Application of McMYC2 transcription factor in regulation and control of stress resistance of mint

Abstract

The invention belongs to the technical field of genetic engineering breeding, and discloses application of an McMYC2 transcription factor in regulation and control of stress resistance of mint. Expression characteristics of an encoding gene (namely an McMYC2 gene) of an McMYC2 transcription factor are studied, the McMYC2 gene plays an important regulation and control role in response of mint to various abiotic stresses such as exogenous ABA, NaCl, AlCl3, CdCl2, CuCl2 and drought, regulation and control of mint plants with stable overexpression of the McMYC2 gene to drought stress are further analyzed, and it is found that under the drought condition, the McMYC2 gene has a good application prospect. The mint plant with the McMYC2 gene overexpressed is lower in water loss rate, higher in SOD and POD enzyme activity and higher in drought tolerance compared with a wild type (WT) mint plant. Theoretical support is provided for improving the stress resistance of the mint and cultivating high-quality mint varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering breeding and relates to the application of McMYC2 transcription factor in regulating the stress resistance of mint. Background Art

[0002] Peppermint (Mentha canadensis L.) is a traditional Chinese medicinal material. Its dried aerial parts are used as medicine, which has the effects of clearing away heat and relieving exterior symptoms, soothing the liver and relieving depression, and is used to treat wind-heat colds, headaches, fevers, sore throats, etc. Peppermint leaves and stems contain volatile components, commonly known as "essential oils", and their content is the main indicator for evaluating the medicinal and flavor properties of peppermint. Modern pharmacological studies have shown that peppermint essential oil has the effects of expectorant, anti-inflammatory, analgesic, and central nervous system excitation. At the same time, peppermint essential oil is widely used in food, spices, cosmetics, etc. In some parts of my country, peppermint is also a fresh vegetable, ornamental plant, and potential energy plant, with huge medicinal and economic value.

[0003] Studies have found that peppermint essential oil is also closely related to the life activities of plants, such as regulating plant pollination, seed dispersal, growth and development. In recent years, more and more studies have shown that peppermint essential oil is closely related to the abiotic defense and biological defense processes of plants. For example, the menthol present in the essential oil of mint plants has insecticidal and antiviral activity in addition to its characteristic fragrance and flavor. At the same time, peppermint essential oil has a good control effect on citrus acid rot. Liu Linyu et al. also found that peppermint essential oil has a good inhibitory effect on plant pathogenic fungi such as Botrytis cinerea, rapeseed sclerotinia, cotton wilt, pepper phytophthora, and bean anthracnose. Qu Yangchun et al. found that essential oils of different species have a significant inhibitory effect on Aspergillus flavus, which can be used for rice mildew prevention and preservation. In addition, peppermint essential oil can effectively inhibit fruit rot and prolong the shelf life of fruits. It can be seen that peppermint essential oil not only has medicinal and commercial development value, but also has a significant regulatory effect on the growth and development of crops. At the same time, peppermint essential oil is a plant-based "green pesticide" with a certain biological control effect. It is of great significance for preventing and controlling diseases and pests in agricultural production, reducing environmental pollution, and reducing agricultural production costs.

[0004] At present, with the increasing market demand for essential oils, the output value of peppermint essential oils has also increased rapidly. However, the potential for increasing peppermint production is limited. In addition, abiotic stress factors such as drought are one of the main limiting factors for plant growth and yield formation. How to improve peppermint stress resistance through molecular means, promote the improvement of peppermint quality, and achieve seed innovation has become an urgent problem to be solved in peppermint breeding and improvement. Summary of the invention

[0005] In order to cultivate new mint varieties with high quality and strong adaptability and improve the resistance of mint to drought environment, the present invention uses genetic engineering to clarify the important function of mint McMYC2 transcription factor in regulating mint stress resistance.

[0006] The present invention firstly provides application of a mint transcription factor in regulating the stress resistance of mint. The transcription factor is McMYC2, and the amino acid sequence of McMYC2 is shown in SEQ ID NO:1.

[0007] Furthermore, in the above application, the stress resistance includes drought resistance.

[0008] Furthermore, in the above application, the mint transcription factor McMYC2 is overexpressed, and the drought resistance of the mint plants is enhanced.

[0009] In a second aspect, the present invention seeks to protect a gene recombinant vector, wherein the gene recombinant vector contains a gene encoding a mint transcription factor McMYC2, and the nucleotide sequence of the gene encoding the gene is shown in SEQ ID NO:2.

[0010] In a third aspect, the present invention seeks to protect a recombinant genetically engineered bacterium, wherein the recombinant genetically engineered bacterium contains the above-mentioned gene recombination vector.

[0011] Based on the above characteristics of McMYC2, the fourth aspect of the present invention provides a method for breeding drought-resistant mint varieties: constructing an overexpression recombinant vector containing a mint transcription factor McMYC2 encoding gene, and transferring it into a mint plant for overexpression; the nucleotide sequence of the mint transcription factor McMYC2 encoding gene is shown in SEQ ID NO: 2.

[0012] Compared with the prior art, the invention "Application of McMYC2 transcription factor in regulating stress resistance of mint" has the following beneficial effects:

[0013] The present invention overexpresses the coding gene of the mint McMYC2 transcription factor (i.e., the McMYC2 gene) in mint plants by genetic engineering means to obtain transgenic mint plants with overexpression of the McMYC2 gene. Experiments have shown that transgenic mint plants are more drought-resistant than wild-type (WT) mint plants, with higher activities of superoxide dismutase (SOD) and peroxidase (POD) and lower relative water loss rate. qRT-PCR analysis found that overexpression of McMYC2 can significantly increase the expression level of the drought-related gene McWRKY57 in mint leaves, indicating that McMYC2 plays an important role in mint drought resistance. In addition, the McMYC2 gene responds to abscisic acid (ABA), NaCl, AlCl 3 , CdCl 2 , CuCl 2It is a widely expressed gene involved in the stress resistance of mint plants.

[0014] Based on the above functions of the McMYC2 gene, it is used as a candidate gene for mint variety improvement to improve the drought resistance of mint, providing a technical approach for reference for mint variety improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the mint McMYC2 gene clone, and the red arrow points to the target gene band.

[0016] Figure 2 Schematic diagram of the McMYC2 gene and McMYC2 protein structure.

[0017] Figure 3 The expression patterns of McMYC2 gene in leaves (A) and roots (B) under 100 μmol / LABA treatment.

[0018] Figure 4 The expression patterns of McMYC2 gene in leaves (A) and roots (B) under 150 μmol / L NaCl treatment.

[0019] Figure 5 100 μmol / L AlCl 3 Expression patterns of McMYC2 gene in leaves (A) and roots (B) under treatments.

[0020] Figure 6 100 μmol / L CdCl 2 Expression patterns of McMYC2 gene in leaves (A) and roots (B) under treatments.

[0021] Figure 7 100 μmol / L CuCl 2 Expression patterns of McMYC2 gene in leaves (A) and roots (B) under treatments.

[0022] Figure 8 The expression patterns of McMYC2 gene in leaves (A) and roots (B) under drought treatment.

[0023] Fig. 9 The phenotypes of WT and transgenic peppermint after 20% PEG treatment for 3 h. The yellow and red arrows indicate the WT and transgenic peppermint stems under 20% PEG treatment, respectively.

[0024] Fig.10 The SOD and POD activities of WT and transgenic peppermint were measured under 20% PEG treatment. Fig.10 A in the figure shows the change of SOD activity under 20% PEG treatment; Fig.10B in the figure shows the changes of POD activity under 20% PEG treatment.

[0025] Fig.11 Relative water loss rate of WT and transgenic peppermint leaves.

[0026] Fig.12 The expression of McWRKY57 in mint leaves with McMYC2 transiently overexpressed. DETAILED DESCRIPTION

[0027] The present invention is explained below in conjunction with the embodiments, and the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] The mint (M. canadensis L.) and peppermint (Mentrapiperita) used in the experiment were grown in an artificial climate greenhouse with a growth condition of 16h light / 8h dark. The tobacco used in the experiment was Nicotiana benthamiana, which was grown in a constant temperature and light incubator and grown for 4 to 5 weeks under normal conditions.

[0029] Example 1

[0030] This example provides the screening of the mint McMYC2 gene.

[0031] Studies have shown that MYC2, a core bHLH transcription factor in the jasmonic acid (JAs) signaling pathway, plays an important role in regulating plant resistance to biotic and abiotic stresses and regulating secondary metabolism. Therefore, the present invention first screened mint bHLH genes. Using the GO annotation of the previous mint MeJA-treated transcriptome data and the Blast alignment of local homologous proteins with Arabidopsis bHLH family members, a total of 123 bHLH transcription factor Unigenes were screened. The RPKM values ​​of these bHLH transcription factors under normal conditions (CK) and MeJA-treated conditions were obtained using transcriptome data. The Logarithm of RPKM was taken. 2 The (MeJA / CK) values ​​showed that 61 bHLH genes were upregulated and 62 were downregulated under MeJA induction.

[0032] Subsequently, four MYCs genes were identified from the up-regulated bHLH transcription factors that were significantly up-regulated by jasmonic acid, among which Unigene0042863 was the most significantly up-regulated. Based on the expresssequence tag (EST) sequence obtained by transcriptome sequencing, the partial cDNA sequences of the above four MYCs genes were spliced. Further NR (non-redundant protein) database annotation and sequence analysis showed that Unigene0042863 was homologous to the MYCs gene MYC2 that regulates abiotic stress and secondary metabolism in plants, so it was named McMYC2 gene.

[0033] Example 2

[0034] This example provides the mint McMYC2 gene cloning.

[0035] 1. Extraction of total RNA from mint and synthesis of first-strand cDNA

[0036] Two-week-old young leaves of peppermint were collected and frozen in liquid nitrogen and then ground into powder. Total RNA from the leaves was extracted according to the steps of Tiangen RNAprepPure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441). The obtained RNA was subjected to 1% agarose gel electrophoresis to determine RNA integrity, and the RNA concentration and purity were determined by Nanodrop 2000 spectrophotometer. The first strand of cDNA was synthesized using HiScript II 1st Strand cDNA Synthesis Kit (+gDNAwiper) (R212, vazyme) according to the instructions. The reaction system and RT-PCR reaction procedure are shown in Table 1.

[0037] Table 1. Reverse transcription reaction system and RT-PCR reaction procedure

[0038] Components Dosage 4×gDNAwiperMix 4μL Oligo(dT)23VN(50μM) 1μL Random hexamers (50ng / μl) 1μL Total RNA 1 μg <![CDATA[RNasefreeddH 2 The]]> To16μL 42℃,2min / 10×RTMix 2μL HiScriptIIEnzymeMix 2μL 50℃, 15min; 85℃, 15s /

[0039] 2. McMYC2 gene amplification and DNA purification

[0040] According to the McMYC2 gene sequence obtained above, the full-length amplification primers of McMYC2 gene were designed using DNAMAN software: McMYC2-F: 5'-ATGATTGATTACCGTCTGCCG-3' (SEQ ID NO: 3); McMYC2-R: 5'-CTAGTTTATTTCAGCAGCAAGTC-3' (SEQ ID NO: 4).

[0041] The McMYC2 gene was amplified using mint leaf cDNA or DNA as a template. The PCR amplification system is shown in Table 2, and the amplification program is shown in Table 3. The PCR product was identified and separated by 1% agarose gel electrophoresis, and the PCR product of the McMYC2 gene was recovered using the Biomed DNA gel recovery kit (DH103-01) according to the instructions. The concentration of the PCR product was determined by Nanodrop 2000 spectrophotometer and set aside.

[0042] Table 2. McMYC2 gene PCR amplification system

[0043]

[0044]

[0045] Table 3. McMYC2 gene PCR amplification procedure

[0046]

[0047] The PCR product was sequenced and aligned to obtain the correct CDS sequence. Sequence analysis showed that the full length of the McMYC2 gene was 1854 bp (nucleotide sequence as shown in SEQ ID NO: 2), encoding 617 amino acids (amino acid sequence as shown in SEQ ID NO: 1), with a theoretical molecular weight of 67.728 KDa and a theoretical isoelectric point of 5.64. The DNA sequence of the McMYC2 gene was further cloned by PCR ( Figure 1 , indicated by arrows). Structural analysis after sequencing showed that the McMYC2 gene had no intron structure ( Figure 2 ), which is similar to the structure of MYC2 genes in Arabidopsis, Artemisia annua and Hevea brasiliensis.

[0048] 3. McMYC2 gene and vector connection, transformation and identification of recombinant bacteria

[0049] According to the steps of the pClone007 BluntVectorKit (TSV-007B) gene cloning kit of Beijing Qingke Biotechnology Co., Ltd., the PCR product of the McMYC2 gene was connected to the intermediate vector pClone007 BluntVector. The reaction system is shown in Table 4.

[0050] Table 4. McMYC2 gene cloning reaction system

[0051] Components Dosage Purpose fragment 1~8μL pClone007BluntVector 1μL 10×Topo 1μL <![CDATA[ddH 2 The]]> up to 10 μL

[0052] The above reaction system was placed in a metal bath at 25°C for 15 minutes. After the reaction, the reaction solution was transformed into E. coli DH5α competent cells. The steps are as follows: take 50 μL of E. coli DH5α competent cells melted in an ice bath, add 10 μL of the reaction product, mix gently, and stand on ice for 30 minutes; heat shock in a 42°C water bath for 45-60 seconds, quickly transfer to an ice bath, and stand for 2 minutes; add 200 μL of non-resistant LB culture medium to the centrifuge tube, mix well, place in a 37°C shaker, and recover at 200rpm for 1 hour; absorb 200 μL of the recovery solution and evenly spread it on the LB medium plate containing Amp resistance, and invert the plate in a 37°C incubator for overnight culture. Pick a monoclonal colony and place it in LB liquid culture medium containing 50 mg / mL Amp for overnight culture. Use bacterial liquid PCR to identify the recombinant, and sequence the positive bacterial liquid containing the target fragment (Beijing Qingke Biotechnology Co., Ltd.) to confirm that the McMYC2 gene sequence has been successfully transformed. The positive bacterial solution was mixed evenly with 50% glycerol at a volume ratio of 1:1 and stored at -20°C for later use.

[0053] Example 3

[0054] This example provides an analysis of the expression characteristics of the McMYC2 gene under abscisic acid (ABA) and abiotic stress.

[0055] Select mint plants with the same growth trend, quickly dry the roots with absorbent paper, and place them in 100μmol / LABA, 150μmol / L NaCl, 100μmol / L AlCl 3 、100μmol / L CdCl 2 , 100μmol / LCuCl 2 The samples were hydroponically treated in aqueous solution and drought treated on dry absorbent paper, with 3 biological replicates for each group of samples. Leaves and roots were sampled at 0, 1, 3, 6, 12, and 24 hours after treatment, and were quickly frozen in liquid nitrogen at -80°C for later use. The total RNA extraction and reverse transcription methods were referred to Example 2.

[0056] qRT-PCR primers were designed according to the McMYC2 gene sequence (Table 5), and McMYC2 gene expression analysis was performed, with β-actin as the internal reference gene. Fluorescence quantitative experiments were performed using a BIO-RAD qPCR instrument. The qRT-PCR reaction system is shown in Table 6, and the qRT-PCR program is shown in Table 7. Each sample was replicated 3 times. -ΔΔCT The relative mRNA expression level of McMYC2 gene was calculated by the method, and the significance analysis was performed using IBM SPSS Statistics 26 software.

[0057] Table 5. qRT-PCR specific primer design

[0058] name Primer sequence (5'-3') qMcMYC2-F TGAAGCATCTGTTGTAGTGAAGC(SEQ ID NO:5) qMcMYC2-R CAATGATCTTCGACTCCGGT(SEQ ID NO:6) β-actin-F CCAGGAATTGCTGATAGGATGAG(SEQ ID NO:7) β-actin-R GCGCCACCACCTTAATCTTC(SEQ ID NO:8) qRTWRKY57-F CCATCCTAGGCTCCCTCATC(SEQ ID NO:9) qRTWRKY57-R ATTTCGCATTCTGGGAGGCA(SEQ ID NO:10)

[0059] Table 6. qRT-PCR reaction system

[0060]

[0061]

[0062] Table 7. qRT-PCR program

[0063]

[0064] Figure 3 The expression patterns of McMYC2 gene in leaves (A) and roots (B) under 100 μmol / LABA treatment. Figure 3 The results showed that under the action of ABA, the expression of McMYC2 in leaves continued to decline, reaching the lowest value at 3 hours and lasting until 24 hours; in roots, McMYC2 showed an expression pattern of first rising and then falling, reaching a peak expression at 1 hour after ABA treatment, rapidly declining to a level lower than that at 0 hours after 3 hours, and reaching the lowest expression at 24 hours.

[0065] Figure 4 The expression patterns of McMYC2 gene in leaves (A) and roots (B) under 150 μmol / L NaCl treatment. Figure 4 The results showed that under NaCl treatment, the expression of McMYC2 in leaves showed an expression pattern of first increasing and then decreasing. It was rapidly upregulated and reached the maximum value at 1 hour, and the expression levels at 6 hours and 24 hours were consistent with those at 0 hours. In roots, its expression continued to increase, reaching the maximum expression level at 6 hours, and then decreased to the same level as that at 0 hours at 12 hours, and finally increased again.

[0066] Figure 5 100 μmol / L AlCl 3 Expression patterns of McMYC2 gene in leaves (A) and roots (B) under treatments. Figure 6 100 μmol / L CdCl 2 Expression patterns of McMYC2 gene in leaves (A) and roots (B) under AlCl treatment. 3 and CdCl 2 Under the treatment, the expression patterns of McMYC2 in leaves were similar, both of which were rapidly downregulated within 1 hour after treatment and continued to be downregulated until 24 hours; in roots, the two also showed similar expression patterns, and the expression levels were rapidly downregulated within 1 hour after treatment, until the expression levels at 24 hours were consistent with those at 1 hour.

[0067] Figure 7 100 μmol / L CuCl2 Expression patterns of McMYC2 gene in leaves (A) and roots (B) under CuCl treatment. 2 In the treatment of AlCl 3 and CdCl 2 The treatments showed similar expression patterns; the expression in the root showed an expression pattern of first increasing and then decreasing, reaching the maximum expression level at 1 hour, the expression levels at other time points were lower than 0 hours, and the lowest expression level at 6 hours.

[0068] Figure 8 The expression patterns of McMYC2 gene in leaves (A) and roots (B) under drought treatment. Under drought conditions, the expression of McMYC2 in leaves was rapidly upregulated and reached the maximum value at 1 hour, and then rapidly decreased to the minimum value and lasted until 24 hours; in roots, the expression of McMYC2 gene was rapidly upregulated in response to drought, with the highest expression level at 1 hour, then decreased, and the expression level at 24 hours was still significantly higher than that at 0 hours.

[0069] These results suggest that McMYC2 may play a role in the response of mint to exogenous ABA, NaCl, AlCl 3 , CdCl 2 , CuCl 2 McMYC2 plays an important regulatory role in various abiotic stresses such as drought and drought, and there are certain differences in the functions of McMYC2 in leaves and roots.

[0070] Example 4

[0071] This example provides the changes in phenotypes and physiological indicators of wild-type and transgenic peppermint under the condition of drought stress treatment simulated by 20% PEG solution.

[0072] Design of homologous recombination primers for McMYC2 gene ligation to overexpression vector pCAMBIA1300-GFP:

[0073] pCAMBIA1300-GFP-McMYC2-F: 5'-GGGGCCCGGGGTCGACATGATTGAT TACCGTCTGCCG-3' (SEQ ID NO: 11); pCAMBIA1300-GFP-McMYC2-R: 5'-TACCGGATCCACTAGTGTTTATTTCAGCAGCAAGTG-3' (SEQ ID NO: 12).

[0074] Referring to the method of transgenic vector construction by Ma et al., a McMYC2 overexpression vector was constructed, and the McMYC2 overexpression vector was transformed into EHA105 by the freeze-thaw method. Through Agrobacterium infection, resistance bud differentiation screening, and RT-PCR detection, several peppermints with stable overexpression of McMYC2 were obtained. Two of them, McMYC2OE-7 and McMYC2OE-14, were selected for simulated drought stress tests, as follows.

[0075] The aboveground 6 cm of the wild-type and transgenic peppermint McMYC2OE-7 and McMYC2OE-14 were cut and placed in 20% PEG solution (simulating drought) and distilled water, respectively, and their growth was observed after 3 hours.

[0076] In addition, samples were taken at 0h, 1h, 3h, and 6h after treatment, with 3 replicates for each group of samples, and repeated 3 times in total to analyze the stress-related physiological indicators of wild-type and transgenic peppermint under simulated drought treatment, including POD, SOD, and water loss rate.

[0077] The growth of wild type and transgenic peppermint after 20% PEG treatment for 3 hours is shown in Figure 2. Fig. 9 As shown, compared with the control (CK, distilled water treatment), after 3 hours of 20% PEG simulated drought treatment, the wild-type peppermint showed obvious stem lodging (indicated by the yellow arrow), while the McMYC2OE-7 and McMYC2OE-14 transgenic peppermints grew well without stem lodging (indicated by the red arrow). McMYC2OE-7 and McMYC2OE-14 transgenic peppermints showed a more drought-resistant phenotype than the wild-type peppermint, indicating that overexpression of McMYC2 enhanced the drought resistance of transgenic peppermint.

[0078] SOD and POD activities of WT and transgenic peppermint were determined as follows Fig.10 As shown in the figure, the results showed that before drought treatment (0h), the activity of SOD in McMYC2OE-7 and McMYC2OE-14 transgenic peppermint was lower than that in WT. As the drought treatment time increased, the activity of SOD in WT and transgenic peppermint increased. Among them, the activity of SOD in McMYC2OE-7 transgenic peppermint was higher than that in WT at 1h, 3h, and 6h, and the activity of SOD in McMYC2OE-14 transgenic peppermint was higher than that in WT at 3h and 6h of drought treatment ( Fig.10 At the same time, this study found that before drought treatment (0h), the activity of POD in transgenic peppermint was lower than that in WT. As the drought treatment time increased, the activity of POD in WT showed a downward trend. However, after 6h of drought treatment, the activity of POD in McMYC2OE-7 and McMYC2OE-14 transgenic peppermint was significantly higher than that in WT ( Fig.10 B).

[0079] The water loss rate results are as follows Fig.11 As shown, the results showed that at 0.5h, 1h, 2h, 3h, 6h, and 12h of treatment, the relative water loss rate of McMYC2OE-7 and McMYC2OE-14 transgenic peppermint leaves was lower than that of WT, indicating that overexpression of McMYC2 in peppermint can increase the SOD and POD enzyme activities of peppermint under drought conditions, reduce the water loss rate and enhance the drought resistance of transgenic peppermint.

[0080] Example 5

[0081] This example provides the expression of McWRKY57 in mint leaves in which McMYC2 is transiently overexpressed.

[0082] The pCAMBIA2300-GFP (VC) vector was double-digested with BamHI and SalI, and the digestion system is shown in Table 8. At the same time, according to the McMYC2 gene sequence obtained above, the homologous recombination primers for connecting the McMYC2 gene to the pCAMBIA2300-GFP vector were designed using DNAMAN software:

[0083] p2300GFP-McMYC2-F: 5'-CGGTACCCGGGGATCCATGATTGATTACCGT CTGCCG-3' (SEQ IDNO: 13); p2300GFP-McMYC2-R: 5'-TGCTCACCATGT CGACGTTTATTTCAGCAGCAAGTG-3' (SEQ IDNO: 14).

[0084] Referring to the method described in Example 2, the McMYC2 intermediate vector pClone007 Blunt Vector with correct sequencing was used as a template to amplify the McMYC2 gene. The PCR product of the McMYC2 gene and the VC vector digestion product were separated by agarose gel electrophoresis and the gel was recovered for later use. The homologous recombination reaction was carried out according to the instructions of IIOne Step Cloning Kit (C112, vazyme). The reaction system was shown in Table 9. The fusion expression vector pCAMBIA2300-McMYC2-GFP was obtained, and the sequence correctness was confirmed.

[0085] Table 8. Double enzyme digestion system

[0086] Components Dosage <![CDATA[10×Cutone TM buffer]]> 5μL Fast Dicer 1 5μL Fast Dicer 2 5μL Plasmids 5μg <![CDATA[ddH 2 The]]> upto50μL

[0087] Table 9. Homologous recombination reaction system

[0088] Components Dosage ExnaseII 1μL 5×CEIIBuffer 2μL PCR products 5~100ng vector 25~100ng <![CDATA[RNasefreeddH 2 The]]> up to 10 μL

[0089] The fusion expression vector pCAMBIA2300-McMYC2-GFP (test) and the empty vector pCAMBIA2300-GFP (control) were transferred into EHA105 Agrobacterium by freeze-thaw method, and the EHA105 Agrobacterium containing these two vectors were injected into the lower epidermis of the opposite leaves in the middle of mint seedlings (plant height about 6 cm), and the leaves were collected after culturing at 23°C for 3 days, and RNA was extracted and reverse transcribed into cDNA. The expression changes of McMYC2 gene and McWRKY57 gene in the leaves of the control group and the test group were analyzed by qRT-PCR (primers are shown in Table 5).

[0090] The expression of McMYC2 and McWRKY57 genes in mint leaves Fig.12 The results showed that compared with the control group, the expression of McMYC2 in the mint leaves of the experimental group was significantly upregulated, indicating that the McMYC2 gene was transiently overexpressed successfully. In addition, Fig.12 It can be seen that compared with the control group, the expression level of the McWRKY57 gene was significantly increased, indicating that overexpression of the McMYC2 gene can significantly increase the expression level of the drought response gene McWRKY57 in mint leaves, helping to enhance the drought resistance of mint.

[0091] The embodiments described above are only some embodiments of the present invention, not all embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but only represents selected embodiments of the present invention. All other embodiments obtained without creative work and related deductions and substitutions made by ordinary technicians in the field under the conditions of the concept of the present invention belong to the scope of protection of the present invention.

Claims

1. Application of mint transcription factor in regulating mint stress resistance, characterized in that: The transcription factor is McMYC2, and the amino acid sequence of McMYC2 is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The stress resistance includes drought resistance.

3. The use according to claim 1, characterized in that: Overexpression of the mint transcription factor McMYC2 enhances the drought resistance of mint plants.

4. A gene recombination vector, characterized in that: The gene recombination vector contains the coding gene of the mint transcription factor McMYC2, and the nucleotide sequence of the coding gene is shown in SEQ ID NO:

2.

5. A recombinant genetically engineered bacterium, characterized in that: The recombinant genetically engineered bacteria contains the genetically recombinant vector according to claim 4.

6. A method for cultivating drought-resistant mint varieties, characterized in that: An overexpression recombinant vector containing the gene encoding the mint transcription factor McMYC2 was constructed and transferred into mint plants for overexpression. The nucleotide sequence of the mint transcription factor McMYC2 encoding gene is shown in SEQ ID NO: 2.

Images