Application of rice endosperm specific expression gene NF-YA8 in rice quality heat resistance at natural high temperature in field
By expressing or knocking out the NF-YA8 gene in rice, the heat resistance of rice quality is regulated, and the high temperature caused by global warming is solved, and the heat resistance of rice quality is improved at high temperatures in fields.
Patent Information
- Application Number
- CN202510329980.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-06-06
AI Technical Summary
Global warming has caused high temperatures to pose a major threat to rice quality, and the existing technology is difficult to effectively improve the heat resistance of rice quality.
The NF-YA8 gene was isolated from rice and specifically expressed or knocked out the NF-YA8 gene in rice through transgenic technology to regulate the heat resistance of rice quality.
It improves the heat resistance of rice quality at high temperatures in the field, maintains the steady-state balance of stored protein and amylose content, reduces the chalky traits, and significantly improves the high-temperature adaptability of rice.
Smart Images

Figure CN120099083A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to the application of a rice endosperm-specific expression gene NF-YA8 in improving the heat resistance of rice quality under natural high temperature in the field. Background Art
[0002] Global warming seriously threatens global agricultural production and poses a major threat to global food security. Every 1°C rise in the global average temperature will reduce the average yield of major crops by 3.1-7.4%, posing a major threat to global food security. In addition, global food security is not only related to output, but also closely related to quality. Rice determines human nutrition, market value and farmers' income, especially in Southeast Asia and Africa where high temperatures occur frequently and are highly dependent on grains. High temperatures will deteriorate the appearance, milling, cooking and eating of grains, as well as the nutritional quality of grains. These problems highlight the need for sustainable agriculture to improve the quality of rice by improving the ability of crops to withstand high temperatures.
[0003] After sensing stress signals, plants will activate a series of signal transduction pathways to respond to stress. In these processes, transcription factors (TFs) regulate the expression of stress-responsive genes by specifically binding to their promoters to cope with the damage caused by abiotic stress. Nuclear factor Y (NF-Y), one of the largest transcription factor families in plants, participates in plant abiotic responses in different regulatory modes in different species. NF-Y is a trimer composed of NF-YA, NF-YB and NF-YC subunits. In mammals and yeast, these three subunits are indispensable and bind to CCAAT-box to regulate downstream gene expression. However, in plants, different NF-Y subunits can regulate downstream genes alone or by binding to each other and other transcription factors. The typical NF-Y complex components generally promote each other, that is, NF-YB and NF-YC subunits promote the DNA binding activity of NF-YA. In rice, multiple NF-Y subunits that are dominantly expressed in seeds have been reported, which can act independently or interact with other transcription factors to regulate downstream gene expression. The NF-YA8 gene involved in the present invention belongs to the rice NF-YA subunit family. Although there are some reports on this type of protein in the rice endosperm development process, this type of protein has not been successfully used to improve the quality and heat resistance of rice. Summary of the invention
[0004] The present invention isolated the NF-YA8 gene (LOC_Os10g25850) from rice and successfully identified its function in negatively regulating the heat resistance of rice quality through transgenic materials, providing new gene resources for rice quality breeding under the background of global warming, which is of great significance for breeding high temperature resistant rice varieties.
[0005] The present invention provides application of a rice endosperm-specific expression gene NF-YA8 or a protein encoded thereof in regulating the heat resistance of rice quality under high temperature in the field. The amino acid sequence encoded by the NF-YA8 gene is shown in SEQ ID NO:3.
[0006] Furthermore, the nucleotide sequence of the NF-YA8 gene is shown in SEQ ID NO:2.
[0007] Furthermore, knocking out, inhibiting or reducing the expression of the NF-YA8 gene or the activity and function of its encoded protein can improve the heat resistance of rice quality under high temperature in the field, that is, better maintaining the steady-state balance of rice storage protein and amylose content and lower chalkiness under high temperature.
[0008] Furthermore, the expression, activity or function of the NF-YA8 gene or its encoded protein is inhibited by CRISPR, RNAi, TALEN and / or ZFN technology.
[0009] Furthermore, a CRISPR knockout vector targeting the sequence shown in SEQ ID NO:4 was constructed and introduced into rice, thereby improving the heat resistance of rice quality under high temperature in the field.
[0010] The present invention provides a method for enhancing the heat resistance of rice quality under high temperature in the field, knocking out or inhibiting the expression of NF-YA8, thereby enhancing the heat resistance of rice quality under high temperature in the field, and the amino acid sequence encoded by the NF-YA8 gene is shown in SEQ ID NO:3.
[0011] Furthermore, a CRISPR knockout vector targeting the sequence shown in SEQ ID NO:4 was constructed and introduced into rice, thereby improving the heat resistance of rice quality under high temperature in the field, that is, better maintaining the steady-state balance of rice storage protein and amylose content and lower chalkiness under high temperature.
[0012] The present invention provides a molecular marker combination related to indica-japonica differentiation and / or rice quality heat resistance, the molecular marker combination comprises 10 SNP sites, SNP1-SNP10, wherein SNP1-SNP10 are respectively located at -1431, -159, +293, +1717, +3138, +5148, +5150, +5265, +5350, +5731 of the NF-YA8 gene, i.e., the 389th, 1661st, 2113th, 3537, 4958, 6968, 6970, 7085, 7170, 7551th positions of the sequence shown in SEQ ID NO:1 (wherein the first A of the promoter ATG is defined as +0). The physical positions are 13392613, 13393885, 13394337, 13395761, 13397182, 13399192, 13399194, 13399309, 13399394, and 13399775 of rice chromosome 10, and the reference genome version is MSU version 7.0.
[0013] Furthermore, rice was divided into haplotypes Hap1-Hap9 according to the results of SNP1-SNP 10, with Hap1 being CCAGGCTTGG, Hap2 being CCAGGCTTGA, Hap3 being TTGTATGGAA, Hap4 being CTGTACGGAA, Hap5 being CCGTGCACGG, Hap6 being CCATGCGCAA, Hap7 being TTGGATGGAA, Hap8 being CCGTATGCGG, and Hap9 being CCGTGCGCGG.
[0014] The present invention provides a method for identifying or assisting in identifying indica and japonica rice and / or rice quality heat resistance, characterized in that rice is detected using any of the aforementioned molecular marker combinations, and when the result is Hap1, Hap2, Hap5 or Hap8, it is identified as japonica rice, and when the result is Hap3, Hap4, Hap6, Hap7 and Hap9, it is identified as indica rice; in addition, rice germplasm with a detection result of haplotype Hap3 has a better quality heat damage index than that of haplotype Hap5, that is, the rice quality heat resistance is better and has higher heat resistance.
[0015] Beneficial effects: The present invention cloned a new gene in rice that negatively regulates the heat resistance of rice quality (chalkiness appearance quality and storage material content, etc.) under natural high temperature in the field, providing new gene resources for high-quality rice breeding and also providing technical reference for cloning related genes in other crops. The haplotype division is further performed on its SNP loci, which can be used for indica-japonica differentiation in rice germplasm and / or identification of high temperature resistance of rice quality. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.
[0017] Figure 1 The expression patterns of NF-YA8 in different tissues of indica rice varieties MH63 and ZS97. The data are from the CREP database.
[0018] Figure 2 The expression levels of NF-YA8 in leaves of wild-type ZH11 and three NF-YA8 overexpression lines.
[0019] Figure 3 Shown is the NF-YA8 gene structure diagram and the sgRNA target sites and genotypes of three independent CRISPR lineages of NF-YA8.
[0020] Figure 4 The chalkiness, storage protein, and amylose content of NF-YA8 overexpression and knockout families under natural high temperature and normal temperature conditions in the field. a and b, chalkiness phenotypes of NF-YA8 overexpression and CRISPR knockout families under different natural temperature conditions. c, storage protein content and amylose content of NF-YA8 overexpression and CRISPR families under different natural temperature conditions. d, ratio of storage protein content to amylose content of NF-YA8 overexpression and CRISPR families under different temperature conditions.
[0021] Figure 5 Analysis of NF-YA8 haplotypes and indica-japonica differentiation. a, Haplotype analysis of NF-YA8 in 4726 germplasms. b, Distribution of each haplotype of NF-YA8 in 4726 germplasms. c, Quality heat resistance and grain chalkiness of the main haplotypes of NF-YA8 in 533 micro-core germplasms at high temperatures. The quality heat damage index is the difference between the chalkiness of 533 germplasm materials at high temperature and normal temperature, that is, the degree of increase in grain chalkiness at high temperature. The lower the quality heat damage index, the better the quality heat resistance. DETAILED DESCRIPTION
[0022] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.
[0023] The following examples define the present invention and describe methods of the present invention for constructing NF-YA8 CRISPR mutants, cloning a DNA fragment comprising the complete coding region of the NF-YA8 gene (SEQ ID NO: 1), and verifying the function of the NF-YA8 gene.
[0024] Example 1 Natural high temperature treatment in the field during rice filling period
[0025] In order to make each rice genetic material be treated with natural high temperature and normal temperature during the grain filling period, we planted each genetic material in batches during the sowing period, and adjusted the planting time according to the length of the heading period of each material. Generally, we sowed once every half a month to try to ensure that the heading and early grain filling period were in the high temperature period of Wuhan field. For materials with a long heading period (>95 days), they were usually sown in mid-to-late April; for materials with a short heading period (<80 days), they were sown around mid-May. Different sowing dates will cause genetic materials with different growth periods to start heading and grain filling in mid-to-late July or early August. During this period, Wuhan often experienced extreme high temperatures exceeding 35°C, and this record has lasted for more than 60 years. For the normal temperature treatment experiment, all materials were sown in mid-to-end June, so that short heading period materials usually started heading and grain filling in mid-to-early September, while long growth period materials started heading and grain filling in mid-to-late September. During this period, the average temperature in Wuhan was relatively low and normal (about 30°C). The dynamic temperature data were automatically recorded every 5 minutes from June to October at Huazhong Agricultural University and from February to May at the Lingshui Nanfan Base using a USB temperature and humidity recorder (USB-TH). The early grain filling period is the most sensitive period for rice endosperm, so the daily average temperature of each material in the early grain filling period from 9 am to 7 pm was calculated 6-12 days after flowering. When the rice chalkiness rate of the sensitive material ZH11 increased significantly, it indicated that these materials had been treated with high temperature during the grain filling period. On the contrary, when the sensitive wild-type materials still maintained a low grain chalkiness rate, it indicated that they were filling at normal temperature.
[0026] Example 2: Identification of rice quality (chalky appearance quality and storage material content, etc.) at natural temperature in the field
[0027] Before investigating the quality traits of rice such as chalkiness, the harvested mature seeds were fully dried or sun-dried and stored at room temperature for at least three months. Rice chalkiness, including belly white, heart white and back white, is generally detected by visual inspection. The mature and dry seeds were threshed and shelled into brown rice, and 100 whole rice grains were randomly selected. The percentage of rice grains with chalkiness was counted and expressed as the grain chalkiness rate (GCR). The chalky rice was laid flat and the percentage of the projected area of the chalky part to the projected area of the whole rice was visually measured and expressed as the rice chalkiness area (GCA). The chalkiness degree (GCD) is the product of the grain chalkiness rate and the chalkiness area. All chalkiness traits are expressed as percentages. The chalkiness in rice will reduce the appearance, milling, cooking and eating quality of rice and the yield of whole polished rice. Therefore, the increase of chalkiness is the most direct indicator of rice quality, and high temperature can easily cause sensitive changes in chalkiness. Therefore, lower rice chalkiness under high temperature indicates that the rice quality has stronger high temperature resistance. The total protein content of brown rice grains and the amylose content of refined rice flour were measured using XDS near-infrared fast content analyzer (FOSS) and near-infrared reflectance spectroscopy.
[0028] Example 3: Application of NF-YA8 gene in rice in regulating rice quality under high temperature environment in the field:
[0029] 1) Construction of NF-YA8 overexpression material under ZH11 background
[0030] Previous studies have found that NF-YA8 is highly expressed in endosperm ( Figure 1 ), designed a PCR specific primer NF-YA8-OE with a restriction endonuclease KpnI linker (Table 1), and amplified the CDS sequence of NF-YA8 using cDNA of endosperm tissue of rice variety ZH11 as a template. The amplified sequence contained the sequence shown in SEQ ID NO: 2, that is, ACGAACGATAGCCGGTACC was added to the 5' end of SEQ ID NO: 2, and GGATCCGATTACAAAGATCA was added to the 3' end. The Gibson ligation method (Gibson et al., 2009, Nat. Methods 6: 343–345) was used to connect to pU1301-flag to obtain the recombinant vector pU1301-flag-NF-YA8.
[0031] Table 1 Primers used for gene function verification of the present invention
[0032]
[0033]
[0034] The correctly cloned plasmid was introduced into ZH11 by Agrobacterium-mediated japonica rice genetic transformation system using the transgenic method. After induction, subculture, infection, co-cultivation, screening of callus with hygromycin resistance, differentiation, rooting, seedling training and transplantation, transgenic rice plantlets were obtained. Transgenic complementary positive plants were detected by RT-NF-YA8-F / PU1301-R (Table 1), and positive results were detected by agarose gel electrophoresis. At the same time, RNA was extracted from endosperm or leaves, and the expression level of NF-YA8 was detected by primer RT-NF-YA8 after reverse transcription to obtain cDNA. Among them, the expression level of NF-YA8-OE in the leaves of the three families was significantly increased, indicating that the overexpression effect was good ( Figure 2 ).
[0035] Continue to investigate the rice quality phenotype of the transgenic positive family compared with the wild-type family ZH11 under high temperature and normal temperature environments in the field.
[0036] 2) Construction of NF-YA8 CRISPR knockout material in ZH11 background
[0037] The target was designed according to the NF-YA8 gene sequence. The U6 plasmid was used as a template, and the forward primer of NF-YA8-sgRNA and the reverse primer of U6 were used for amplification; the U6 plasmid was used as a template, and the reverse primer of NF-YA8-sgRNA and the forward primer of U6 were used for amplification; the above two amplification products were recovered and mixed in equal amounts, and the mixture was used as a template for amplification with U6 primers. After the product was recovered, it was introduced into the pCXUN-CAS9 plasmid (first cut with KpnI) (CN201610639854.3) by Gibson ligation method to obtain the pCXUN-CAS9-OsCRN1-U6 knockout vector, and the knockout target sequence on the genome is shown in SEQ ID NO.4.
[0038] The correctly cloned pCXUN-CAS9-NF-YA8-U6 knockout vector was introduced into rice ZH11 by Agrobacterium-mediated rice genetic transformation system, and transgenic rice plantlets were obtained through induction, subculture, infection, co-cultivation, screening of callus with hygromycin resistance, differentiation, rooting, seedling hardening and transplantation. The Agrobacterium-mediated rice (Japonica subspecies) genetic transformation system was mainly optimized based on the method reported by Hiei et al. (Hiei and Ohta, 1994, Plant J. 6: 271-282).
[0039] The transgenic plants were detected by NF-YA8-PAGE (Table 1), and the positive plants with successful knockout were sequenced and confirmed using Seq-NF-YA8 (Table 1). Three independent transgenic knockout families were obtained, namely NF-YA8-CR (#1, #2 and #3) ( Figure 3 ).
[0040] Continue to investigate the rice quality of transgenic positive plants compared with wild-type ZH11 under high temperature and normal temperature environments in the field.
[0041] 3) Identification of rice quality phenotypes of NF-YA8 genetic materials under natural field conditions during the rice filling period
[0042] Under normal temperature conditions in Hainan in 2023, compared with the wild-type ZH11, the chalkiness rate of the CRISPR knockout family NF-YA8-CR did not change significantly, and both showed a low chalkiness phenotype, while the chalkiness rate of the NF-YA8 overexpression family NF-YA8-OE increased significantly ( Figure 4 a, b). Under the natural high temperature environment of Wuhan field in 2022, the chalkiness rate of wild-type ZH11 increased significantly, showing a high temperature sensitive powdery phenotype. The NF-YA8 overexpression family NF-YA8-OE also showed an extreme powdery high temperature sensitive phenotype, while the CRISPR knockout family NF-YA8-CR showed lower chalkiness and better rice quality ( Figure 4 a, b). These results indicate that NF-YA8 can positively regulate the formation of chalkiness under high temperature, that is, negatively regulate the heat tolerance of rice with excellent quality.
[0043] In order to further study the changes in other rice qualities under high temperature and the causes of rice chalkiness, the storage protein and amylose content of each material were measured. It was found that compared with normal temperature, the storage protein content of ZH11, three independent NF-YA8 overexpression lines (NF-YA8-OE) and three independent CRISPR lines (NF-YA8-CR) at high temperature was significantly reduced, accompanied by a significant increase in amylose content, resulting in a significant decrease in the ratio of storage protein to amylose, which destroyed the balance of storage material content and promoted the formation of grain chalkiness ( Figure 4 c, d). However, under high temperature conditions, compared with the NF-YA8-OE family and ZH11, the NF-YA8-CR family was able to maintain a higher ratio of storage protein to amylose content, thereby maintaining a better balance at high temperatures, which was manifested as lower chalkiness and better quality. In addition, under normal temperature, compared with ZH11, the grain chalkiness and storage material content ratio of the NF-YA8-CR family did not change significantly, while the grain chalkiness of the NF-YA8-OE family increased to a certain extent, and the storage material content ratio decreased.
[0044] The transgenic evidence of these genetic materials showed that NF-YA8 can reduce the quality of rice under high temperature by maintaining a certain degree of storage material balance in the endosperm, thereby negatively regulating the heat tolerance of rice quality under high temperature. Example 4: Indica-japonica differentiation and haplotype analysis of NF-YA8 gene:
[0045] Using 4726 germplasm resources from all over the world to analyze NF-YA8, it was found that 10 representative SNP variations (SNP1-SNP10) on the NF-YA8 genome can divide it into 9 haplotypes (Hap1-Hap9) ( Figure 5 a).
[0046] SNP1-SNP10 are located at -1431, -159, +293, +1717, +3138, +5148, +5150, +5265, +5350, +5731 of the NF-YA8 gene, respectively. The physical positions of positions 389, 1661, 2113, 3537, 4958, 6968, 6970, 7085, 7170, and 7551 of the sequence shown in NO:1 (the first A of the promoter ATG is defined as +0) are 13392613, 13393885, 13394337, 13395761, 13397182, 13399192, 13399194, 13399309, 13399394, and 13399775 of rice chromosome 10, respectively, and the reference genome version is MSU version 7.0.
[0047] According to the results of SNP1-SNP10, rice was divided into haplotypes Hap1-Hap9, Hap1 was CCAGGCTTGG, Hap2 was CCAGGCTTGA, Hap3 was TTGTATGGAA, Hap4 was CTGTACGGAA, Hap5 was CCGTGCACGG, Hap6 was CCATGCGCAA, Hap7 was TTGGATGGAA, Hap8 was CCGTATGCGG, and Hap9 was CCGTGCGCGG. Among them, the number of indica rice and japonica rice in Hap1, Hap2, Hap5 and Hap8 were 25 and 1328 respectively, and japonica rice accounted for 98.2%, while the number of indica rice and japonica rice in Hap3, Hap4, Hap6, Hap7 and Hap9 were 1406 and 32 respectively, and indica rice accounted for 97.8% ( Figure 5 b). These results indicate that NF-YA8 has obvious indica-japonica differentiation, which may be the reason for the differentiation of heat resistance between indica and japonica. In order to study the effect of natural variation of NF-YA8 on rice quality and heat resistance, the five main haplotypes of NF-YA8 were further analyzed for quality heat resistance phenotype and chalkiness phenotype under high temperature ( Figure 5c). Haplotype analysis found that the main indica rice haplotype Hap3 of NF-YA8 had a lower quality heat damage index than the main japonica rice haplotype Hap5 (the quality heat damage index is the difference between the chalkiness of 533 germplasm materials at high temperature and normal temperature, that is, the degree of increase in grain chalkiness at high temperature. The lower the quality heat damage index, the better the quality heat resistance). At the same time, Hap3 had a lower chalkiness than the main japonica rice haplotypes Hap1 and Hap5 under the high temperature environment in 2013 ( Figure 5 c).
[0048] These results indicate that there is a natural variation in NF-YA8 that affects the heat resistance of rice quality. Some heat-resistant indica rice varieties have better heat resistance than japonica rice varieties. The molecular marker combination of the above 10 SNP loci can be used to identify or assist in the identification of indica and japonica rice and / or rice quality heat resistance. When the result is Hap1, Hap2, Hap5 or Hap8, it is identified as japonica rice, and when the result is Hap3, Hap4, Hap6, Hap7 and Hap9, it is identified as indica rice; in addition, the rice germplasm with the test result of haplotype Hap3 has better heat resistance of rice quality than haplotype Hap5. It provides new genetic resources for high-quality rice breeding.
[0049] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.
Claims
1. Application of rice endosperm-specific expression gene NF-YA8 or its encoded protein in regulating the heat resistance of rice quality under high temperature in the field, characterized in that: The amino acid sequence encoded by the NF-YA8 gene is shown in SEQ ID NO:
3.
2. The use according to claim 1, characterized in that: The nucleotide sequence of the NF-YA8 gene is shown in SEQ ID NO:
2.
3. The use according to any one of claims 1-2, characterized in that: Knocking out, inhibiting or reducing the expression of the NF-YA8 gene or the activity and function of its encoded protein can improve the heat resistance of rice quality under high temperature in the field.
4. The use according to claim 3, characterized in that: The expression, activity or function of the NF-YA8 gene or its encoded protein is inhibited by CRISPR, RNAi, TALEN and / or ZFN technology.
5. The use according to claim 4, characterized in that: A CRISPR knockout vector targeting the sequence shown in SEQ ID NO:4 was constructed and introduced into rice, thereby improving the heat resistance of rice quality under high temperature in the field.
6. A method for enhancing the heat resistance of rice quality under high temperature in the field, characterized in that: Knocking out or inhibiting the expression of NF-YA8, thereby enhancing the heat resistance of rice quality under high temperature in the field, the amino acid sequence encoded by the NF-YA8 gene is shown in SEQ ID NO:
3.
7. The method according to claim 6, characterized in that A CRISPR knockout vector targeting the sequence shown in SEQ ID NO:4 was constructed and introduced into rice, thereby improving the heat resistance of rice quality under high temperature in the field.
8. A combination of molecular markers related to indica-japonica differentiation and / or heat tolerance of rice quality, characterized in that: The molecular marker combination includes 10 SNP sites, SNP1-SNP10, and the SNP1-SNP10 are respectively located at -1431, -159, +293, +1717, +3138, +5148, +5150, +5265, +5350, and +5731 of the NF-YA8 gene, i.e., SEQ ID The physical positions of positions 389, 1661, 2113, 3537, 4958, 6968, 6970, 7085, 7170, and 7551 of the sequence shown in NO:1 are 13392613, 13393885, 13394337, 13395761, 13397182, 13399192, 13399194, 13399309, 13399394, and 13399775 of rice chromosome 10, respectively. The reference genome version is MSU version 7.
0.
9. The molecular marker combination according to claim 8, characterized in that: According to the results of SNP1-SNP10, rice was divided into haplotypes Hap1-Hap9, Hap1 was CCAGGCTTGG, Hap2 was CCAGGCTTGA, Hap3 was TTGTATGGAA, Hap4 was CTGTACGGAA, Hap5 was CCGTGCACGG, Hap6 was CCATGCGCAA, Hap7 was TTGGATGGAA, Hap8 was CCGTATGCGG, and Hap9 was CCGTGCGCGG.
10. A method for identifying or assisting in identifying the heat resistance of indica and japonica rice and / or rice quality, characterized in that: Rice is detected using any molecular marker combination described in any one of claims 8-9, and when the result is Hap1, Hap2, Hap5 or Hap8, it is identified as japonica rice, and when the result is Hap3, Hap4, Hap6, Hap7 and Hap9, it is identified as indica rice; in addition, rice germplasm with a detection result of haplotype Hap3 has better rice quality heat resistance than haplotype Hap5.
Citation Information
Patent Citations
Rice efficient conversion vector pCXUN-Cas9-sgRNA and construction method thereof
CN107686845A