Real-time visible liver humanized PiZZ mouse model as well as construction method and application thereof

Through HDI technology, naked plasmid DNA expressing the humanized PiZZ mutant gene is delivered to liver cells, and a real-time visualization of liver humanized transient PiZZ mouse model was constructed, solving the problems of immune deficiency, long acquisition cycle, high cost and inability to detect in real time in the existing model, and achieving rapid, economical and immune- sound AATD pathological simulation.

CN120099093APending Publication Date: 2025-06-06ZHEJIANG LONGCHUAN BIOMEDICAL TECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311672080.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-06
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The existing humanized NSG-PiZ mouse model has limitations such as immunodeficiency, long acquisition cycle, high cost and inability to detect real-time live life, making it difficult to meet the research needs of AATD liver disease.

Method used

Through HDI technology, naked plasmid DNA expressing the humanized PiZZ mutant gene is quickly delivered to liver cells, and real-time visualization of liver humanized transient transient PiZZ mouse model is constructed, and the Luc2 gene is used to achieve real-time visualization of transgenes.

Benefits of technology

It realizes rapid modeling of AATD pathological characteristics (eight weeks in the short term), supports real-time visual transgene expression, is immune-friendly, reduces R&D costs, and can truly simulate the immune response of clinical AATD patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004593568920000011
    Figure HDA0004593568920000011
  • Figure HDA0004593568920000012
    Figure HDA0004593568920000012
  • Figure HDA0004593568920000021
    Figure HDA0004593568920000021
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a real-time visible liver humanized transient PiZZ mouse model, a construction method thereof and application of the real-time visible liver humanized transient PiZZ mouse model in biological medicine. The construction method of the PiZZ mouse model comprises the following steps: (1) selecting a report gene; (2) designing a PiZZ rare disease point mutant gene; (3) designing DNA (deoxyribonucleic acid) of a naked plasmid; (4) amplifying and purifying the DNA of the naked plasmid; and (5) establishing a real-time visible liver humanized transient PiZZ mouse model through HDI (hexamethylene diisocyanate). The liver-humanized PiZZ E342K immune sound mouse model disclosed by the invention can be applied to immunity and efficacy evaluation of AATD treatment drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to a real-time visible liver humanized transiently transfected PiZZ mouse model and a construction method thereof and an application thereof in biomedicine. Background Art

[0002] Alpha-1 antitrypsin (AAT) is a protease inhibitor of the serine protease inhibitor (serpin) superfamily encoded by the SERPINA1 gene at the Pi locus of the human genome. Normal AAT protein is a circulating glycoprotein mainly synthesized by hepatocytes and secreted into the blood. It resists infection by inhibiting neutrophil protease to protect organs such as the liver and lungs from nonspecific damage during the inflammatory stage.

[0003] Alpha-1 antitrypsin deficiency (AATD) is a rare hereditary disease. The codon for the 342nd amino acid of the SERPINA1 gene encoding the AAT protein mutates from GAG to AAG, and from glutamic acid (Glu, E) to lysine (Lys, K), resulting in a PiZ mutation. The misfolded AAT protein is retained in the endoplasmic reticulum (ER) of hepatocytes in mild cases, and accumulates in hepatocytes to form polymer globules in severe cases. This toxic liver polymer can be identified by glycogen D-PAS periodic acid Schiff staining. The PiZ mutation eventually leads to liver fibrosis, cirrhosis and liver cancer. About 95% of severe clinical cases are homozygous for the PiZ mutation, called PiZZ patients (Turner AM, et al. Hepatic-targeted RNA interference provides robust and persistent knockdown of alpha-1 antitrypsin levels in ZZpatients.JHepatol.2018,69(2):378-384.pii:S0168-8278(18)30176-4).

[0004] AATD not only affects adults, but PiZZ infants also experience neonatal jaundice and cholestasis, some of which progress to advanced fibrosis or cirrhosis and require liver transplantation. AATD gene diagnosis is rarely considered in clinical practice in my country. Even in the United States, only about 10% of PiZZ liver patients are diagnosed. Under the circumstance of underestimating the rarity of AATD, the PiZZ frequencies in the United States and Europe are approximately 1 / 2000 and 1 / 2500, respectively. my country has a large population base, and there may be many PiZZ liver patients who have not been diagnosed.

[0005] Currently, all the drugs on the market for AATD are blood products, which are enzyme replacement therapies that supplement normal AAT through intravenous plasma infusion. They are mainly used to treat emphysema caused by AATD rather than AATD liver disease. AATD liver disease patients currently have no other drug treatment options except liver transplantation. Therefore, in recent years, emerging nucleic acid drugs have become a blue ocean field for AATD drug research and development. The fastest progress is the Fazirsiran siRNA small nucleic acid drug from Arrowhead, a US company, which is just entering the phase 3 clinical trial stage. However, there are very few AATD pipelines in my country. One of the reasons is the lack of independently developed, economical and accessible AATD animal models.

[0006] The humanized PiZZ animal model NSG-PiZ mouse (https: / / www.jax.org / strain / 028842) currently available in China expresses the humanized SERPINA1 E342K (Glu342Lys) mutant gene in the context of the immunodeficient mouse NSG. It is a humanized PiZ gene stable transfer model that can be inherited to offspring. The efficacy is evaluated by D-PAS staining liver tissue pathology examination, which shows a significant decrease in polymer beads and an increase in normal serum AAT protein. The live commercial NSG-PiZ mouse homozygotes are ordered from the United States, with a delivery cycle of 6 to 10 weeks. If mice have been introduced into China, it will take at least 6 months from the breeding of PiZ heterozygotes, genome extraction, PCR genotype identification to obtaining a sufficient number of sexually mature PiZZ homozygotes. The AATD disease C57BL / 6J mouse model developed by the University of Florida in the United States not only needs to go through a cycle of homozygous identification and screening, but the homozygous PiZZ mice do not show liver pathophysiological characteristics such as positive D-PAS staining liver tissue pathology until they are over 3 months old (Khodayari N et al. Characterization of hepatic inflammatory changes in aC57BL / 6J mouse model of alpha1-antitrypsin deficiency. Am J Physiol Gastrointest Liver Physiol. 2022 Dec 1; 323(6): G594-G608.).

[0007] The existing humanized NSG-PiZ mouse model has the following limitations: first, the NSG background is a mouse with combined immunodeficiency of T lymphocytes, B lymphocytes, and NK cells. In preclinical trials of new drugs, it cannot simulate the immune response of clinical AATD patients after using the drug, and may even affect the evaluation of drug efficacy; second, it takes a long time to obtain PiZZ homozygous mice, the source is limited, and it is expensive; third, the main indicator is D-PAS staining to identify polymer beads, which requires the mice to be sacrificed at the end of the experiment and cannot be detected in vivo.

[0008] In summary, with the improvement of clinical diagnosis and technology of rare disease genotypes, animal models of rare diseases are key tools for researching and developing new therapies. Therefore, it is urgent to develop a humanized transiently transfected PiZZ immune-competent mouse model with real-time visualization of the liver, which can make up for the limitations of the existing humanized NSG-PiZ mouse model. Summary of the invention

[0009] In view of the problems existing in the above-mentioned prior art and to overcome the defects of the existing animal models, the purpose of the present invention is to construct a real-time visible liver humanized PiZZ mouse model suitable for rare AATD liver disease, with detectable indicators in vivo, sound immunity, economy, short modeling cycle, and available domestically. In order to achieve the purpose of the present invention, the inventors have combined and optimized the selection of reporter genes, the construction of PiZZ rare disease point mutation genes and plasmids, and high-speed fluid mechanics.

[0010] A method for constructing a real-time visual liver humanized PiZZ mouse model, comprising the steps of:

[0011] (1) Selection of reporter gene and construction of vector plasmid DNA;

[0012] (2) Design of PiZZ rare disease point mutation genes;

[0013] (3) Design of naked plasmid DNA;

[0014] (4) Amplification and purification of naked plasmid DNA;

[0015] (5) Establish a real-time visualized liver humanized transiently transfected PiZZ mouse model through HDI.

[0016] Preferably, in step (1), the reporter gene is the Luc2 gene whose substrate is D-luciferin potassium. The Luc2 gene Genebank ID is AY738225.1.

[0017] Furthermore, a Kozak sequence with the sequence of GCCACC was designed before the start codon of the Luc2 gene, and after removing the stop codon at the 3′ end, a 2A peptide (P2A) with the sequence of GCAACCAATTTCTCTCTTCTTAAACAAGCCGGTGATGTGGAGGAGAACCCCGGACCC (SEQ ID NO. 1) and a multiple cloning site (MCS) of AvrII-MluI-PvuI-stop codon TGA-FseI with the sequence of CCTAGGACGCGTCGATCGTGAGGCCGGCC (SEQ ID NO. 2) were designed, and the vector plasmid DNA was named pLC-Luc2-P2A.

[0018] In step (2), the PiZZ rare disease point mutation gene is based on the human SERPINA1 gene (Genebank ID: NM_000295.5) as a reference sequence, and the 342nd amino acid is designed to mutate from glutamic acid (Glutamic acid, Glu, E) to lysine (Lysine, Lys, K), and the corresponding nucleotide sequence GAG ​​is site-directedly mutated to AAG to obtain the PiZZ rare disease point mutation gene.

[0019] In step (3), the 5' end design sequence of the PiZZ rare disease point mutation gene obtained in step (2) is MluI with ACGCGT and the 3' end sequence is SacI with GAGCTC, and the restriction sites are connected to the pLC-Luc2-P2A vector plasmid DNA to obtain naked plasmid DNA, named pLC-Luc2-P2A-hPiZZ E342K. The plasmid DNA is transcribed into mRNA, and then translated into three connected Luc2-P2A-hPiZZ E342K fusion proteins from the mRNA. The short peptide P2A derived from the virus will self-cleave between glycine and proline, cutting Luc2 and hPiZZ E342K, and each expresses its protein function.

[0020] In step (4), the amplification and purification specifically include transforming the pLC-Luc2-P2A-hPiZZE342K naked plasmid DNA obtained in step (3) into DH5α competent cells, coating on a Kan+ LB plate, picking positive clones for inoculation, shaking the cells overnight, extracting the plasmid and sequencing and identifying it to obtain a sufficient amount of naked plasmid DNA. Preferably, the shaking temperature is 37°C.

[0021] In step (5), a real-time visual liver humanized transiently transfected PiZZ mouse model was established by HDI.

[0022] Preferably, the mouse model uses 6-7 week old immunocompetent C57BL / 6 or BALB / c female mice;

[0023] Preferably, each mouse is injected with a plasmid DNA solution, preferably, each mouse is injected with a total volume of 10% of the body weight of the plasmid DNA solution, the solution being a plasmid DNA solution of pLC-Luc2-P2A-hPiZZ E342K in 0.9% NaCl saline as a solvent. Preferably, a plasmid DNA solution of 5 pmol / mouse pLC-Luc2-P2A-hPiZZ E342K is prepared.

[0024] Preferably, the plasmid DNA solution equivalent to 10% of the mouse body weight is injected into the tail vein HDI of the mouse within 5-8 seconds, and further preferably, the tail of the nude mouse is soaked in warm water to expose the tail vein of the mouse. Preferably, the pLC-Luc2-P2A-hPiZZ E342K naked plasmid expressing the humanized gene is delivered to the liver cells for expression, so as to establish a real-time visible liver humanized transient PiZZ mouse model.

[0025] Preferably, the PiZZ mouse model establishment process includes using 6-7 week old immune-competent C57BL / 6 or BALB / c female mice, injecting each mouse with a total volume of 10% pLC-Luc2-P2A-hPiZZ E342K plasmid DNA solution of body weight, preferably, preparing a plasmid DNA solution with a concentration of 5 pmol / mouse pLC-Luc2-P2A-hPiZZE342K using 0.9% NaCl saline as a solvent, delivering the plasmid DNA solution to liver cells for expression through the mouse tail vein HDI, and establishing a real-time visible liver humanized transient PiZZ mouse model. Preferably, the modeling process includes fixing 6-7 week old immune-competent C57BL / 6 or BALB / c female mice with a mouse fixer, soaking the tail of the nude mouse in 42°C warm water, exposing the tail vein of the mouse, and then rapidly injecting a pLC-Luc2-P2A-hPiZZE342K plasmid DNA solution equivalent to 10% of the mouse body weight in volume through the tail vein HDI of the mouse within 5 to 8 seconds, delivering the plasmid DNA to liver cells for expression, and establishing a real-time visible liver humanized transient PiZZ mouse model.

[0026] Another aspect of the present invention provides a real-time visual liver humanized PiZZ mouse model.

[0027] In another aspect, the present invention provides an application of the PiZZ mouse model in studying AATD disease or screening AATD disease drugs.

[0028] Using hydrodynamic injection (HDI), or hydrodynamic tail vein injection or hydrodynamic gene delivery, the naked plasmid DNA of human genes with point mutations can be cleverly combined to permeabilize cell membranes and promote intracellular gene transfer by the physical force of dynamic pressure generated by rapidly injecting a large amount of liquid into the blood vessels. The gene expressing the humanized point mutation is injected into the mouse tail vein. Due to the huge hydrodynamic force caused by the injection, the hepatic pores expand, allowing the genetic material to enter the liver cells.

[0029] The beneficial effects of the present invention are:

[0030] 1. The model disclosed in the present invention can achieve the pathological characteristics of AATD in a short period of eight weeks. The D-PAS staining of liver tissue pathological examination showed positive polymer beads, revealing the degree of aggregation of misfolded proteins. The severity of the pathology is also correlated with the specific E342K mRNA of the point mutation site that causes the rare disease AATD.

[0031] 2. The model disclosed in the present invention can detect Luc2 signals through a small animal in vivo imaging device from the beginning of modeling to the end of the experiment, which can achieve real-time visualization of the transgene and the degree of humanization of the transgene in the mouse liver; and the Luc2 signal is consistent with the trend of the AAT protein level detected by ELISA;

[0032] 3. The model disclosed in the present invention is an immunocompetent mouse, which is more able to simulate the immune response of clinical AATD patients after using drugs in preclinical trials of new drugs than the humanized NSG-PiZ combined immunodeficient mice imported from the United States;

[0033] 4. The model building method disclosed in the present invention has a simple process and low cost, which can reduce R&D costs;

[0034] 5. The model construction method disclosed in the present invention can not only introduce a single mutant gene that causes a rare disease, but also have a homozygous-like effect, eliminating the genotype identification and homozygous screening cycle required for traditional stable transformation;

[0035] 6. The model disclosed in the present invention can fill the gap of the real-time visual liver humanized transient PiZZ mouse model;

[0036] 7. The model construction method disclosed in the present invention has the potential to be applied to large animal models.

[0037] In summary, the method for constructing a real-time visible liver humanized transiently transfected PiZZ mouse model disclosed in the present invention can quickly establish a model in eight weeks in a short period of time, and the model establishment rate passing in vivo quality control is 100%. It can be applied to the preclinical efficacy evaluation of targeted PiZZ inhibitors for the treatment of AATD, which is beneficial to the study of the pathogenesis of human AATD and the development of PiZZ targeted drug therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Plasmid map for efficient establishment of a humanized transiently transfected PiZZ mouse model with real-time visualization of the liver;

[0039] Figure 2 Schematic diagram of the modeling process for the real-time visualization of the humanized liver transiently transfected PiZZ mouse model;

[0040] Figure 3Real-time visualization of transgene expression in the liver for the humanized transient PiZZ mouse model;

[0041] Figure 4 It indicates that the trend of Luc2 signal and hAAT protein level in the humanized transiently transfected PiZZ mouse model is consistent;

[0042] Figure 5 It indicates that the humanized transient PiZZ mouse model has pathological features similar to clinical AATD at 8 weeks;

[0043] Figure 6 Schematic diagram of the target location of small nucleic acid drugs for treating AATD in liver mRNA in the humanized PiZZ mouse model. DETAILED DESCRIPTION

[0044] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and specific embodiments. However, the specific technical solution further defined does not limit the present invention.

[0045] The gene sequence of the present invention was commissioned to be synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0046] DH5α competent cells (Nanjing Novozymes Corporation, C502-03).

[0047] Plasmid extraction kit (MACHEREY-NAGEL, product number 740410.50)

[0048] Example 1: Design and purification of pLC-Luc2-P2A-hPiZZ E342K naked plasmid DNA

[0049] The Firefly Luciferase luc2 gene (Genebank ID: AY738225.1), abbreviated as "Luc2", was used as the reference sequence. A Kozak sequence with the sequence of GCCACC was designed before the start codon of the Luc2 gene. After removing the stop codon at the 3' end, a 2A peptide (P2A) with the sequence of GCAACCAATTTCTCTCTTCTTAAACAAGCCGGTGATGTGGAGGAGAACCCCGGACCC and a multiple cloning site with the sequence of CCTAGGACGCGTCGATCGTGAGGCCGGCC, AvrII-MluI-PvuI-stop codon TGA-FseI were designed. The vector plasmid DNA was named pLC-Luc2-P2A and gene synthesis was commissioned (Nanjing GenScript Biotechnology Co., Ltd.).

[0050] Then, the human SERPINA1 gene (Genebank ID: NM_000295.5) was used as the reference sequence, and the 342nd amino acid was designed to mutate from glutamic acid (Glu, E) to lysine (Lys, K), and the corresponding nucleotide sequence GAG ​​was site-directed mutated to AAG. Finally, the restriction enzyme sequences of MluI with the sequence ACGCGT at the 5' end and SacI with the sequence GAGCTC at the 3' end were designed, and gene synthesis (Nanjing GenScript Biotechnology Co., Ltd.) was commissioned to be connected to the pLC-Luc2-P2A vector plasmid DNA through the restriction enzyme sites to become a full-length 6377bp pLC-Luc2-P2A-hPiZZ E342K plasmid DNA, see for details. Figure 1 .

[0051] Finally, the pLC-Luc2-P2A-hPiZZ E342K naked plasmid was transformed into DH5α competent cells (Novagen, C502-03), spread on Kan+ LB plates, picked positive clones for inoculation, and shaken at 37°C overnight. The plasmid was extracted and purified using a plasmid extraction kit (MACHEREY-NAGEL, 740410.50) and sequenced to obtain sufficient naked plasmid DNA.

[0052] Example 2: Establishment of a humanized liver transiently transfected PiZZ mouse model with real-time visualization

[0053] Use 6-7 week old immune-competent C57BL / 6 or BALB / c female mice, and inject each mouse with a total volume of 10% of body weight liquid, using 0.9% NaCl saline as solvent, prepare 5 pmol / mouse of vector negative control group and 5 pmol / mouse of pLC-Luc2-P2A-hPiZZ E342K plasmid DNA solution. Fix the mouse with a mouse fixator, soak the nude mouse tail in 42°C warm water, expose the mouse tail vein, and quickly inject a volume of liquid equivalent to 10% of the mouse body weight (for example, the injection volume of 20g mouse is 2ml of plasmid solution) through the mouse tail vein HDI within 5-8 seconds, and deliver the pLC-Luc2-P2A-hPiZZ E342K naked plasmid expressing the humanized gene to the liver cells for expression, and establish a real-time visual liver humanized transient PiZZ mouse model, see for details. Figure 2 .

[0054] Example 3: Humanized transient PiZZ mouse model shows real-time visualization of transgene expression in the liver

[0055] D-luciferin potassium salt powder (McLean, D812647) was dissolved in D-PBS (Biyuntian, C0221D) without magnesium and calcium ions to prepare a D-Luciferin solution with a concentration of 15 mg / ml, and then sterilized with a 0.2μm filter and stored in a -20℃ refrigerator. The night before the filming, the mice were fasted but not watered overnight. Each mouse weighing 20g was intraperitoneally injected with 200μl of D-Luciferin solution, and placed in a supine position with the chest facing up on a small animal in vivo imager (Guangzhou Bolu Teng, AniView SE) with a gas anesthesia mask to capture the Luc2 signal in bioluminescence mode.

[0056] The humanized transient PiZZ mouse model is a naked plasmid DNA of pLC-Luc2-P2A-hPiZZ E342K. It is enriched in liver cells by the HDI method, transcribed into mRNA by DNA, and then translated into protein. Luc2 and hPiZZ E342K proteins are expressed in the liver through P2A self-cleavage. Under the action of Luc2 protein and ATP in the mouse body, the D-Luciferin substrate is oxidized to emit light. The changes in light intensity are detected by bioluminescence imaging technology (BLI), thereby monitoring the development status of the model's humanized transgene in real time. Therefore, the humanized transient PiZZ mouse model can present real-time visualization of the expression level of the transgene in the liver by detecting Luc2. The model group is visually in sharp contrast with the wild-type control group. For details, see Figure 3 .

[0057] Example 4: The Luc2 signal in the humanized transiently transfected PiZZ mouse model is consistent with the hAAT protein level trend

[0058] Humanized transient PiZZ mouse model n=20, fasted but not watered overnight on day 20 (d20) after modeling, and captured Luc2 signal with a small animal in vivo imager in the morning of d21, with the wild-type (B6 WT) control group as the blank group (Blank), subtracted the background value, quantified the Luc2 signal and sorted it from high to low by signal mean ( Figure 4 A), after the filming, restore the diet and vitality, and put it back into the cage.

[0059] On the morning of d22 of the humanized transient PiZZ mouse model, the middle value of Luc2 (n=3) and one mouse with high, medium and low values ​​were selected and fasted for half a day. On the afternoon of d22, blood was collected from the eye sockets to keep the mice alive. The serum was separated and diluted 10 times, and the protein level was detected using the hAATELISA kit (Boster, EK1634). The Luc2 signal of the humanized transient PiZZ mouse model on d21 was high (#424), medium (#417), and low (#535). The human AAT ELISA values ​​of the mouse serum on d22 were 49.5±0.62ng / ml, 36.0±1.59ng / ml, and 8.0±0.13ng / ml, respectively. The Luc2 signal can reflect the high, medium, and low protein levels of human AAT ( Figure 4 B). The average Luc2 signal of the humanized transiently transfected PiZZ mouse model at d21 was 1.11E+06, and the human AAT ELISA values ​​of the serum of the n=3 (#670, #417, #642) mice at d22 were 30.7±1.18ng / ml, 36.0±1.59ng / ml, 27.0±0.12ng / ml ( Figure 4 CD), its n=3 is very close, so the Luc2 signal can reflect the protein level of human AAT.

[0060] Example 5: Humanized transiently transfected PiZZ mouse model has pathological features similar to clinical AATD at 8 weeks

[0061] When the humanized transient PiZZ mouse model was 8 weeks old, a small piece of liver tissue with comparable position was fixed. The D-PAS staining method is to digest the liver tissue slices with amylase first, remove glycogen, and then stain with periodic acid (PAS). The PAS oxidant oxidizes the 1,2-ethylene glycol group in sugars and related substances to convert them into dialdehydes. The aldehydes then combine with Schiff reagent to generate a red compound. The depth of the reactant color depends on the amount of ethylene glycol structure that can react in the tissue. In this way, the structural components of glycoproteins can be more clearly revealed, such as abnormally folded polymer globules and amyloid proteins in the cytoplasm of AATD liver cells. D-PAS staining result evaluation criteria: glycogen and other PAS-positive substances are red, and the cell nucleus is blue. The slices treated with amylase are glycogen-negative. The degree of positive reaction is distinguished according to the depth of color, very strong positive: ++++, strong positive: +++, moderate positive: ++, weak positive: +, very weak positive / negative: + / -.

[0062] In the #2 model, the liver tissue of the humanized transiently transfected PiZZ mouse model was strongly positive by D-PAS staining at 8 weeks. After the liver tissue was homogenized, 0.2 g of tissue was weighed and total RNA was extracted by Trizol method (Invitrogen, 15596018). After reverse transcription into 1st-cDNA (Tuosu, TR0101), the mRNA level was identified by qPCR (Tuosu, TR0204-5) using primers with hPiZZ E342K specificity, forward primer sequence 5'-AGACAGAAGGTCTGCCAGCT-3' and reverse primer 5'-AGCAGCTTCAGTCCCTTTCTT-3'. Figure 5 Abnormal folded polymer globules were found in AATD liver tissue #2 ( Figure 5 A), relative quantification of human PiZZ E342K mRNA and mouse Actin in liver #2 was 4275.7 times higher than that in the control group ( Figure 5 B); In the #1 model with moderately positive liver pathology, the relative quantification of human PiZZ E342K mRNA and mouse Actin in the liver was 2566.6 times higher than that in the control group. The humanized transient PiZZ mouse model not only had pathological features similar to clinical AATD at 8 weeks, but also had a positive correlation between the severity of its pathology and the level of human PiZZ E342K mRNA ( Figure 5 ).

[0063] Example 6: The humanized transiently transfected PiZZ mouse model of the present invention is suitable for the evaluation of the efficacy of small nucleic acid drugs for the treatment of AATD

[0064] Fazirsiran, a siRNA small nucleic acid drug targeting the human SERPINA1 gene for the treatment of AATD developed by Arrowhead, USA, is undergoing Phase III clinical trials. According to the company's published but unauthorized patent (CN 114222820A), AD04837 has the best efficacy in the non-human primate NHP model. Its unmodified target sequence of the positive chain is 5'-AGCGUUUAGGCAUGUUUAACA-3', and its unmodified target sequence of the antisense chain is 5'-UGUUAAACAUGCCUAAACGCU-3', targeting the second exon ( Figure 6 ), the model of the present invention covers this target, and it is suitable for original research drugs to use Arrowhead's Fazirsiran as a yang ginseng drug in preclinical efficacy evaluation.

Claims

1. A method for constructing a real-time visual liver humanized PiZZ mouse model, comprising the steps of: (1) Selection of reporter gene and construction of vector plasmid DNA; (2) Design of PiZZ rare disease point mutation genes; (3) Design of naked plasmid DNA; (4) Amplification and purification of naked plasmid DNA; (5) Establish a real-time visualized liver humanized transiently transfected PiZZ mouse model through HDI.

2. The construction method according to claim 1, wherein in step (1), the reporter gene is the Luc2 gene whose substrate is potassium D-luciferin, and the Luc2 gene Genebank ID is AY738225.

1.

3. The construction method according to claim 2 further comprises designing a Kozak sequence with a sequence of GCCACC before the start codon of the Luc2 gene, removing the stop codon at the 3' end, designing a 2A peptide (P2A) with a sequence of SEQ ID NO.1 and a multiple cloning site of AvrII-MluI-PvuI-stop codon TGA-FseI with a sequence of SEQ ID NO.2, and designing a vector plasmid DNA named pLC-Luc2-P2A.

4. The construction method according to claim 1, in step (2), the PiZZ rare disease point mutation gene is based on the human SERPINA1 gene (Genebank ID: NM_000295.5) as a reference sequence, and the 342nd amino acid is designed to mutate from glutamic acid (Glu, E) to lysine (Lys, K), and the corresponding nucleotide sequence GAG ​​is site-directedly mutated to AAG.

5. The construction method according to claim 1, in step (3), the 5' end design sequence of the PiZZ rare disease point mutation gene obtained in step (2) is MluI with an ACGCGT sequence and the 3' end sequence is SacI with a GAGCTC sequence, and is connected to the pLC-Luc2-P2A vector plasmid DNA through the restriction site to obtain the naked plasmid DNA, named pLC-Luc2-P2A-hPiZZ E342K.

6. The construction method according to claim 1, in step (4), the amplification and purification specifically comprises transforming the pLC-Luc2-P2A-hPiZZ E342K naked plasmid DNA obtained in step (3) into DH5α competent cells, spreading it on a Kan+ LB plate, picking positive clones for inoculation, shaking the bacteria overnight, extracting the plasmid and sequencing it to obtain the naked plasmid DNA.

7. The construction method according to claim 1, wherein in step (5), the mouse model uses 6-7 week old immune-competent C57BL / 6 or BALB / c female mice.

8. The construction method according to claim 7, wherein the plasmid DNA solution of pLC-Luc2-P2A-hPiZZ E342K is injected into the mouse tail vein.

9. The construction method according to claim 7, wherein the total volume of HDI for each mouse is 10% of the body weight of the plasmid DNA solution of pLC-Luc2-P2A-hPiZZ E342K. 10 . The construction method according to claim 9 , wherein the solution is a plasmid DNA solution of pLC-Luc2-P2A-hPiZZ E342K using 0.9% NaCl saline as solvent.

11. The construction method according to claim 7, comprising rapidly injecting a plasmid DNA solution of pLC-Luc2-P2A-hPiZZ E342K equivalent to 10% of the mouse body weight through the tail vein HDI within 5-8 seconds, delivering the pLC-Luc2-P2A-hPiZZ E342K naked plasmid expressing the humanized gene into liver cells for expression, and establishing the real-time visible liver humanized transient PiZZ mouse model.

12. The construction method according to claim 7, wherein the PiZZ mouse model establishment process comprises using 6-7 week old immune-competent C57BL / 6 or BALB / c female mice, injecting a total volume of HDI into the tail vein of each mouse with a pLC-Luc2-P2A-hPiZZ E342K plasmid DNA solution of 10% of body weight, delivering the plasmid DNA into liver cells for expression, and establishing the real-time visible liver humanized transient PiZZ mouse model.

13. A real-time visual liver humanized PiZZ mouse model, wherein the mouse model is constructed according to the construction method according to any one of claims 1 to 12.

14. An application of the PiZZ mouse model in studying AATD disease or screening drugs for AATD disease.

Citation Information

Patent Citations

  • Methods for treating alpha-1 antitrypsin deficiency (AATD)

    CN114222820A