonies when the plasmid pWLBE-Pm1Cpf1Ng-1C connected to the homologous template was used for knockout. When performing simultaneous knockout of two genes, we co-transformed pWLBE-Pm1Cpf1Ng-2C and the corresponding homologous templates (△epr-HA and △nprE-HA), but were unable to obtain any colonies. This may be related to the transformation efficiency and homologous recombination efficiency of B. subtilis. If the above homologous templates are connected to the plasmid pWLBE-Pm1Cpf1Ng vector containing the crRNA array, the resulting plasmid pWLBE-Pm1Cpf1Ng-2C-DEL can achieve simultaneous knockout of the two genes epr and nprE. When trying to use the plasmid pWLBE-Pm1Cpf1Ng-4C-DEL to simultaneously knock out the four genes aprE, epr, nprE and bpr, no colonies were obtained, indicating that the recombination efficiency at this time still cannot meet the requirements for the simultaneous knockout of more than two genes. If the four genes are knocked out twice, that is, after the two genes are knocked out by plasmid pWLBE-Pm1Cpf1Ng-2C-DEL, the plasmid is eliminated, and then the plasmid pWLBE-Pm1Cpf1Ng-4C-DEL is transformed, the four genes can be knocked out. This shows that due to the influence of the homologous recombination efficiency of Bacillus subtilis itself, this system can knock out two genes at most at a time. If more than two genes are to be knocked out, continuous knockout is required by transforming different plasmids.
[0048] Furthermore, in order to perform multi-site editing simultaneously, we tried to mutate only some bases instead of completely knocking them out, by modifying the PAM region and crRNA recognition site, and adding a stop codon to the homologous template. In this way, not only can Cpf1 be prevented from recognizing and cutting the target gene, but it can also cause nonsense mutations in the gene and loss of function. Figure 3As shown in the figure, we designed and constructed the plasmid pWLBE-Pm1Cpf1Ng-6C containing crRNA arrays for six genes, aprE, epr, nprE, bpr, mpr and nprB, and connected the required homologous template to the plasmid to obtain the plasmid pWLBE-Pm1Cpf1Ng-6C-NM. Using this plasmid, multiple stop codons can be introduced into the coding regions of the six protease genes, indicating that if only a small range of base modifications are performed, the number of operating sites is greater than the number when the gene is completely knocked out. In addition, by co-transforming the homology arms with the pWLBE-Pm1Cpf1Ng derivative plasmid containing the crRNAarray, base modifications of up to two sites can be completed each time, and base modifications of 6 sites can be achieved by three consecutive transformations and plasmid elimination. In addition, we also tested the protease activity of the mutant strains on a medium containing 5% skim milk. The results showed that compared with B. subtilis 168, the mutant strains with more mutation sites had a more significant decrease in protease activity. Figure 4 We further performed Sanger sequencing on these mutant strains, and the results showed that the gene sequences obtained by both methods were consistent with expectations.
[0049] Finally, the single-plasmid gene editing system was used to insert genes into the genome of B. subtilis 168, with the yellow fluorescent protein encoding gene as the gene to be inserted. It was found that this system could only integrate one gene into the genome of B. subtilis 168 at a time, e.g. Figure 5 As shown in the figure, we used the plasmid pWLBE-Pm1Cpf1Ng-1C-YFP containing crRNA array and homologous template to achieve the integration of yellow fluorescent protein (sYFP2) in the B. subtilis genome, and the crRNA array expression plasmid pWLBE-Pm1Cpf1Ng-1C was co-transformed with the corresponding homologous template to achieve the integration of sYFP2 in the B. subtilis genome, but the number of single colonies obtained on the plate was small, indicating that when the single plasmid gene editing system is used for gene insertion, the efficiency of gene integration is higher when the homologous template containing the gene to be integrated is connected to the pWLBE-Pm1Cpf1Ng vector.
[0050] Example 3: Using a single plasmid gene editing system based on CRISPR Cpf1 to modify Bacillus subtilis to enhance the ability to synthesize acetoin
[0051] Referring to the SOMACA (Synthetic Oligos Mediated Assembly of crRNA Array) crRNA array assembly method described by Wu et al. in CAMERS-B: CRISPR / Cpf1 assisted multiple-genes editing and regulation system for Bacillus subtilis. Biotechnology and Bioengineering 2020, 117: 1817-1825, the crRNA arrays targeting the bdhA and acoA genes were connected to the pWLBE-Pm1Cpf1Ng vector, and then the upstream and downstream homologous arms of the acoA and bdhA genes were amplified by PCR, and the homologous template was obtained by fusion PCR. The pWLBE-Pm1Cpf1Ng vector connected to the crRNA array was used as a template for linearization by PCR and the template DNA was digested with the endonuclease DpnI. Finally, the above fragments were assembled by a one-step cloning kit to obtain the plasmid pWLB E-Pm1Cpf1Ng-bdhA and pWLBE-Pm1Cpf1Ng-acoA can be transformed into Bacillus subtilis competent cells for gene editing to knock out the acoA and bdhA genes. The crRNA arrays targeting the two bdhA and acoA genes and the corresponding homologous templates can also be connected to the same pWLBE-Pm1Cpf1Ng vector to obtain the plasmid pWLBE-Pm1Cpf1Ng-bdhA-acoA. In this way, the knockout of the bdhA and acoA genes can be completed at one time by transforming the single plasmid. When the yodc gene is overexpressed, the integration site is designed at the bdhA gene site. It is only necessary to add the expression frame of the yodc gene in the middle of the upstream and downstream homologous arms of the plasmid pWLBE-Pm1Cpf1Ng-bdhA to obtain the plasmid pWLBE-Pm1Cpf1Ng-yodc with the yodc gene integrated. The bdhA and acoA genes and the crRNA array and upstream and downstream homologous templates required for the integration of the yodc gene are knocked out, and the yodc gene is inserted into the bdhA gene site after being transformed into Bacillus subtilis competent cells. The primers for constructing the plasmids pWLBE-Pm1Cpf1Ng-bdhA, pWLBE-Pm1Cpf1Ng-acoA and pWLBE-Pm1Cpf1Ng-yodc are shown in Table 2. Promoter P ycec , P odhA , P 556 The nucleotide sequences of the primers are shown in Table 2.
[0052] The bdhA gene was successfully knocked out in the strain BSA2. The acoA gene was further knocked out on the basis of BSA2 to obtain the strain BSA3. On the basis of BSA3, the yodc gene was overexpressed using promoters of different strengths to obtain BSA4, BSA5, and BSA6. The above strains were subjected to shake flask fermentation experiments to detect the changes in the biomass of the acetoin production strains. The fermentation results are shown in the figure. Figure 6 As shown, knocking out the bdhA and acoA genes can significantly increase the acetoin fermentation yield of the strain, reaching a maximum yield of 48.48 g / L after 48 h of fermentation.
[0053] The acetoin biosynthesis pathway has the function of preventing cytoplasmic acidification and balancing cofactors. After knocking out the bdhA gene, although the acetoin fermentation yield was greatly improved, the biomass of the strain during the fermentation process was lower than that of the starting strain. This may be because of the excessive accumulation of NADH, which led to an intracellular redox imbalance and affected cell growth. Therefore, the coding gene yodc of the endogenous NADH oxidase of Bacillus subtilis was overexpressed on the basis of strain BSA3, and three different strength promoters P were used to express the NADH oxidase. ycec , P odhA , P 556 The yodc gene was overexpressed and then shake flask fermentation was performed. The fermentation results are shown in Figure 6 As shown, using the weak promoter P ycec Maximum OD of strains overexpressing yodc 600 The yield of acetoin was increased, and the maximum yield reached 51.78 g / L after 48 h of fermentation, which was 6.8% higher than that of strain BSA3. The maximum OD 600 From 29.74 to 33.92, using the strong promoter P 556 After overexpression of yodc, the production of acetoin decreased significantly, so moderate overexpression of yodc is beneficial to alleviate NADH accumulation and restore cell growth.
[0054] Table 2 Primers and their sequences involved in Example 3
[0055] SEQ ID Name Sequence SEQ ID NO.17 bdhA-cr-F AGATTTCAAACTTCCTGATGAATTATC SEQ ID NO.18 bdhA-cr-R AATTGATAATTCATCAGGAAGTTTGAA SEQ ID NO.19 acoA-cr-F AGATACCAACTGCGGAAGAGAGATACG SEQ ID NO.20 acoA-cr-R AATTCGTATCTCTCTTCCGCAGTTGGT SEQ ID NO.21 bdhA-U-F AGTTAGCTTGGCCAGTGCCTGTCAGCTTCTCCTCATGGATCACC SEQ ID NO.22 bdhA-U-R TGACTTGGCTTGCTGCCTTCATGGATTACCACTC SEQ ID NO.23 bdhA-D-F GAAGGCAGCAAGCCAAGTCAAAATCCTTGTTAGACC SEQ ID NO.24 bdhA-D-R GATCTGCCGTTCGTAACAGGGAGATGTCTCCTGTGGAAAGCAGG SEQ ID NO.25 acoA-U-F AGTTAGCTTGGCCAGTGCCTCAATGCATGAACACAAAGTCAACAGATG SEQ ID NO.26 acoA-U-R AGGCCGATCGTGCTTAACGCAAAAAAAAGACCGGATATCACCCG SEQ ID NO.27 acoA-D-R GCGTTAAGCACGATCGGCCTTGC SEQ ID NO.28 acoA-D-R GATCTGCCGTTCGTAACAGGGAAGACGGTAAAACAAGTCCTCTCTG SEQ ID NO.29 yodc-F ATGACGAATACTCTGGATGTTTTAAAAGCAC SEQ ID NO.30 yodc-R CATGAAGCTGAACAGGCTCGTG SEQ ID NO.31 <![CDATA[P ycec -F]]> GTGTACATTCCTCTCTTACATAGTCACATTTATTTT SEQ ID NO.32 <![CDATA[P ycec -R]]> GTACAATCGTCGACCTGCAGG SEQ ID NO.33 <![CDATA[P odhA -F]]> TTTTCGAATGATTAAATTTTTTGTTTTTTATAAAGGTTT SEQ ID NO.34 <![CDATA[P odhA -R]]> GTGTACATTCCTCTCTTACCAACGATATTTTACC SEQ ID NO.35 <![CDATA[P 556 -F]]> AAAAAACGGCCTCTCGAAATAGAGG SEQ ID NO.36 <![CDATA[P 556 -R]]> TTTTATCACCTCCTTTTCTGATAATATAACATATTCTC
[0056] Comparative Example 1: Effect of transferring the components of the dual-plasmid gene editing system to a single plasmid on gene editing efficiency
[0057] Referring to the description of Wu et al. in CAMERS-B: CRISPR / Cpf1 assisted multiple-genes editing and regulation system for Bacillus subtilis. Biotechnology and Bioengineering 2020, 117: 1817-1825, the dual-plasmid system consists of two plasmids, PHTXCR6 and pcrf19NM, in which the PHTXCR6 plasmid contains the Cpf1 protein expressed by the xylose-inducible promoter PxylA and the constitutive promoter P grac The expressed NgAgo protein and the replicon pBR322 in Escherichia coli and the replicon RepA in Bacillus subtilis carry the ampicillin resistance gene in Escherichia coli and the chloramphenicol resistance gene in Bacillus subtilis; the pcrf19NM plasmid contains the constitutive promoter P veg The expressed crRNA array, the replicon pUC in Escherichia coli, and the thermosensitive replicon pE194ts in Bacillus subtilis carry kanamycin resistance in both Escherichia coli and Bacillus subtilis. The essential elements for gene editing carried on the above two plasmids (including Cpf1, NgAgo, crRNA array, resistance gene and replicon) were directly transferred to one plasmid, and the kanamycin resistance gene common in Escherichia coli and Bacillus subtilis was selected as a screening marker. After successful construction, the endogenous apre gene of Bacillus subtilis was used as the knockout verification target, and the crRNA targeting apre and the upstream and downstream homologous fragments of the apre gene were connected to the vector to construct the Plwbe-apre-1 plasmid. After the plasmid was transformed into the strain, it was found that no single colony could be grown on the kanamycin resistance plate. After trying to replace different vectors and co-transform the homologous fragments with the crRNA vector, no single colony could be grown. Therefore, directly transferring the elements on the dual-plasmid system to a single plasmid cannot perform gene editing normally ( Figure 7 ).
[0058] Comparative Example 2: Effects of expression intensity and expression pattern of crRNA array, NgAgo protein and Fn-Cpf1 on gene editing efficiency
[0059] Since the elements of the dual-plasmid system were directly transferred to a single plasmid and the host strain was transformed into the plasmid, the strain could not grow on the kanamycin-resistant plate. Therefore, we speculate that the following reasons may have caused this phenomenon: (1) The Cpf1 protein itself is toxic to the growth of the strain, and its high expression intensity inhibits the normal growth of the strain. (2) The crRNA array, NgAgo protein, and Fn-Cpf1 are expressed using separate expression frames, which may cause promoter competition problems, resulting in instability of the plasmid in the bacteria. (3) The plasmid contains many expression elements, which is too heavy and reduces the transformation efficiency.
[0060] To address the above problems, we optimized the expression intensity and expression mode of crRNA array, NgAgo protein and Fn-Cpf1. m1 , P veg The expression intensity of Cpf1 protein was optimized by replacing the original xylose-inducible promoter with the IPTG-inducible promoter. The results showed that the gene editing efficiency was significantly improved after adjusting the expression intensity of Cpf1 protein. m1 After the promoter expressed Cpf1 protein, a few strains were able to grow on kanamycin-resistant plates, and sequencing results showed that some strains had completed the knockout of the apre gene ( Figure 7 Next, we tried to reduce the number of promoters on the plasmid to enhance the stability of the plasmid. grac The NgAgo protein expressed by the constitutive promoter P veg Expression of crRNA arrays and Cpf1 protein using P m1 The results showed that when NgAgo protein and cpf1 protein were expressed in tandem using Pm1 promoter, and crRNA array was expressed alone using constitutive promoter Pveg, the number of single colonies growing on kanamycin resistant plates increased significantly, and sequencing results showed that more than 90% of the strains had completed the knockout of apre gene. At the same time, the positions of different expression elements were adjusted ( Figure 7 ).
[0061] Comparative Example 3: Effects of different plasmid replicons on plasmid elimination efficiency
[0062] After completing gene editing, the vector plasmid needs to be eliminated to facilitate the next round of gene editing. In the actual application process, we found that the vector plasmid is difficult to eliminate, and it is often necessary to culture it in a medium containing 0.0006% SDS for multiple rounds to complete the elimination, which greatly prolongs the gene editing cycle. Since the independent replication of plasmids in bacteria depends on the replication start site (i.e., replicon), in order to improve the elimination efficiency of the vector plasmid, an attempt was made to replace the replicon of the vector plasmid with the reported thermosensitive replicon pE194ts, which cannot start replication normally at 42°C. Therefore, as the bacteria continue to pass on, the plasmid carrying the replicon will be eliminated. After introducing the thermosensitive replicon pE194ts into the single-plasmid gene editing vector to replace the original RepA replicon, there was no significant change in the gene editing efficiency, but the plasmid elimination efficiency was greatly improved. The plasmid can be efficiently eliminated by culturing the strain that has completed gene editing at 42°C for one round.
[0063] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.
Claims
1. A single plasmid gene editing system based on CRISPR-Cpf1, characterized in that: The single plasmid gene editing system includes a recombinant plasmid pWLBE-Pm1Cpf1Ng, which uses plasmid pcr19NM as a vector and includes a crRNA sequence insertion region, a gene encoding a Cpf1 protein, a gene encoding a NgAgo protein, a replicon pE194ts, and a gene encoding an RBS; The Cpf1 protein and NgAgo protein are expressed by the promoter P m1 Regulating expression, the gene encoding NgAgo protein is located downstream of the gene encoding Cpf1 protein, and the gene encoding RBS is located upstream of the gene encoding NgAgo protein and downstream of the gene encoding Cpf1 protein; The crRNA sequence insertion region upstream contains a constitutive promoter P veg .
2. The single plasmid gene editing system according to claim 1, characterized in that: The gene encoding the NgAgo protein is shown in GenBank: PLK21409.
1.
3. The single plasmid gene editing system according to claim 1, characterized in that: The gene sequence of the replicon pE194ts is shown in SEQ ID NO.
2.
4. The single plasmid gene editing system according to claim 1, characterized in that: The promoter P m1 The gene sequence is shown in SEQ ID NO.
3.
5. The single plasmid gene editing system according to claim 1, characterized in that: The constitutive promoter P veg The gene sequence is shown in SEQ ID NO.
4.
6. Use of the single plasmid gene editing system according to any one of claims 1 to 5 in Bacillus subtilis gene editing.
7. The use according to claim 6, characterized in that: The single plasmid gene editing system is used for gene knockout, gene editing or gene integration of Bacillus subtilis.
8. The use according to claim 6, characterized in that: The homology arms were connected to the recombinant plasmid pWLBE-Pm1Cpf1Ng.
9. Use of the single plasmid gene editing system according to any one of claims 1 to 5 in the production of acetoin.
10. The use according to claim 9, characterized in that: The application is: designing a crRNA sequence according to knocking out the acetoin reductase gene and the acetoin lyase A gene and inserting the NADH oxidase gene, integrating the crRNA sequence into the crRNA sequence insertion region, connecting the homology arm to the recombinant plasmid pWLBE-Pm1Cpf1Ng and transforming it into Bacillus subtilis for fermentation culture.