A method for dynamically regulating plasmid copy number in Saccharomyces cerevisiae based on RNA interference

Abstract

The present invention provides a method for dynamically regulating plasmid copy number in Saccharomyces cerevisiae based on RNA interference. This method reconstructs an orthogonal RNAi system, uses Saccharomyces cerevisiae as a synthetic biology chassis with dynamically programmable plasmid copy number, and integrates the heterologous RNAi mechanism from Saccharomyces castellii to design sequence-specific siRNAs targeting plasmid-encoded selection markers. This establishes a chemically induced gene dosage control platform to achieve dynamic regulation of plasmid copy number, thereby optimizing gene expression dosage and improving biosynthesis efficiency. RNAi-mediated copy number regulation was applied to the carotenoid biosynthesis pathway, and lycopene titer increased by 18.6 times compared to a static plasmid system. This method further enriches the tool set for synthetic metabolic regulation and has great potential for improving the production performance of microbial cell factories, providing new ideas for metabolic engineering optimization in the field of synthetic biology.

Description

Technical Field

[0001] The present invention belongs to the field of metabolic engineering, and in particular relates to a method for dynamically regulating the copy number of a plasmid in Saccharomyces cerevisiae based on RNA interference. Background Art

[0002] In the design of microbial cell factories, precise coordination of gene dosage and expression dynamics is of great significance for optimizing metabolic flux, reducing cell burden, and increasing target product yield. Saccharomyces cerevisiae ) is an important synthetic biology chassis microorganism and is widely used in genetic engineering and recombinant protein production. Plasmids are commonly used tools in genetic engineering, and their copy number has a significant impact on the expression of target genes and the yield of biosynthetic products. However, traditional plasmid systems have problems such as large copy number fluctuations, lack of dynamic control methods, and lack of dynamic control capabilities, which limit their application in the optimization of complex metabolic networks. Therefore, it is necessary to provide a method for dynamically regulating the copy number of plasmids in Saccharomyces cerevisiae to increase the yield of biosynthetic products such as recombinant proteins in engineered Saccharomyces cerevisiae strains. Summary of the Invention

[0003] To address the existing difficulty in real-time regulation of plasmid copy number, the present invention provides a method for dynamically regulating yeast plasmid copy number using RNA interference (RNAi) technology. This method recreates an orthogonal RNAi pathway in Saccharomyces cerevisiae and uses chemically induced short interfering RNA (siRNA) to target a plasmid-encoded selectable marker gene, achieving dynamic regulation of plasmid copy number. This optimizes gene expression dosage and improves biosynthesis efficiency.

[0004] The technical solution adopted by the present invention is: to reconstruct the RNAi pathway in Saccharomyces cerevisiae cells, and use a chemically induced hairpin RNA expression module to target the plasmid-encoded selection marker gene to achieve dynamic regulation of the plasmid copy number; the hairpin RNA expression module includes an estradiol-inducible system and a hairpin structure sequence homologous to the selection marker gene.

[0005] RNA interference (RNAi) is a post-transcriptional gene silencing mechanism that inhibits gene expression by specifically degrading target mRNA. Although the RNAi system has been lost in Saccharomyces cerevisiae during evolution, it is still present in other yeasts. This paper aims to reconstruct the RNAi system of Saccharomyces cerevisiae and use Saccharomyces cerevisiae as a synthetic biology chassis with dynamically programmable plasmid copy number. By integrating the RNAi system from Saccharomyces castellii ( Saccharomyces castelli) and Argonaute proteins, a chemically inducible hairpin RNA (hpRNA) expression module targeting a plasmid-encoded selectable marker gene was designed. This system controls plasmid copy number via a chemically inducible promoter: the presence of the inducer estradiol triggers transcription of a hairpin sequence homologous to the selectable marker gene within the hairpin RNA expression module, which is then processed into siRNA that complements the selectable marker gene's mRNA. After pairing, the selectable marker gene's mRNA is cleaved and degraded by the Argonaute protein, increasing plasmid growth pressure and thus dynamically regulating plasmid copy number to enhance the yield of recombinant proteins and biosynthetic products. Specifically, the method for dynamically regulating plasmid copy number in Saccharomyces cerevisiae provided by the present invention primarily comprises two components: 1) RNAi pathway reconstruction and 2) specific siRNA regulation.

[0006] The RNAi pathway reconstruction section specifically includes the following:

[0007] Target gene selection: The present invention obtains the RNA interference core component gene from Saccharomyces cerevisiae Castelli DCR1 (encoding the Dicer ribonuclease) and AGO1 (encoding Argonaute protein), these two genes are key components of the RNA interference pathway, responsible for processing long double-stranded RNA into small interfering RNA (siRNA) and forming the RNA-induced silencing complex (RISC).

[0008] Integration site selection: Select Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) integration into neutral sites in the host cell genome, such as sites 416d and 308a. These sites do not significantly affect the normal physiological functions of the host cell and can stably express the integrated foreign gene.

[0009] The specific siRNA regulation part specifically includes the following contents:

[0010] Target selection: Select plasmid-encoded selectable marker genes as targets for siRNA. For example, commonly used antibiotic resistance genes (such as HygR , encoding hygromycin B phosphotransferase; NrsR, encoding nourseothricin sulfate) or auxotrophic selectable marker genes (e.g. URA3 、 LEU2 、 TRP1 Estradiol induction system and hairpin structure sequence homologous to the selection marker gene are connected to construct a hairpin RNA expression module. The hairpin structure sequence homologous to the selection marker gene is transcribed and processed into siRNA complementary to the mRNA of the selection marker gene under the triggering of the inducer estradiol. HygRThe nucleotide sequence of the hairpin structure gene homologous to the gene is preferably as shown in SEQ ID NO. 5; NrS The nucleotide sequence of the hairpin structure gene homologous to the gene is preferably as shown in SEQ ID NO. 13; URA3 The nucleotide sequence of the hairpin structure gene homologous to the gene is preferably as shown in SEQ ID NO. 6; LEU2 The nucleotide sequence of the hairpin structure gene homologous to the gene is preferably as shown in SEQ ID NO. 7; and TRP1 The nucleotide sequence of the hairpin structure gene with gene homology is preferably as shown in SEQ ID NO. 8.

[0011] Induction system design: To achieve dynamic regulation of the hairpin RNA expression module, a chemical induction system is introduced. The present invention preferably utilizes a β-estradiol-inducible system, which includes a DNA binding domain, ZF97-4, that binds to β-estradiol; an estrogen ligand binding domain; a transcriptional activation domain, VP16; and an engineered promoter containing multiple 97-4 operators.

[0012] Construction of the inducible system: The hairpin RNA expression module is placed under the control of the β-estradiol inducible system, so that the expression level of siRNA can be adjusted by adding different concentrations of β-estradiol, thereby achieving dynamic regulation of the plasmid copy number.

[0013] Preferably, the method for reconstructing the RNAi pathway in yeast cells comprises: DCR1 Gene, AGO1 The genes are respectively integrated into the neutral sites of the Saccharomyces cerevisiae genome. DCR1 The nucleotide sequence of the gene is preferably as shown in SEQ ID NO. 14. AGO1 The nucleotide sequence of the gene is preferably as shown in SEQ ID NO. 15.

[0014] Preferably, the neutral sites of the Saccharomyces cerevisiae genome include: site 416d and site 308a; the nucleotide sequence of the 416d site is shown in SEQ ID NO. 1; the nucleotide sequence of the 308a site is shown in SEQ ID NO. 2.

[0015] Preferably, the chemical induction method comprises: regulating the hairpin RNA expression module by introducing a β-estradiol inducible system into the Saccharomyces cerevisiae genome.

[0016] Preferably, the β-estradiol-inducible system comprises: a DNA binding domain ZF97-4 that binds to β-estradiol; an estrogen ligand binding domain; a transcriptional activation domain VP16; and an engineered promoter containing the 97-4 operator. The nucleotide sequence of the β-estradiol-inducible system is preferably as shown in SEQ ID NO. 3.

[0017] Preferably, the plasmid is a high-copy plasmid containing a 2μ replicon. The nucleotide sequence of the 2μ replicon is preferably as shown in SEQ ID NO. 4.

[0018] Preferably, the selective marker gene comprises an antibiotic resistance gene or an auxotrophic marker gene. The antibiotic resistance gene may be HygR 、 NrS Gene. The nutritional deficiency marker gene can be URA3 、 LEU2 、 TRP1 Gene.

[0019] The present invention also provides a system for dynamically regulating the copy number of plasmids in Saccharomyces cerevisiae, comprising:

[0020] RNA interference pathway reconstruction module, used to integrate the DCR1 gene and AGO1 gene from Saccharomyces castellii into the neutral site of the Saccharomyces cerevisiae genome;

[0021] A specific siRNA module is used to introduce a hairpin RNA expression module targeting a plasmid-encoded selection marker gene and a β-estradiol inducible system for regulating hairpin RNA expression into the Saccharomyces cerevisiae genome; the hairpin RNA expression module includes an estradiol inducible system and a hairpin structure sequence homologous to the selection marker gene.

[0022] The present invention also provides the application of the system for dynamically regulating the copy number of plasmids in Saccharomyces cerevisiae in microbial metabolic engineering.

[0023] Preferably, the application includes:

[0024] Constructing an engineered yeast strain containing the system, wherein the hairpin RNA expression module of the system targets the plasmid-encoded selection marker gene HygR ;

[0025] Build contains CrtE 、 CrtB 、 CrtI Genes and selectable marker genes HygR Plasmids;

[0026] Transforming the constructed plasmid into the engineered yeast Saccharomyces cerevisiae to obtain a carotenoid-synthesizing strain;

[0027] The carotenoid-producing strain is fermented under the induction of β-estradiol at a preferred concentration of 200 nM to obtain carotenoids.

[0028] Preferably, the carotenoids include β-carotene, α-carotene, lycopene, lutein and zeaxanthin.

[0029] Preferably, the CrtE The nucleotide sequence of the gene is preferably as shown in SEQ ID NO. 9; CrtB The nucleotide sequence of the gene is preferably as shown in SEQ ID NO. 10; CrtI The nucleotide sequence of the gene is preferably as shown in SEQ ID NO.11.

[0030] The present invention applies the system to the carotenoid biosynthesis pathway. CrtE (geranylgeranyl pyrophosphate synthase), CrtB (phytoene synthase) and CrtI (phytoene desaturase) gene plasmid and insert it into the plasmid HygR Select the marker gene. The constructed plasmid is transformed into a yeast strain integrated with the system for dynamically controlling the copy number of plasmids in Saccharomyces cerevisiae to construct an engineered strain for carotenoid synthesis. CrtE 、 CrtB and CrtI Genes are key enzymes in the carotenoid biosynthesis pathway. Optimizing the expression of these genes can increase carotenoid production. Fermentation experiments were conducted under different concentrations of β-estradiol, monitoring yeast growth curves and carotenoid production. The results showed that the induced yeast strain increased carotenoid production by 18.6-fold compared to the wild-type control strain. This result validates the potential of RNAi-mediated plasmid copy number control systems in metabolic engineering and provides a new approach to improving the production performance of microbial cell factories.

[0031] Beneficial effects of the present invention:

[0032] 1. Dynamic regulation of plasmid copy number: This invention uses RNA interference technology to achieve dynamic regulation of Saccharomyces cerevisiae plasmid copy number. It can adjust the plasmid copy number in real time according to metabolic needs, optimize gene expression levels, and solve the problem of fixed copy number in traditional plasmid systems.

[0033] 2. Increased metabolite production: Dynamically controlling plasmid copy number can significantly increase metabolite production and enhance the production performance of microbial cell factories. In the carotenoid biosynthesis pathway, dynamic control of plasmid copy number increased lycopene production by 18.6 times, significantly outperforming traditional static plasmid systems.

[0034] 3. Universal application: This system is not only applicable to antibiotic resistance genes, but can also be extended to other selection marker genes (such as URA3 、 LEU2 、 TRP1 ), has a wide range of applicability, enabling it to be widely used in different metabolic engineering scenarios.

[0035] In summary, this invention achieves dynamic regulation of Saccharomyces cerevisiae plasmid copy number through RNA interference technology, overcoming the limitations of traditional plasmid systems. This system not only enhances the flexibility and precision of gene expression but also significantly improves bioproduction efficiency, providing new tools and strategies for synthetic biology and metabolic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 In Example 1 of the present invention AGO1 and DCR1 Verification results of gene integration at sites 416d and 308a respectively.

[0037] Figure 2 This is the effect of RNA interference pathway reconstruction on the host Saccharomyces cerevisiae in Example 1 of the present invention.

[0038] Figure 3 The figure shows the change in plasmid copy number under the induction of different concentrations of β-estradiol in Example 1 of the present invention.

[0039] Figure 4 The fluorescence intensity and copy number changes of different auxotrophic marker plasmids under RNAi regulation in Example 1 of the present invention are shown.

[0040] Figure 5 This is the application effect of the system for dynamically regulating the plasmid copy number in Saccharomyces cerevisiae in Example 2 of the present invention in the lycopene biosynthesis pathway. DETAILED DESCRIPTION

[0041] The following describes the embodiments of the present invention by specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. The various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the case of no conflict, the features in the following examples and embodiments can be combined with each other. In the embodiments of the present invention, unless otherwise specified, the methods used are all conventional methods, and the reagents used can be obtained from commercial sources.

[0042] The culture medium used in the examples is:

[0043] 1) LB medium: Weigh 10 g tryptone, 5 g yeast extract, and 10 g sodium chloride, dissolve in water, and dilute to 1 L. For solid medium, add 2% agar powder. Sterilize at 121°C for 20 min. After cooling, add the appropriate antibiotics.

[0044] 2) YPD medium: Weigh 20 g tryptone, 10 g yeast extract, and 20 g glucose, dissolve in water, and adjust the volume to 1 L. For solid medium, add 2% agar powder. Sterilize at 115°C for 30 min. After cooling, add the appropriate antibiotics.

[0045] The transformation method of Saccharomyces cerevisiae in the embodiment:

[0046] Preparation of competent cells: Take an appropriate amount of bacterial solution from the seed tube and inoculate it into the corresponding liquid culture medium, and culture it at 30℃ overnight until saturated; take an appropriate amount of saturated bacterial solution into 25 mL liquid culture medium, and culture it at 30℃ overnight until the cell density reaches 1×10 8 / mL (OD600≈1.3~1.5); transfer the bacterial solution to a 50 mL sterile centrifuge tube, centrifuge at 4000 rpm at 4°C for 3 min, discard the supernatant, and resuspend in 8 mL ice-cold sterile water; add ice-cold 1 mL 10×TE buffer and 1 mL 10×LiAc solution, incubate at 30°C on a shaker for 45 min; add 250 μL 1 M DTT aqueous solution, incubate at 30°C on a shaker for 15 min; add ice-cold sterile water to 40 mL in the above centrifuge tube, centrifuge at 4000 rpm at 4°C for 3 min, discard the supernatant; add 20~30 mL ice-cold sterile water to resuspend, centrifuge at 4000 rpm at 4°C for 3 min, discard the supernatant; add 20~30 mL ice-cold 1 M sorbitol aqueous solution, centrifuge at 4000 rpm at 4°C for 3 min, discard the supernatant; add 200 μL ice-cold 1 M The sorbitol aqueous solution was dispensed into ice-cold 1.5 mL centrifuge tubes, 100 μL per tube, to obtain electroporation competent Saccharomyces cerevisiae.

[0047] Electroporation: Take 100 μL of Saccharomyces cerevisiae competent cells, add 5-10 μL of plasmid or linear fragment, mix gently, and transfer to a 0.1 cm electroporation reaction cup; set the electroporation instrument mode to Saccharomyces cerevisiae, preheat for ten minutes, and then electroporate at 1.5 kV; after electroporation, quickly add 1 mL of ice-cold 1 M sorbitol and incubate in a 30°C water bath for 3 hours, inverting and mixing every half hour to prevent sedimentation; remove the incubated centrifuge tube and centrifuge at 1000 rpm for 4 minutes. Discard part of the supernatant and spread it on the corresponding culture medium. Transformants will grow after 2-4 days.

[0048] The shake flask fermentation method of Saccharomyces cerevisiae in the examples was as follows: an appropriate amount of bacteria from a glycerol tube stored at -80°C was added to 5 mL of liquid culture medium and cultured at 30°C and 220 rpm for 48 h; 1 mL of the above bacterial solution was added to 20 mL of liquid culture medium, with an initial OD600 of approximately 0.2, and cultured at 30°C and 220 rpm for 4 days.

[0049] Lycopene extraction and detection in the examples: 1 mL of fermentation broth was centrifuged at 12,000 rpm for 2 min to collect the cells, the supernatant was discarded, and the cells were washed twice with water; 1 mL of ice-cold acetone was added to resuspend the cells; after sonication for 30 min, the cells were centrifuged at 12,000 rpm for 10 min, the supernatant was filtered through a membrane, and analyzed by HPLC; another 10 mL of fermentation broth was centrifuged at 12,000 rpm for 2 min, and the supernatant was discarded; the cells were washed once with water and then oven-dried at 80°C to constant weight for calculation of dry cell weight; HPLC analysis was performed using a Welch Ultimate AQ-C18 column (4.6 × 250 mm, 5 μm), a mobile phase of acetonitrile:methanol:isopropanol (5:3:2 v / v / v), a flow rate of 0.5 mL / min, a column temperature of 30°C, and lycopene was detected at a wavelength of 470 nm.

[0050] Table 1. Plasmids and strains used in the examples

[0051] plasmids describe source p-Cas9 pRS414, AmpR, NrsR, TEF1p-Cas9-CYC1t Addgene p-sgRNA pRS426, AmpR, HygR, SNR52p-gRNA-SUP4t Addgene p-2µ-HygR-GFP pRS426, AmpR, HygR, TDH3p-yeGFP-ADH1t This study constructs p-2µ-URA3-GFP pRS426, AmpR, URA3, TDH3p-yeGFP-ADH1t This study constructs p-2µ-TRP1-GFP pRS426, AmpR, LEU2, TDH3p-yeGFP-ADH1t This study constructs p-2µ-LEU2-GFP pRS426, AmpR, TRP1, TDH3p-yeGFP-ADH1t This study constructs p-2µ-HygR-CRT pRS426, AmpR, HygR, GAL7p-CrtE-PGK1t_GAL1p-CrtB-ADH1t_GAL10p-CrtI-CYC1t This study constructs strains describe source CEN.PK2-1C EUROSCARF CGFP CEN.PK2-1C, 911b∷ TDH3p-yeGFP-ADH1t This study constructs CE-SH CEN.PK2-1C, gal80△∷ synER-siRNAHygR This study constructs RNAi+ CEN.PK2-1C, 416d∷TEF1p-AGO1-ADH1t, 308a∷TEF1p-DCR1-ADH1t This study constructs RGFP RNAi+ , 911b∷TDH3p-yeGFP-ADH1t This study constructs C-P2HGFP CEN.PK2-1C, p-2µ-HygR-GFP This study constructs R-P2HGFP RNAi+ , p-2µ-HygR-GFP This study constructs RE-SH-P2HGFP RE-SH,p-2µ-HygR-GFP This study constructs RE-SH RNAi+ , gal80△∷synER-siRNAHygR This study constructs RE-SU RNAi+ , gal80△∷synER-siRNAURA3 This study constructs RE-ST RNAi+ , gal80△∷synER-siRNATRP1 This study constructs RE-SL RNAi+ , gal80△∷synER-siRNALEU2 This study constructs RE-SU-P2UGFP RE-SU, p-2µ-URA3-GFP This study constructs RE-ST-P2TGFP RE-ST, p-2µ-TRP1-GFP This study constructs RE-SL-P2LGFP RE-SL, p-2µ-TRP1-GFP This study constructs CE-SH-P2HCRT CE-SH, p-2µ-HygR-CRT This study constructs R-P2HCRT RNAi+, p-2µ-HygR-CRT This study constructs RE-SH-P2HCRT RE-SH, p-2µ-HygR-CRT This study constructs

[0052] Table 2. Primers used in the examples

[0053] name sequence 308-yz-S AAAGTTGAAAGAATCCCGTATC 308-yz-A CCATATTGTTTGGCGCTGAT 416-yz-S ACTTGGTTGGCGTGTTTC 416-yz-A TGGGGTTGTCAATGTGGT AGO1-S AGTTTTAATTACAAAaatccttggcttggaacagg AGO1-A TCATAAGAAATTCGCaataggatattaataatagatgtttttaaacatac DCR1-S AGTTTTAATTACAAAtaaaagatcaattaaacaat DCR1-A TCATAAGAAATTCGCaaatgaacttaatgttatca 2UM-URA3-S tgacataactaattacatgactcgagaTTAGTTTTGCTGGCCGCA 2UM-URA3-A catccgaacataaacaaccCATATGATGTCGAAAGCTACATATAAGGAAC 2UM-LEU-S tgacataactaattacatgactcgagattaagcaaggattttcttaacttct 2UM-LEU-A catccgaacataaacaaccCATATGatgtctgcccctaagaagat 2UM-TRP-S tgacataactaattacatgactcgagactatttcttagcatttttgacgaa 2UM-TRP-A catccgaacataaacaaccCATATGatgtctgttattaatttcacaggta g-416d-S tagtgcacttaccccacgttgttttagagctagaaatagc g-416d-A aacgtggggtaagtgcactagatcatttatctttcactgc g-308a-S CACTTGTCAAACAGAATATAGTTTTAGAGCTAGAAATAGCAAG g-308a-A CACTTGTCAAACAGAATATAGTTTTAGAGCTAGAAATAGCAAG CRT-S gggaacaaaagctggagctcacatggagacatcaaaaattga CRT-A actatagggcgaattgggtacctttgtacagaaaaaaaagaaaaatttgaaa g-gal80-S GTGTCATGCAGTTTCAAAGGgttttagagctagaaatagcaagtt g-gal80-A CCTTTGAAACTGCATGACACgatcatttatctttcactgcgg 80-YZ-S ATACCCCTTTCTTCTCTCCC 80-YZ-A AATCAATCCAGCACCATCAC

[0054] Among them, 308-yz-S / A was used for 308a integration site verification, 416-yz-S / A was used for 416d integration site verification, AGO1-S / A was used for AGO1 gene amplification, DCR1-S / A was used for DCR1 gene amplification, 2UM-URA3-S / A was used for URA3 gene amplification, 2UM-LEU-S / A was used for LEU2 gene amplification, 2UM-TRP-S / A was used for TRP1 gene amplification, g-416d-S / A was used for pg-416d plasmid construction, g-308a-S / A was used for pg-308a plasmid construction, CRT-S / A was used for CRT gene amplification, g-gal80-S / A was used for pg-gal80 plasmid construction, and 80-YZ-S / A was used for gal80 site integration verification.

[0055] The PCR amplification program for cloning in the embodiment is: ((98°C, 30 s), 1 cycle); ((98°C, 10 s), (50-72°C, 30 s), (72°C, 30 s / kb), 35 cycles); (72°C, 120 s), 1 cycle); stored at 4°C.

[0056] Example 1: Construction and validation of a system for dynamically regulating plasmid copy number in Saccharomyces cerevisiae

[0057] (1) System construction

[0058] 1. Construction of RNAi+ strains

[0059] In order to obtain DCR1 and AGO1 The gene fragment was PCR-generated using Q5 High Fidelity 2× Master Mix (NEB) and cloned into a plasmid containing the TEF1 promoter, ADH1 terminator, and homology arms of the 416d / 308a sites. AGO1 To knock in the gene encoding Argonaute protein, we electroporated the donor fragment and the sgRNA plasmid targeting the corresponding site (using the p-sgRNA plasmid as a template, the whole plasmid was PCR amplified using primers with the corresponding targeting site, and the PCR product was recovered and transformed into DH5α competent cells, and the plasmid was successfully constructed by sequencing) into the Saccharomyces cerevisiae CEN.PK2-1C containing the p-Cas9 plasmid (the sgRNA at the 416d site is TAGTGCACTTACCCCACGTT, and the sgRNA at the 308a site is CACTTGTCAAACAGAATATA). After electroporation, the cells were incubated at 30°C for 3 h, spread onto YPD solid medium containing nourseothricin sulfate and hygromycin B (the final concentration of nourseothricin was 50 mg / L, and the final concentration of hygromycin B was 300 mg / L), and cultured in a 30°C incubator for 2 days. After a single colony grows on the double-antibody plate, pick it into a test tube and culture it in a shaker at 30°C for 2 days. Take 200 μL of the bacterial solution and add phenol and chloroform to quickly extract the total DNA. Design primers 416-yz-S / A and 308-yz-S / A according to the gene, ensuring that the forward primer and reverse primer are located upstream and downstream of the left and right arms of 416d or 308a, respectively. The PCR results are as follows: Figure 1 As shown, a successful integration RNAi+ strain was obtained.

[0060] 2. Functional Verification of RNAi+ Strains

[0061] First, we examined DCR1 and AGO1 The impact of gene introduction on yeast itself. Through growth curve measurement (growth conditions: culture in YPD liquid medium, 30℃, 220 rpm), we found that the restoration of the RNAi pathway has a certain impact on the growth of the strain. Compared with the wild-type strain, the RNAi+ strain grows more slowly, but the final biomass achieved is not much different ( Figure 2 Middle B).

[0062] In order to eliminate the possible interference of RNA interference system on reporter gene transcription expression, we selected green fluorescent protein ( GFP ) as a reporter gene and the same method as above was used to GFPThe expression cassette was precisely integrated into the neutral site 911b of the genome of the wild-type (WT) strain and the RNAi strain, thereby constructing the C-GFP and R-GFP strains. GFP Clone into a plasmid vector containing 2µ replicon to construct plasmid p-2µ-HygR-GFP and transfer it into a free plasmid. GFP The yeast strains were introduced to generate C-P2HGFP and R-P2HGFP strains. Subsequent fluorescence intensity measurements showed no significant difference between the two strains. However, unlike genomic integration of GFP expression, without the additional introduction of hairpin transcripts to interfere with gene expression, the GFP fluorescence intensity in the R-P2HGFP strain increased by approximately 1.59 times compared to the C-P2HGFP strain ( Figure 2 Middle C). The resistance gene on the plasmid was found based on the transcription status of the gene on the plasmid ( HyB ) The decrease in transcriptional abundance leads to a significant increase in the transcription level of the reporter gene GFP. GFP The nucleotide sequence of the gene is shown in SEQ ID NO. 12.

[0063] 3. Regulating siRNA to achieve engineered control of plasmid copy number

[0064] To further enhance the regulation of plasmid copy number, siRNA was introduced to further enhance the effect of RNA interference, thereby increasing plasmid copy number. We introduced an estradiol-inducible transcriptional regulatory system into the Saccharomyces cerevisiae strain (nucleotide sequence shown in SEQ ID NO. 3). This system contains a DNA binding domain (ZF97-4), an estrogen ligand binding domain, a transcriptional activation domain (VP16), and an engineered promoter containing a 7× 97-4 operator ( Figure 3 Middle A) has good inducible expression effect in yeast.

[0065] The green fluorescent protein was placed under the engineered CYC1 weak promoter, and the entire estradiol-inducible transcriptional regulatory system was integrated into the RNAi strain genome to generate the RE-GFP strain. During growth (growth conditions: cultured in YPD liquid medium, 30°C, 220 rpm), different concentrations of estradiol (1, 10, 100, and 1000 nM) were used for induction. The experimental results showed that with increasing estradiol concentrations, the production of fluorescent protein induced by this system showed a gradual increase, indicating that this system has a good induction transcription effect in Saccharomyces cerevisiae. Figure 3 Middle B).

[0066] Afterwards, we will GFP Gene replacement with HygRA hairpin structure gene with homology to the gene (nucleotide sequence is shown in SEQ ID NO. 5, constructing strain RE-SH) was introduced into the p-2µ-HygR-GFP plasmid to generate the RE-SH-P2HGFP strain. Real-time quantitative PCR (qPCR) technology was used to detect changes in plasmid copy number. Single-copy genes in the yeast genome (such as ERG13) were used as internal reference genes, and the relative changes in plasmid copy number were calculated by comparing the Ct value difference between the target gene and the internal reference gene. The results showed that with the increase of inducer concentration, the plasmid copy number gradually increased; and compared with the C-P2HGFP strain, the plasmid copy number increased by up to 7.13 times, indicating that our system has the potential to control plasmid copy number ( Figure 3 Middle C).

[0067] 4. Universality of RNAi-mediated plasmid copy number regulation strategies

[0068] We replaced the resistance gene on the p-2µ-HygR-GFP plasmid with three auxotrophic markers, URA3, LEU2, and TRP1, to construct the plasmids p-2µ-URA3-GFP, p-2µ-TRP1-GFP, and p-2µ-LEU2-GFP. We also constructed strains containing homologous hairpin structure sequences for the corresponding selection markers, resulting in RE-SU, RE-ST, and RE-SL, so that the hairpin RNA expression module targeted the plasmid-encoded selection marker gene. These plasmids were introduced into the corresponding strains to construct the strains RE-SU-P2UGFP, RE-ST-P2TGFP, and RE-SL-P2LGFP. Fluorescence intensity measurements using a microplate reader revealed that the introduction of RNAi and siRNA increased the fluorescence intensity of the strains to varying degrees for the different selection markers, with the most significant increase in fluorescence intensity for the TRP1 selection marker ( Figure 4 ).

[0069] Example 2: RNAi regulation of plasmid copy number to increase lycopene production

[0070] The optimized GAL promoter was constructed CrtE 、 CrtB and CrtI Gene( Figure 5 A) and integrated it into a region containing a 2μ replication origin and HygR The high-copy plasmid vector was used to obtain the plasmid p-2µ-HygR-CRT ( Figure 5The plasmid was electroporated into Saccharomyces cerevisiae to obtain four engineered strains: C-P2HCRT, CE-SH-P2HCRT, R-P2HCRT, and RE-SH-P2HCRT. The growth curve of Saccharomyces cerevisiae was monitored by shake flask fermentation under the induction of 200 nM β-estradiol, and the lycopene production capacity was detected by high-performance liquid chromatography (HPLC) to verify the effect of plasmid copy number regulation on metabolite synthesis. The results are shown in Figure 2. Figure 5 The experimental results showed that the induced yeast strain increased carotenoid production by 18.6 times compared to the wild-type control strain. This result validates the potential application of RNAi-mediated plasmid copy number regulation in metabolic engineering and provides a new method for improving the production performance of microbial cell factories.

[0071] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection of the present invention.

Claims

1. A method for dynamically regulating the copy number of a plasmid in Saccharomyces cerevisiae, characterized in that: include: Reconstructing an RNA interference pathway in Saccharomyces cerevisiae cells and using a chemically inducible hairpin RNA expression module to target a plasmid-encoded selectable marker gene to achieve dynamic regulation of plasmid copy number; the hairpin RNA expression module includes a β-estradiol inducible system and a hairpin structure sequence homologous to the selectable marker gene; The method for reconstructing the RNA interference pathway in a Saccharomyces cerevisiae cell comprises: integrating the DCR1 gene and the AGO1 gene from Saccharomyces castellii into neutral sites of the Saccharomyces cerevisiae genome; the neutral sites of the Saccharomyces cerevisiae genome include: site 416d and site 308a; The chemical induction method comprises: regulating the hairpin RNA expression module by introducing a β-estradiol induction system into the Saccharomyces cerevisiae genome; The β-estradiol inducible system comprises: a DNA binding domain ZF97-4 that binds to β-estradiol, an estrogen ligand binding domain, a transcription activation domain VP16, and an engineered promoter containing a 97-4 operator; The plasmid is a high copy plasmid containing a 2μ replicon; The selection marker genes include: antibiotic resistance genes and nutritional deficiency marker genes.

2. The method according to claim 1, wherein The nucleotide sequence of the 416d site is shown in SEQ ID NO.1; the nucleotide sequence of the 308a site is shown in SEQ ID NO.

2.

3. A system for dynamically regulating plasmid copy number in Saccharomyces cerevisiae, characterized in that: include: RNA interference pathway reconstruction module, used to integrate the DCR1 gene and AGO1 gene from Saccharomyces castellii into the neutral site of the Saccharomyces cerevisiae genome; The neutral sites of the Saccharomyces cerevisiae genome include: site 416d and site 308a; A specific siRNA module is used to introduce a hairpin RNA expression module targeting a plasmid-encoded selectable marker gene and a β-estradiol-inducible system for regulating hairpin RNA expression into the Saccharomyces cerevisiae genome; the hairpin RNA expression module includes a β-estradiol-inducible system and a hairpin structure sequence homologous to the selectable marker gene; The β-estradiol inducible system comprises: a DNA binding domain ZF97-4 that binds to β-estradiol, an estrogen ligand binding domain, a transcription activation domain VP16, and an engineered promoter containing a 97-4 operator; The plasmid is a high copy plasmid containing a 2μ replicon; The selection marker genes include: antibiotic resistance genes and nutritional deficiency marker genes.

4. Application of the system for dynamically controlling the copy number of plasmids in Saccharomyces cerevisiae according to claim 3 in microbial metabolic engineering, characterized in that: include: Constructing an engineered yeast strain of Saccharomyces cerevisiae containing the system, wherein the hairpin RNA expression module of the system targets the plasmid-encoded selection marker gene HygR; Construct a plasmid containing CrtE, CrtB, CrtI genes and the selection marker gene HygR; Transforming the constructed plasmid into the engineered yeast Saccharomyces cerevisiae to obtain a carotenoid-synthesizing strain; Carotenoids are obtained by fermenting a carotenoid-producing strain under the induction of β-estradiol.

Images