Spinach non-tissue culture genetic transformation method

The recombinant plasmid of plant expression vectors constructed and transferred into spinach through flower impregnation method solves the problems of complexity and low efficiency of the existing spinach genetic transformation system, and achieves efficient, stable transfer and expression of spinach genes, providing convenient research tools.

CN120099079APending Publication Date: 2025-06-06HENAN NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510240197.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-03
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The existing spinach genetic transformation system is based on tissue culture, with complex operations, long cycles and poor repetition, making it difficult to meet the needs of spinach gene function research.

Method used

By using the flower impregnation method, the recombinant plasmid of plant expression vector was constructed, and Agrobacterium tumefaciens was transferred to Agrobacterium tumefaciens, and the infectious solution was prepared and inoculated until the spinach was unfertilized pistil, so as to achieve stable gene transfer and expression.

Benefits of technology

This method is simple, efficient and stable, and can quickly transfer exogenous DNA or RNA or protein into the spinach genome and pass it stably to offspring, providing convenient tools for spinach genetic breeding and functional genomics research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099079A_ABST
    Figure CN120099079A_ABST
Patent Text Reader

Abstract

The invention discloses a spinach non-tissue culture genetic transformation method which comprises the following steps: constructing a plant expression vector containing a target gene, and transferring the plant expression vector into agrobacterium tumefaciens to obtain positive agrobacterium tumefaciens into which recombinant plasmids are transferred; preparing an infection solution by using the positive agrobacterium with the transferred recombinant plasmid, and inoculating the positive agrobacterium to female flowers of spinach in a flower dipping manner; culturing the infected spinach in a dark place for 18-30 hours, and continuously culturing at the temperature of 16-20 DEG C under the conditions of 16-hour illumination / 8-hour darkness to obtain spinach T0 seeds; t0 positive plants are identified by utilizing PCR (Polymerase Chain Reaction) and RT-qPCR, and the target gene is successfully transferred into a spinach genome and is stably inherited to offspring. According to the invention, a simple, efficient and stable spinach non-tissue culture genetic transformation technical system is established in a flower dipping manner.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic transformation, and particularly relates to a non-tissue culture genetic transformation method for spinach. Background Art

[0002] Plant genetic transformation refers to the purposeful insertion of foreign genes or DNA fragments into the genome of the recipient plant, and the introduced genes can be stably expressed and inherited in the plant. Compared with the traditional tissue culture genetic transformation system, the flower dip method is simpler and more efficient. This method has been successfully applied to a variety of plants, such as Arabidopsis, corn, rice, wheat, tobacco, Salvia miltiorrhiza, cucumber, buckwheat, etc.

[0003] Spinach (Spinacia oleracea L) is a dioecious plant of the genus Spinacia in the Amaranthaceae family. It is rich in nutrients, has important economic value, and is also one of the model plants for studying the mechanism of sex determination and differentiation. At present, the molecular breeding work and functional genomics research of spinach are progressing slowly, and the primary limiting factor is the lack of a stable genetic transformation system. At present, there are two genetic transformation systems for spinach: one is a genetic transformation system that uses Agrobacterium rhizogenes to infect spinach hairy roots to obtain regenerated seedlings, and the other is a genetic transformation system that uses Agrobacterium tumefaciens to infect spinach explants to obtain regenerated seedlings. These transformation systems are based on plant tissue culture methods, all of which require sterile operations, have long transformation cycles, and have poor reproducibility. Therefore, designing a simple, stable, and efficient genetic transformation method is an important technological breakthrough in studying the gene function of spinach. Summary of the invention

[0004] The technical problem solved by the present invention is to provide a simple, efficient and stable non-tissue culture genetic transformation method for spinach, which provides a new path for carrying out spinach genetic breeding and spinach gene function research.

[0005] The present invention adopts the following technical solution to solve the above technical problems, a non-tissue culture genetic transformation method of spinach, characterized by the specific steps of:

[0006] Step S1: constructing a plant expression vector recombinant plasmid containing the target gene, and transferring it into Agrobacterium tumefaciens to obtain positive Agrobacterium transferred with the recombinant plasmid;

[0007] Step S2: Activate the positive Agrobacterium transferred with the recombinant plasmid and then expand the culture to a concentration of OD 600=0.8-1.2, centrifugally precipitate the bacteria, and then resuspend the bacteria with a resuspension solution to obtain an infection solution, wherein the resuspension solution is composed of: 300-500 mL of single distilled water, 0.8-0.9 g of Murashige & Skoog basic salt, 10-30 g of sucrose, 0.1-0.3 g of 2-morpholineethanesulfonic acid, 3-5 mg of 6-benzylaminoadenine, 70-90 μL of Silwet surfactant and 30-50 μL of 1 M NaOH solution;

[0008] Step S3: inoculating the infection solution into the unfertilized pistils of spinach by soaking for 5 to 20 minutes;

[0009] Step S4: After culturing the infected spinach seedlings in the dark for 18 to 30 hours, continue culturing at 16 to 20° C. and 16 hours of light / 8 hours of darkness until the spinach T0 seeds are harvested;

[0010] Step S5: sowing spinach T0 seeds on 1 / 2MS medium containing kanamycin, and transferring them to soil culture after the seeds germinate and grow two true leaves;

[0011] Step S6: After the T0 plants grow four true leaves, positive strains and target gene expression are identified by PCR and RT-qPCR, indicating that the target gene is successfully transferred into the spinach genome and stably inherited to the offspring.

[0012] Furthermore, the specific process of step S1 is as follows:

[0013] Step S101: extracting total RNA from spinach flowers and performing reverse transcription to obtain cDNA;

[0014] Step S102: retrieve the CDS of the target gene in the spinach genome data;

[0015] Step S103: Design amplification primers according to the target gene CDS, the amplification primers contain homologous recombination adapters, and the sequence of the homologous recombination adapters is as follows:

[0016] Forward primer linker: 5'-GGACAGGGTACCCGGGGATCC-3'

[0017] Back primer linker: 5′-CAGGTCGACTCTAGAGGATCC-3′;

[0018] Step S104: using the cDNA in step S101 as a template to perform PCR amplification to obtain the target gene CDS;

[0019] Step S105: linearize the plant expression vector and then perform gel excision and recovery;

[0020] Step S106: Connect the target gene CDS to the linearized plant expression vector by homologous recombination. The homologous recombination reaction system is as follows:

[0021]

[0022] The reaction conditions are: 50° C., 15 min; the amount X of the linearized vector DNA is 50 to 100 ng, and the molar ratio of the linearized vector DNA to the target gene CDS fragment is 1:1 to 1:3;

[0023] Step S107: The ligation product is transformed into competent E. coli, and after a single clone is detected to be correct, the recombinant plasmid is extracted and transformed into competent Agrobacterium tumefaciens by heat shock method.

[0024] Furthermore, the composition of the resuspension in step S2 is: 400 mL of single distilled water, 0.88 g of Murashige & Skoog basic salt, 20 g of sucrose, 0.2 g of 2-morpholineethanesulfonic acid, 4 mg of 6-benzylaminoadenine, 80 μL of Silwet surfactant and 40 μL of 1 M NaOH solution.

[0025] The invention discloses an application of the spinach non-tissue culture genetic transformation method in spinach genetic breeding.

[0026] The invention discloses an application of the spinach non-tissue culture genetic transformation method in the research of spinach functional genomics.

[0027] Compared with the prior art, the present invention has the following advantages and beneficial effects: the present invention establishes a set of spinach genetic transformation technology system by means of the flower dipping method, the technology system is simple, efficient and stable, the technology system can quickly transfer exogenous DNA or RNA or protein into the spinach genome and stably inherit it to offspring, and the technology system can provide a convenient tool for spinach genetic breeding and spinach functional genomics research. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is the detection of Sp1590 CDS amplification product.

[0029] Figure 2 The colony PCR test of E. coli transformed with pLP100-35S-Sp1590 was performed.

[0030] Figure 3 The pLP100-35S-Sp1590 was transformed into Agrobacterium by PCR detection.

[0031] Figure 4 It is a positive identification of pLP100-35S-Sp1590 T0 generation plants.

[0032] Figure 5It is the relative expression level of Sp1590 gene in positive transgenic plants detected by RT-qPCR. DETAILED DESCRIPTION

[0033] The above contents of the present invention are further described in detail below through examples, but this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples, and all technologies implemented based on the above contents of the present invention belong to the scope of the present invention.

[0034] Example 1

[0035] A non-tissue culture genetic transformation method for spinach, the specific process is as follows:

[0036] 1. Vector Construction

[0037] 1. Sp1590 gene CDS is shown in SEQ ID NO. 1. Sp1590 gene CDS is used as the target sequence, and specific amplification primers with homologous recombination adapters are designed. The amplification primer sequences are shown in SEQ ID NO. 2 and SEQ ID NO. 3, and the underlined base sequences are homologous recombination adapters.

[0038] 1590-F:5'- GGACAGGGTACCCGGGGATCC ATGGATTCCAACACGAATGTTTTT-3'

[0039] 1590-R:5'- CAGGTCGACTCTAGAGGATCC TCAAAACGGAGCCGTAGTTG-3'

[0040] 2. Using cDNA from male and female spinach flowers as template, PCR amplification was performed to obtain the specific fragment of the Sp1590 gene. The PCR amplification reaction conditions were: 95°C for 2 min; 95°C for 20 s, 55°C for 20 s, 72°C for 10 s, 40 cycles; 72°C for 5 min. 1% (w / v) agarose gel electrophoresis was used to detect the PCR product. The results were as follows: Figure 1 As shown; the target band is cut and recovered.

[0041] 3. Linearize the plant vector pLP100-35S. The reaction system is shown in Table 1. The reaction conditions are 37°C.

[0042] 30min; 80℃5min.

[0043] Table 1. Vector linearization reaction system

[0044]

[0045] 4. The Sp1590 gene CDS fragment was connected to the linearized pLP100-35S vector by homologous recombination. The homologous recombination reaction system is shown in Table 2. The reaction conditions are 50°C for 15 min. The amount X of the linearized vector DNA is generally 50 to 100 ng. The molar ratio of the linearized vector DNA to the Sp1590 gene CDS fragment is 1:1 to 1:3.

[0046] Table 2 Homologous recombination reaction system

[0047]

[0048] 5. Take 5 μL of the ligation product to transform competent E. coli and spread it on a plate containing 100 mg·L -1 Incubate the cells on LB solid medium containing kanamycin at 37°C for 12 to 16 hours.

[0049] 6. Pick a single clone for colony PCR, and the result is as follows Figure 2 As shown, the positive clones were sequenced and the recombinant plasmid pLP100-35S-Sp1590 was successfully constructed.

[0050] 2. Transformation of Agrobacterium

[0051] 1. Thaw 10 μL Agrobacterium competent cells;

[0052] 2. Add 1 μL of recombinant plasmid pLP100-35S-Sp1590, mix thoroughly, and let stand on ice for 5 minutes;

[0053] 3. Place the centrifuge tube in liquid nitrogen and freeze for 5 minutes;

[0054] 4. Take it out quickly and heat shock it in a 37℃ water bath for 5 minutes;

[0055] 5. Take out quickly and place on ice for 5 minutes;

[0056] 6. Add 700 μL of LB liquid medium to each tube, incubate at 28°C, 200 rpm, and shake for 3 h to revive the plasmid;

[0057] 7. Centrifuge at 6000 rpm for 1 min to collect the cell pellet, resuspend the cells in 100 μL LB liquid medium, and spread evenly on a plate containing 100 mg·L -1 Kanamycin, 50 mg L -1 Rifampicin was cultured on LB solid medium at 28°C for 36 to 48 hours.

[0058] 8. Pick a single clone for colony PCR identification. The result is as follows Figure 3 As shown, it indicates that the recombinant plasmid was successfully introduced into Agrobacterium.

[0059] 3. Preparation of infection solution

[0060] 1. Inoculate the GV3101 strain containing pLP100-35S-Sp1590 into 5 mL of fresh LB liquid medium containing kanamycin for activation, then add 200 μL of the activated bacterial solution into 200 mL of new LB liquid medium containing kanamycin and rifampicin, and culture on a shaker at 28°C until OD 600 = about 1.0;

[0061] 2. Centrifuge at 3500 rpm for 15 min to collect the cells and discard the supernatant;

[0062] 3. Resuspend the cells with resuspension solution (400 mL of single distilled water, 0.88 g of Murashige & Skoog basic salt, 20 g of sucrose, 0.2 g of 2-morpholineethanesulfonic acid, 4 mg of 6-benzylaminoadenine, 80 μL of Silwet surfactant and 40 μL of 1 M NaOH solution) until OD 600 =0.5, which is the infection solution;

[0063] 4. Agrobacterium infection of spinach

[0064] Soak the female flowers of spinach in the infection solution for 5 to 20 minutes, then culture in the dark for 18 to 30 hours, then transfer to 18°C, 16 hours light / 8 hours dark conditions and continue to culture until the seeds are mature, and harvest the spinach T0 seeds.

[0065] 5. Identification of positive strains

[0066] 1. Sow spinach T0 seeds on 1 / 2MS medium containing kanamycin, and transfer them to soil culture after the seeds germinate and grow two true leaves;

[0067] 2. After the T0 plants grow four true leaves, extract leaf genomic DNA and total RNA respectively;

[0068] 3. Using genomic DNA as template, PCR amplification was performed. The amplification primers were shown in SEQ ID NO.4 and SEQ ID NO.5. The PCR product was detected by 1% (w / v) agarose gel electrophoresis. The results were as follows: Figure 4 As shown, the target bands appeared in multiple strains;

[0069] Sp1590-CDS-F: 5'-ATGGATTCCAACACGAATGTTTTT-3'

[0070] pLP100-35s-R: 5'-AGAACCCTAATTCCCTTATCTGG-3'.

[0071] 4. The extracted total RNA was reverse transcribed to synthesize cDNA, and RT-qPCR was performed using cDNA as a template. The primers were shown in SEQ ID NO.6 and SEQ ID NO.7. The RT-qPCR results were shown in Figure 5 As shown, the expression levels of the Sp1590 gene in multiple strains were significantly upregulated.

[0072] Q-Sp1590-F: 5'-CTCTCAAGGCCCTCAAGCTC-3'

[0073] Q-Sp1590-R: 5'-CCCTAGAACGAACCGCACTT-3'.

[0074] VI. Analysis of Genetic Transformation Efficiency

[0075] A total of 300 T0 generation strains were tested, of which 61 were positive strains, with a positive rate of 20.33%.

[0076] The above embodiments describe the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for illustrating the principles of the present invention. Without departing from the scope of the principles of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of protection of the present invention.

[0077] SEQUENCE LISTING

[0078] <110> Henan Normal University

[0079] <120> A non-tissue culture genetic transformation method for spinach

[0080] <130> 2025

[0081] <160> 9

[0082] <170> patent version 3.3

[0083] <210> 1

[0084] <211> 414

[0085] <212> DNA

[0086] <213> Artificial sequence

[0087] <400> 1

[0088] atggattccaacacgaatgtttttggcaaatcgatggaggaggtttggaatcacataaacccattgtcgaacacccaacacgtccagcctac

[0089] cccaaacccccacttcaatggtttatttttccaagactattctcttttaccacatcctacgcactctcaaggccctcaagctccgccaatcaatc

[0090] ctgttaccgctgttgatcgaagaaacaaacgtttgattaagggcagagaaagtgcggttcgttctagggctcggaaaaaggcgtatgttga

[0091] agagttagagataatagttgaggatttacaagcagacaataagcgtttaaaagatgagaatgaaaagctgaagaagcgacaccgacagcttgatagaaaggaaggtctacttcgaacaactacggctccgttttga 414

[0092] <210>2

[0093] <211>45

[0094] <212>DNA

[0095] <213>Artificial Sequence

[0096] <400>2

[0097] ggacagggtacccggggatccatggattccaacacgaatgttttt 45

[0098] <210>3

[0099] <211>41

[0100] <212>DNA

[0101] <213>Artificial Sequence

[0102] <400>3

[0103] caggtcgactctagaggatcctcaaaacggagccgtagttg 41

[0104] <210> 4

[0105] <211> twenty four

[0106] <212> DNA

[0107] <213> Artificial sequence

[0108] <400> 4

[0109] atggattccaacacgaatgttttt 24

[0110] <210> 5

[0111] <211> twenty three

[0112] <212> DNA

[0113] <213> Artificial sequence <400> 5

[0114] agaaccctaattcccttatctgg 23

[0115] <210> 6

[0116] <211> 20

[0117] <212> DNA

[0118] <213> Artificial sequence <400> 6

[0119] ctctcaaggccctcaagctc 20

[0120] <210> 7

[0121] <211> 20

[0122] <212> DNA

[0123] <213> Artificial sequence <400> 7

[0124] ccctagaacgaaccgcactt 20

[0125] <210> 8

[0126] <211> twenty one

[0127] <212> DNA

[0128] <213> Artificial sequence <400> 8

[0129] ggacagggtacccggggatcc 21

[0130] <210> 9

[0131] <211> twenty one

[0132] <212> DNA

[0133] <213> Artificial sequence <400> 9

[0134] caggtcgactctagaggatcc 21

Claims

1. A method for non-tissue culture genetic transformation of spinach, characterized in that The specific steps are: Step S1: constructing a plant expression vector recombinant plasmid containing the target gene, and transferring it into Agrobacterium tumefaciens to obtain positive Agrobacterium transferred with the recombinant plasmid; Step S2: Activate the positive Agrobacterium transferred with the recombinant plasmid and then expand the culture to a concentration of OD 600 =0.8-1.2, centrifugally precipitate the bacteria, and then resuspend the bacteria with a resuspension solution to obtain an infection solution, wherein the resuspension solution is composed of: 300-500 mL of single distilled water, 0.8-0.9 g of Murashige & Skoog basic salt, 10-30 g of sucrose, 0.1-0.3 g of 2-morpholineethanesulfonic acid, 3-5 mg of 6-benzylaminoadenine, 70-90 μL of Silwet surfactant and 30-50 μL of 1 M NaOH solution; Step S3: inoculating the infection solution into the unfertilized pistils of spinach by soaking for 5 to 20 minutes; Step S4: After culturing the infected spinach seedlings in the dark for 18 to 30 hours, continue culturing at 16 to 20° C. and 16 hours of light / 8 hours of darkness until the spinach T0 seeds are harvested; Step S5: sowing spinach T0 seeds on 1 / 2MS medium containing kanamycin, and transferring them to soil culture after the seeds germinate and grow two true leaves; Step S6: After the T0 plants grow four true leaves, positive strains and target gene expression are identified by PCR and RT-qPCR, indicating that the target gene is successfully transferred into the spinach genome and stably inherited to the offspring.

2. The spinach non-tissue culture genetic transformation method according to claim 1, characterized in that The specific process of step S1 is: Step S101: extracting total RNA from spinach flowers and performing reverse transcription to obtain cDNA; Step S102: retrieve the CDS of the target gene in the spinach genome data; Step S103: Design amplification primers according to the target gene CDS, the amplification primers contain homologous recombination adapters, and the sequence of the homologous recombination adapters is as follows: Forward primer linker: 5'-GGACAGGGTACCCGGGGATCC-3' Back primer linker: 5′-CAGGTCGACTCTAGAGGATCC-3′; Step S104: using the cDNA in step S101 as a template to perform PCR amplification to obtain the target gene CDS; Step S105: linearize the plant expression vector and then perform gel excision and recovery; Step S106: Connect the target gene CDS to the linearized plant expression vector by homologous recombination. The homologous recombination reaction system is as follows: The reaction conditions are: 50° C., 15 min; the amount X of the linearized vector DNA is 50 to 100 ng, and the molar ratio of the linearized vector DNA to the target gene CDS fragment is 1:1 to 1:3; Step S107: The ligation product is transformed into competent E. coli, and after a single clone is detected to be correct, the recombinant plasmid is extracted and transformed into competent Agrobacterium tumefaciens by heat shock method.

3. The spinach non-tissue culture genetic transformation method according to claim 1, characterized in that The composition of the resuspension in step S2 is: 400 mL of single distilled water, 0.88 g of Murashige & Skoog basic salt, 20 g of sucrose, 0.2 g of 2-morpholineethanesulfonic acid, 4 mg of 6-benzylaminoadenine, 80 μL of Silwet surfactant and 40 μL of 1M NaOH solution.

4. Application of the spinach non-tissue culture genetic transformation method according to any one of claims 1 to 3 in spinach genetic breeding.

5. Application of the spinach non-tissue culture genetic transformation method according to any one of claims 1 to 3 in spinach functional genomics research.