Non-human animal modified by TRBC gene

Abstract

The present invention provides a non-human animal expressing a human or chimeric (e.g., humanized) TRBC protein and methods of use thereof.

Description

Technical Field

[0001] The present invention provides a non-human animal expressing a human or chimeric (eg, humanized) TRBC protein and methods of use thereof. Background Art

[0002] Traditional drug development usually uses in vitro screening methods, but these screening methods cannot provide the body environment (such as tumor microenvironment, stromal cells, extracellular matrix components and immune cell interactions, etc.), resulting in a high failure rate of drug development. In addition, given the differences between humans and animals, the test results obtained from in vivo pharmacology tests using conventional experimental animals may not reflect the actual disease state and the interaction of the target site, resulting in significant differences between the results of many clinical trials and the results of animal experiments.

[0003] Therefore, developing humanized animal models suitable for screening and evaluation of human drugs will significantly improve the efficiency of new drug development and reduce drug development costs. Summary of the invention

[0004] The present application provides an animal model with human or chimeric TRBC protein. The animal model can express human or chimeric TRBC (e.g., humanized TRBC) protein. It can be used for the study of TRBC gene function, and can also be used for the screening and evaluation of TRBC signaling pathway regulators (e.g., therapeutic agents targeting TRBC, including antibodies targeting TRBC, nucleic acid drugs targeting TRBC, and / or polypeptide drugs). In addition, the animal model prepared by the method described in the present application can be used for drug screening, pharmacodynamic studies, and treatment studies of diseases of human TRBC targets (including tumors, inflammatory or immune diseases, preferably tumors); the animal model can also be used to promote new drug development and design, saving time and cost. In summary, the present invention provides a powerful tool for studying the function of TRBC protein and provides a platform for screening drugs for the treatment of related diseases.

[0005] In one aspect, the present invention provides a genetically modified non-human animal or a method for constructing the same, wherein the genome of the non-human animal comprises at least one chromosome, the chromosome comprising a nucleotide sequence encoding a human or chimeric T cell receptor B chain constant region (TRBC) protein. In some embodiments, the chromosome comprises a nucleotide sequence encoding a human or chimeric TRBC1 protein. In some embodiments, the chimeric TRBC1 protein comprises all or part of the extracellular region of the human TRBC1 protein, and preferably also comprises all or part of the transmembrane region of the human TRBC1 protein. In some embodiments, the nucleotide sequence encoding all or part of the human or chimeric TRBC1 protein may be a genomic DNA sequence, a CDS sequence, or a cDNA sequence. In some embodiments, the chimeric TRBC1 protein is a humanized TRBC1 protein. In some embodiments, the chimeric TRBC1 protein comprises a human or humanized extracellular region. In some embodiments, the chimeric TRBC1 protein comprises a human or humanized extracellular region, an endogenous or humanized transmembrane region of a non-human animal, and an endogenous cytoplasmic region of a non-human animal. In some embodiments, the amino acid sequence of the chimeric TRBC1 protein comprises an amino acid sequence that is identical to at least 50 to 176, e.g., at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 145, 147, 149, 150, 160, 163, 170, 175 or 176, consecutive or non-consecutive amino acid sequences of a human TRBC1 protein. In some embodiments, the amino acid sequence of the chimeric TRBC1 protein comprises SEQ ID NO:2, positions 3-149 of SEQ ID NO:2, positions 1-149 of SEQ ID NO:2, or positions 1-163 of SEQ ID NO:2; or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.5% identical to the amino acid sequence shown in SEQ ID NO:2, positions 3-149 of SEQ ID NO:2, positions 1-149 of SEQ ID NO:2, or positions 1-163 of SEQ ID NO:2. In some embodiments, the amino acid sequence of the chimeric TRBC1 protein comprises SEQ ID NO: 1, positions 1-2 and 146-172 of SEQ ID NO: 1, positions 146-172 of SEQ ID NO: 1, or positions 160-172 of SEQ ID NO: 1; or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.5% identical to the amino acid sequence shown in SEQ ID NO: 1, positions 1-2 and 146-172 of SEQ ID NO: 1, positions 146-172 of SEQ ID NO: 1, or positions 160-172 of SEQ ID NO: 1.In some embodiments, the amino acid sequence of the chimeric TRBC1 protein comprises SEQ ID NO: 24, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to SEQ ID NO: 24. In some embodiments, the chromosome further comprises a nucleotide sequence encoding a human or chimeric TRBC2 protein. In some embodiments, the chimeric TRBC2 protein comprises all or part of the extracellular region of the human TRBC2 protein, and preferably also comprises all or part of the transmembrane region of the human TRBC2 protein. In some embodiments, the nucleotide sequence encoding all or part of the human or chimeric TRBC2 protein may be a genomic DNA sequence, a CDS sequence or a cDNA sequence. In some embodiments, the chimeric TRBC2 protein is a humanized TRBC2 protein. In some embodiments, the chimeric TRBC1 protein comprises a human or humanized extracellular region. In some embodiments, the chimeric TRBC2 protein comprises a human or humanized extracellular region, an endogenous or humanized transmembrane region of a non-human animal, and an endogenous cytoplasmic region of a non-human animal. In some embodiments, the amino acid sequence of the chimeric TRBC2 protein comprises an amino acid sequence that is identical to at least 50 to 178, e.g., at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 142, 144, 147, 149, 150, 160, 163, 170, 175 or 178, consecutive or non-consecutive amino acid sequences of a human TRBC2 protein. In some embodiments, the amino acid sequence of the chimeric TRBC2 protein comprises SEQ ID NO:4, positions 3-144 of SEQ ID NO:4, positions 1-149 of SEQ ID NO:4, or positions 1-163 of SEQ ID NO:4; or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.5% identical to the amino acid sequence shown in SEQ ID NO:4, positions 3-144 of SEQ ID NO:4, positions 1-149 of SEQ ID NO:4, or positions 1-163 of SEQ ID NO:4. In some embodiments, the amino acid sequence of the chimeric TRBC2 protein comprises SEQ ID NO: 3, positions 1-2 and 146-172 of SEQ ID NO: 3, positions 146-172 of SEQ ID NO: 3, or positions 160-172 of SEQ ID NO: 3; or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.5% identical to the amino acid sequence set forth in SEQ ID NO: 3, positions 1-2 and 146-172 of SEQ ID NO: 3, positions 146-172 of SEQ ID NO: 3, or positions 160-172 of SEQ ID NO: 3.In some embodiments, the amino acid sequence of the chimeric TRBC2 protein comprises SEQ ID NO: 25, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to SEQ ID NO: 25. In some embodiments, the chromosome comprises a nucleotide sequence encoding a human or chimeric TRBC1 protein, and / or, a nucleotide sequence encoding a human or chimeric TRBC2 protein. In some embodiments, the human or chimeric TRBC protein comprises a human or chimeric TRBC1 protein, and / or, a human or chimeric TRBC2 protein. In some embodiments, the nucleotide sequence encoding the human or chimeric TRBC protein is regulated by an endogenous regulatory element (e.g., a promoter, a 5'UTR and / or a 3'UTR). In some embodiments, the non-human animal is a mammal, such as a monkey or a rodent. In some embodiments, the rodent comprises a mouse or a rat. In some embodiments, the non-human animal is a mouse. In some embodiments, one or more cells of the non-human animal express a human or chimeric TRBC protein.

[0006] On the one hand, the present invention provides a genetically modified non-human animal or a method for constructing the same, wherein the genome of the non-human animal comprises a nucleotide sequence in an endogenous TRBC region at an endogenous TRBC locus, and is replaced by a nucleotide sequence comprising a human or chimeric TRBC corresponding region. In some embodiments, the nucleotide sequence comprising a human or chimeric TRBC corresponding region is operably connected to a regulatory element (e.g., a promoter, 5'UTR, and / or 3'UTR) of an endogenous TRBC gene. In some embodiments, one or more cells of the non-human animal express human or humanized TRBC protein. In some embodiments, the nucleotide sequence comprising a human or chimeric TRBC corresponding region comprises all or part of a human TRBC1 gene, preferably, the nucleotide sequence comprising a human or chimeric TRBC corresponding region comprises all or part of a human TRBC1 gene and all or part of a human TRBC2 gene. In some embodiments, the nucleotide sequence comprising a human or chimeric TRBC corresponding region comprises all or part of a human TRBC1 gene, and / or, all or part of a human TRBC2 gene. In some embodiments, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises part of exon 1, all of exon 2, and part of exon 3 of human TRBC1 gene (preferably also comprising intron 1 and / or intron 2). In some embodiments, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises part of exon 1, all of exon 2, and part of exon 3 of human TRBC2 gene (preferably also comprising intron 1 and / or intron 2). In some embodiments, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises part of exon 1, all of exon 2, and part of exon 3 of human TRBC1 gene (preferably also comprising intron 1 and / or intron 2), and comprises part of exon 1, all of exon 2, and part of exon 3 of human TRBC2 gene (preferably also comprising intron 1 and / or intron 2). In some embodiments, the nucleotide sequence comprising the corresponding region of the chimeric TRBC comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence shown in SEQ ID NO: 7. In some embodiments, the nucleotide sequence of the endogenous TRBC region comprises all or part of the endogenous TRBC1 gene of a non-human animal. In some embodiments, the nucleotide sequence encoding the endogenous TRBC region comprises all or part of the endogenous TRBC2 gene of a non-human animal. In some embodiments, the nucleotide sequence of the endogenous TRBC region comprises all or part of the endogenous TRBC1 gene of a non-human animal and all or part of the endogenous TRBC2 gene of a non-human animal.In some embodiments, the nucleotide sequence of the endogenous TRBC region comprises a portion of exon 1, all of exon 2, and a portion of exon 3 (preferably also comprising intron 1 and / or intron 2) of an endogenous TRBC1 gene of a non-human animal. In some embodiments, the nucleotide sequence of the endogenous TRBC region comprises a portion of exon 1, all of exon 2, and a portion of exon 3 (preferably also comprising intron 1 and / or intron 2) of an endogenous TRBC1 gene of a non-human animal and a portion of exon 1, all of exon 2, and a portion of exon 3 (preferably also comprising intron 1 and / or intron 2) of an endogenous TRBC2 gene of a non-human animal. In some embodiments, the modified TRBC gene in the genome of the non-human animal is homozygous or heterozygous for the endogenously replaced locus.

[0007] In one aspect, the present invention provides a genetically modified non-human animal or a method for constructing the same, wherein the nucleotide sequence of the corresponding region of endogenous TRBC in the non-human animal is replaced with a nucleotide sequence comprising human or chimeric TRBC at the endogenous TRBC locus of the non-human animal. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises a nucleotide sequence encoding a human or chimeric TRBC1 protein. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises a nucleotide sequence encoding all or part of the extracellular region of the human TRBC1 protein, preferably a nucleotide sequence encoding all or part of the transmembrane region of the human TRBC1 protein. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises all or part of the human TRBC1 gene. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises a nucleotide sequence consistent with at least 50 to at least 1448 bp of the human TRBC1 gene, for example, at least 50, 100, 200, 300, 400, 441, 500, 760, 1000, 1400, 1440, 1445 or 1448 bp of continuous or non-continuous nucleotides. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises a portion of exon 1 to a portion of exon 3 of the human TRBC1 gene, wherein the portion of exon 1 of the human TRBC1 gene preferably comprises at least 5-387bp, for example, at least 5, 10, 50, 100, 150, 200, 250, 300, 350, 379, 380, 385 or 387bp of continuous nucleotide sequence, preferably comprising the nucleotide sequence of the coding region; the portion of exon 3 of the human TRBC1 gene preferably comprises at least 5-107bp, for example, at least 5, 10, 15, 20, 25, 30, 35, 40, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105 or 107bp of continuous nucleotide sequence, preferably comprising the nucleotide sequence of the coding region. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises the nucleotide sequence at positions 142791702-142792735 of NCBI accession number NC_000007.14; or comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity with the nucleotide sequence at positions 142791702-142792735 of NCBI accession number NC_000007.14. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises a nucleotide sequence encoding a human or chimeric TRBC2 protein. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises a nucleotide sequence encoding all or part of the extracellular region of the human TRBC2 protein, preferably a nucleotide sequence encoding all or part of the transmembrane region of the human TRBC2 protein.In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises all or part of a human TRBC2 gene. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises a nucleotide sequence identical to at least 50 to at least 1489 bp of a human TRBC2 gene, for example, at least 50, 100, 200, 300, 400, 441, 500, 700, 758, 760, 1000, 1400, 1440, 1480 or 1489 bp of continuous or non-continuous nucleotides. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises a portion of exon 1 to a portion of exon 3 of the human TRBC2 gene, wherein the portion of exon 1 of the human TRBC2 gene preferably comprises at least 5-387bp, for example, at least 5, 50, 100, 150, 200, 250, 300, 350, 370, 379, 380, 385 or 387bp of continuous nucleotide sequence, preferably comprising the nucleotide sequence of the coding region; the portion of exon 3 of the human TRBC2 gene preferably comprises at least 5-107bp, for example, at least 5, 10, 15, 20, 25, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105 or 107bp of continuous nucleotide sequence, preferably comprising the nucleotide sequence of the coding region. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises the nucleotide sequence of positions 142801049-142802133 of NCBI accession number NC_000007.14 or a variant thereof; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence of positions 142801049-142802133 of NCBI accession number NC_000007.14 or a variant thereof. In some embodiments, the variant comprises a mutation from G to A at position 142801129, a mutation from T to C at position 142802045, and a mutation from A to G at position 142802078. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC also comprises a portion of exon 3 of an endogenous TRBC1 gene of a non-human animal to a portion of exon 1 of an endogenous TRBC2 gene of a non-human animal, wherein the portion of exon 3 of an endogenous TRBC1 gene of a non-human animal preferably comprises at least 1-375bp, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 50, 100, 150, 200, 250, 300, 350 or 375bp of continuous nucleotide sequence, and the portion of exon 1 of an endogenous TRBC2 gene of a non-human animal preferably comprises at least 5-107bp, for example, at least 5, 10, 20, 30, 40, 50, 60, 61, 62, 63, 64, 65, 70, 80, 90, 100 or 107bp of continuous nucleotide sequence.In some embodiments, the nucleotide sequence comprising human or chimeric TRBC further comprises the nucleotide sequence at positions 41516207-41523671 of NCBI Accession Number NC_000072.7; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence at positions 41516207-41523671 of NCBI Accession Number NC_000072.7. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC further comprises a portion of exon 3 of an endogenous TRBC2 gene of a non-human animal to all of exon 4, wherein the portion of exon 3 of an endogenous TRBC2 gene of a non-human animal preferably comprises at least 5-107bp, for example, 5, 10, 20, 30, 40, 50, 60, 61, 62, 63, 64, 65, 70, 80, 90, 100 or 107bp of continuous nucleotide sequence. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC further comprises a portion of exon 3 of an endogenous TRBC2 gene of a non-human animal to a nucleotide sequence of a stop codon, preferably further comprises 3'UTR, and further preferably further comprises at least 5bp of continuous nucleotide sequence downstream of 3'UTR. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC further comprises a portion of exon 3 of an endogenous TRBC2 gene of a non-human animal to at least 5bp of continuous nucleotide sequence downstream of 3'UTR. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC further comprises the nucleotide sequence of positions 41524735-41525760 with NCBI accession number NC_000072.7; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence of positions 41524735-41525760 with NCBI accession number NC_000072.7. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises, from the 5' end to the 3' end, part of exon 1 to part of exon 3 of the human TRB1 gene, part of exon 3 of the endogenous TRBC1 gene of a non-human animal to part of exon 1 of the endogenous TRBC2 gene of a non-human animal, part of exon 1 to part of exon 3 of the human TRBC2 gene, and part of exon 3 of the endogenous TRBC2 gene of a non-human animal to at least 5 bp of continuous nucleotide sequence downstream of 3'UTR. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises SEQ ID NO: 7; or comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to the nucleotide sequence shown in SEQ ID NO: 7. In some embodiments, the nucleotide sequence of the corresponding region of the endogenous TRBC of a non-human animal comprises a nucleotide sequence encoding an endogenous TRBC1 protein of a non-human animal.In some embodiments, the nucleotide sequence of the corresponding region of endogenous TRBC of a non-human animal comprises a nucleotide sequence encoding all or part of the extracellular region of an endogenous TRBC1 protein of a non-human animal, and preferably comprises a nucleotide sequence encoding all or part of the transmembrane region of an endogenous TRBC1 protein of a non-human animal. In some embodiments, the nucleotide sequence of the corresponding region of endogenous TRBC of a non-human animal comprises a nucleotide sequence encoding positions 1-145 of SEQ ID NO: 1, positions 3-145 of SEQ ID NO: 1, or positions 1-159 of SEQ ID NO: 1, or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to a nucleotide sequence encoding positions 1-145 of SEQ ID NO: 1, positions 3-145 of SEQ ID NO: 1, or positions 1-159 of SEQ ID NO: 1. In some embodiments, the nucleotide sequence of the corresponding region of endogenous TRBC of a non-human animal comprises all or part of an endogenous TRBC1 gene of a non-human animal. In some embodiments, the nucleotide sequence of the corresponding region of endogenous TRBC of a non-human animal includes a portion of exon 1 to a portion of exon 3 of the endogenous TRBC1 gene of the non-human animal, wherein the portion of exon 1 of the endogenous TRBC1 gene of the non-human animal preferably contains at least 5-375bp, for example, 5, 50, 100, 150, 200, 250, 300, 350, 360, 367, 370 or 375bp of continuous nucleotide sequence, and preferably contains the nucleotide sequence of the coding region; the portion of exon 3 of the endogenous TRBC1 gene of the non-human animal preferably contains at least 5-107bp, for example, 5, 10, 15, 20, 25, 30, 35, 40, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105 or 107bp of continuous nucleotide sequence, and preferably contains the nucleotide sequence of the coding region. In some embodiments, the nucleotide sequence of the corresponding region of endogenous TRBC of non-human animals comprises a nucleotide sequence encoding all or part of the endogenous TRBC2 protein of non-human animals. In some embodiments, the nucleotide sequence of the corresponding region of endogenous TRBC of non-human animals comprises a nucleotide sequence encoding all or part of the extracellular region of the endogenous TRBC2 protein of non-human animals, preferably comprises a nucleotide sequence encoding all or part of the transmembrane region of the endogenous TRBC2 protein of non-human animals.In some embodiments, the nucleotide sequence of the corresponding region of endogenous TRBC in a non-human animal comprises a nucleotide sequence encoding positions 1-145 of SEQ ID NO: 3, positions 3-145 of SEQ ID NO: 3, or positions 1-159 of SEQ ID NO: 3, or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.5% identical to a nucleotide sequence encoding positions 1-145 of SEQ ID NO: 3, positions 3-145 of SEQ ID NO: 3, or positions 1-159 of SEQ ID NO: 3. In some embodiments, the nucleotide sequence of the corresponding region of endogenous TRBC in a non-human animal comprises all or part of an endogenous TRBC2 gene in a non-human animal. In some embodiments, the nucleotide sequence of the corresponding region of endogenous TRBC of a non-human animal includes a portion of exon 1 to a portion of exon 3 of the endogenous TRBC2 gene of the non-human animal, wherein the portion of exon 1 of the endogenous TRBC2 gene of the non-human animal preferably contains at least 5-375bp, for example, 5, 50, 100, 150, 200, 250, 300, 350, 360, 367, 370 or 375bp of continuous nucleotide sequence, and preferably contains the nucleotide sequence of the coding region; the portion of exon 3 of the endogenous TRBC2 gene of the non-human animal preferably contains at least 5-107bp, for example, 5, 10, 15, 20, 25, 30, 35, 40, 44, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105 or 107bp of continuous nucleotide sequence, and preferably contains the nucleotide sequence of the coding region. In some embodiments, the nucleotide sequence of the corresponding region of endogenous TRBC of the non-human animal comprises a portion of exon 1 of the endogenous TRBC1 gene of the non-human animal to at least 5bp of continuous nucleotide sequence downstream of the 3'UTR of the endogenous TRBC2 gene of the non-human animal. In some embodiments, the nucleotide sequence encoding human or chimeric TRBC protein, or, the nucleotide sequence comprising human or chimeric TRBC is operably connected to the endogenous regulatory element of the endogenous TRBC locus. In some embodiments, the regulatory element comprises a promoter, a 5'UTR and / or a 3'UTR. In some embodiments, the endogenous TRBC protein of the non-human animal is not expressed or the expression level is reduced compared with TRBC in wild-type animals. In some embodiments, the modified TRBC gene in the genome of the non-human animal is homozygous or heterozygous for the endogenously replaced locus. In some embodiments, the non-human animal is a mammal, such as a monkey or a rodent. In some embodiments, the rodent comprises a mouse or a rat.In some embodiments, the mRNA transcribed from the modified TRBC1 gene in the genome of the non-human animal comprises SEQ ID NO: 26, or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the mRNA transcribed from the modified TRBC2 gene in the genome of the non-human animal comprises SEQ ID NO: 27, or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence of SEQ ID NO: 27. In some embodiments, the non-human animal further comprises a nucleotide sequence encoding other human or chimeric proteins, and the other human or chimeric proteins preferably include at least one of NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1 or CTLA4.

[0008] In one aspect, the present invention provides a non-human animal or a method for constructing the same, wherein the non-human animal comprises at least one cell comprising a nucleotide sequence encoding a human or humanized TRBC protein. In some embodiments, the non-human animal expresses a human or humanized TRBC protein. In some embodiments, the humanized TRBC protein comprises all or part of a humanized TRBC1 protein. In some embodiments, the humanized TRBC protein comprises all or part of a humanized TRBC2 protein. In some embodiments, the humanized TRBC protein comprises all or part of a humanized TRBC1 protein and all or part of a humanized TRBC2 protein. In some embodiments, the humanized TRBC1 protein is identical to at least 50 to 176 consecutive amino acids of a human TRBC1 protein, such as at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 145, 147, 149, 150, 160, 163, 170, 175, or 176 consecutive amino acids. In some embodiments, the humanized TRBC2 protein is consistent with the continuous amino acid sequence of human TRBC2 protein for at least 50 to 178, for example, at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 142, 144, 147, 149, 150, 160, 163, 170, 175 or 178 consecutive amino acids. In some embodiments, the nucleotide sequence encoding human or humanized TRBC protein is regulated by endogenous regulatory elements. In some embodiments, the regulatory elements include promoters, 5'UTRs and / or 3'UTRs. In some embodiments, the nucleotide sequence encoding human or humanized TRBC protein can be integrated into the non-human animal endogenous locus. In some embodiments, the humanized TRBC protein has at least one activity, such as non-human animal endogenous TRBC activity and / or human TRBC activity.

[0009] In one aspect, the present invention provides a genetically modified non-human animal or a method for constructing the same, wherein in at least one cell of the non-human animal, at the endogenous TRBC locus of the non-human animal, the nucleotide sequence of the endogenous TRBC region of the non-human animal is replaced by a nucleotide sequence comprising the corresponding region of human or chimeric TRBC. In some embodiments, the endogenous TRBC protein of the non-human animal is not expressed or the expression level is reduced compared with TRBC in wild-type animals. In some embodiments, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises all or part of the human TRBC1 gene, and preferably, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises all or part of the human TRBC1 gene and all or part of the human TRBC2 gene. In some embodiments, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises part of exon 1, all of exon 2 and part of exon 3 (preferably also comprising intron 1 and / or intron 2) of human TRBC1 gene, preferably, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises part of exon 1, all of exon 2 and part of exon 3 (preferably also comprising intron 1 and / or intron 2) of human TRBC1 gene and part of exon 1, all of exon 2 and part of exon 3 (preferably also comprising intron 1 and / or intron 2) of human TRBC2 gene. In some embodiments, the amino acid sequence encoded by the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises an amino acid sequence that is identical or has at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to the amino acid sequence shown in SEQ ID NO: 24 and / or SEQ ID NO: 25. In some embodiments, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence shown in SEQ ID NO: 7. In some embodiments, the nucleotide sequence of the endogenous TRBC region of the non-human animal comprises all or part of the endogenous TRBC1 gene of the non-human animal. Preferably, the nucleotide sequence of the endogenous TRBC region of the non-human animal comprises all or part of the endogenous TRBC1 gene of the non-human animal and all or part of the endogenous TRBC2 gene of the non-human animal. In some embodiments, the nucleotide sequence of the endogenous TRBC region of the non-human animal comprises part of exon 1, all of exon 2 and part of exon 3 (preferably also comprising intron 1 and / or intron 2) of the endogenous TRBC1 gene of the non-human animal.In some embodiments, the nucleotide sequence of the non-human animal endogenous TRBC region comprises a portion of exon 1, all of exon 2, and a portion of exon 3 (preferably also comprising intron 1 and / or intron 2) of the non-human animal endogenous TRBC1 gene and a portion of exon 1, all of exon 2, and a portion of exon 3 (preferably also comprising intron 1 and / or intron 2) of the non-human animal endogenous TRBC2 gene. In some embodiments, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC is operably linked to an endogenous regulatory element (e.g., a promoter, 5'UTR, and / or 3'UTR). In some embodiments, the non-human animal is a mammal, such as a monkey or a rodent (mouse or rat).

[0010] In one aspect, the present invention provides a method for constructing a genetically modified non-human animal cell expressing human or chimeric TRBC, the construction method comprising replacing the nucleotide sequence of the endogenous TRBC region of the non-human animal with a nucleotide sequence comprising the corresponding region of human or chimeric TRBC at the endogenous TRBC locus of the non-human animal, thereby producing a genetically modified non-human animal cell. In some embodiments, the non-human animal cell expresses human or chimeric TRBC protein. In some embodiments, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises all or part of the human TRBC1 gene, preferably, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises all or part of the human TRBC1 gene and all or part of the human TRBC2 gene. In some embodiments, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises part of exon 1, all of exon 2 and part of exon 3 (preferably also comprising intron 1 and / or intron 2) of human TRBC1 gene, preferably, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises part of exon 1, all of exon 2 and part of exon 3 (preferably also comprising intron 1 and / or intron 2) of human TRBC1 gene and part of exon 1, all of exon 2 and part of exon 3 (preferably also comprising intron 1 and / or intron 2) of human TRBC2 gene. In some embodiments, the amino acid sequence encoded by the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises an amino acid sequence that is identical or has at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to the amino acid sequence shown in SEQ ID NO: 24 and / or SEQ ID NO: 25. In some embodiments, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence shown in SEQ ID NO: 7. In some embodiments, the nucleotide sequence of the non-human animal endogenous TRBC region comprises all or part of the non-human animal endogenous TRBC1 gene, preferably, the nucleotide sequence of the non-human animal endogenous TRBC region comprises all or part of the non-human animal endogenous TRBC1 gene and all or part of the non-human animal endogenous TRBC2 gene.In some embodiments, the nucleotide sequence of the non-human animal endogenous TRBC region comprises a portion of exon 1, all of exon 2, and a portion of exon 3 (preferably also comprising intron 1 and / or intron 2) of the non-human animal endogenous TRBC1 gene. Preferably, the nucleotide sequence of the non-human animal endogenous TRBC region comprises a portion of exon 1, all of exon 2, and a portion of exon 3 (preferably also comprising intron 1 and / or intron 2) of the non-human animal endogenous TRBC1 gene and a portion of exon 1, all of exon 2, and a portion of exon 3 (preferably also comprising intron 1 and / or intron 2) of the non-human animal endogenous TRBC2 gene. In some embodiments, the nucleotide sequence comprising the corresponding region of human or chimeric TRBC is operably linked to an endogenous regulatory element (e.g., a promoter, 5'UTR, and / or 3'UTR). In some embodiments, the non-human animal is a mouse.

[0011] On the one hand, a method for determining the effectiveness or toxicity of a therapeutic agent in treating a disease is provided, the method comprising: 1) administering a therapeutic agent to the non-human animal or the non-human animal obtained by the construction method; 2) determining the effect of the therapeutic agent on the non-human animal or the disease. In some embodiments, the therapeutic agent comprises an antibody targeting TRBC, a nucleic acid drug targeting TRBC, and / or a polypeptide drug. In some embodiments, the therapeutic agent further comprises an additional therapeutic agent, and the additional therapeutic agent preferably comprises one or more of antibodies against NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1 or CTLA4. In some embodiments, the additional therapeutic agent further preferably comprises one or more of anti-PD-1 antibodies, anti-PD-L1 antibodies or anti-CTLA4 antibodies. In some embodiments, the disease comprises one or more of a tumor, an immune disease or inflammation. In some embodiments, the disease is a tumor. In some embodiments, the tumor comprises a solid tumor or a hematological tumor. In some embodiments, the tumor includes one or more of glioma, leukemia, multiple myeloma, myelodysplastic syndrome, female reproductive system cancer, breast cancer, melanoma, lymphocyte tumor (e.g., T cell tumor and / or B cell tumor), head and neck cancer, liver cancer or lung cancer. In some embodiments, the immune disease includes one or more of systemic lupus erythematosus, atopic dermatitis, psoriasis, asthma, rheumatoid arthritis or multiple sclerosis. In some embodiments, the inflammation includes inflammatory bowel disease (IBD).

[0012] In one aspect, the present invention provides a method for determining the effectiveness of a therapeutic agent in treating cancer (tumor), the method comprising:

[0013] 1) administering a therapeutic agent to the non-human animal or the non-human animal obtained by the construction method, wherein the non-human animal has a tumor; 2) determining the inhibitory effect of the therapeutic agent on the tumor. In some embodiments, the therapeutic agent includes an antibody targeting TRBC, a nucleic acid drug targeting TRBC, and / or a polypeptide drug. In some embodiments, the tumor comprises one or more tumor cells injected into the non-human animal. In some embodiments, the determination of the inhibitory effect of the therapeutic agent on the tumor involves measuring the tumor volume in the non-human animal. In some embodiments, the cancer (tumor) comprises a solid tumor or a hematological tumor. In some embodiments, the cancer (tumor) comprises one or more of glioma, leukemia, multiple myeloma, myelodysplastic syndrome, female reproductive system cancer, breast cancer, melanoma, lymphocyte tumor (e.g., T cell tumor and / or B cell tumor), head and neck cancer, liver cancer, or lung cancer. In some embodiments, the non-human animal further comprises a sequence encoding human or chimeric PD-1, human or chimeric PD-L1, and / or human or chimeric CTLA4. In some embodiments, the tumor comprises one or more tumor cells expressing PD-L1.

[0014] In one aspect, the present invention provides a method for determining the effectiveness of a therapeutic agent in treating an immune disease, the method comprising: 1) administering a therapeutic agent to the non-human animal or the non-human animal obtained by the construction method, wherein the non-human animal suffers from an immune disease; 2) determining the therapeutic effect of the therapeutic agent on the immune disease. In some embodiments, the therapeutic agent comprises an antibody targeting TRBC, a nucleic acid drug targeting TRBC, and / or a polypeptide drug. In some embodiments, the immune disease comprises one or more of systemic lupus erythematosus, atopic dermatitis, psoriasis, asthma, rheumatoid arthritis, or multiple sclerosis.

[0015] In one aspect, the present invention provides a method for determining the effectiveness of a therapeutic agent in treating inflammation, the method comprising: 1) administering a therapeutic agent to the non-human animal or the non-human animal obtained by the construction method, wherein the non-human animal has inflammation; 2) determining the effectiveness of the therapeutic agent in treating inflammation. In some embodiments, the therapeutic agent comprises an antibody targeting TRBC, a nucleic acid drug targeting TRBC, and / or a polypeptide drug. In some embodiments, the inflammation comprises inflammatory bowel disease (IBD).

[0016] In one aspect, the present invention provides a method for determining the toxicity of a therapeutic agent, the method comprising: 1) administering a therapeutic agent to the non-human animal; 2) determining the effect of the therapeutic agent on the non-human animal. In some embodiments, the therapeutic agent comprises an antibody targeting TRBC, a nucleic acid drug targeting TRBC, and / or a polypeptide drug. In some embodiments, determining the effect of the therapeutic agent on the non-human animal involves measuring the weight of the non-human animal or performing a blood test. In some embodiments, the blood test includes, but is not limited to, red blood cell count, hematocrit, and / or hemoglobin content.

[0017] In one aspect, the present invention provides a humanized TRBC protein, wherein the humanized TRBC protein comprises all or part of a human TRBC1 protein. In some embodiments, the humanized TRBC protein comprises all or part of an extracellular region of a human TRBC1 protein. In some embodiments, the humanized TRBC protein comprises a humanized TRBC1 protein. In some embodiments, the amino acid sequence of the humanized TRBC1 protein comprises SEQ ID NO: 24, or comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to the amino acid sequence shown in SEQ ID NO: 24. In some embodiments, the humanized TRBC protein comprises all or part of a human TRBC2 protein. In some embodiments, the humanized TRBC protein comprises all or part of an extracellular region of a human TRBC2 protein. In some embodiments, the humanized TRBC protein comprises a humanized TRBC2 protein. In some embodiments, the amino acid sequence of the humanized TRBC2 protein comprises SEQ ID NO: 25, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the amino acid sequence shown in SEQ ID NO: 25.

[0018] In one aspect, a humanized TRBC1 protein is provided, the humanized TRBC1 protein comprising all or part of a human TRBC1 protein. In some embodiments, the humanized TRBC1 protein comprises all or part of an extracellular region of a human TRBC1 protein. In some embodiments, the humanized TRBC1 protein comprises an amino acid sequence as shown in SEQ ID NO: 2, 3-149 of SEQ ID NO: 2, 1-149 of SEQ ID NO: 2, or 1-163 of SEQ ID NO: 2; or comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity with an amino acid sequence as shown in SEQ ID NO: 2, 3-149 of SEQ ID NO: 2, 1-149 of SEQ ID NO: 2, or 1-163 of SEQ ID NO: 2. In some embodiments, the humanized TRBC1 protein further comprises all or part of an endogenous TRBC1 protein of a non-human animal. In some embodiments, the humanized TRBC1 protein comprises SEQ ID NO: 1, 1-2 and 146-172 of SEQ ID NO: 1, 146-172 of SEQ ID NO: 1, or 160-172 of SEQ ID NO: 1; or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the amino acid sequence of SEQ ID NO: 1, 1-2 and 146-172 of SEQ ID NO: 1, or 146-172 of SEQ ID NO: 1, or 160-172 of SEQ ID NO: 1. In some embodiments, the amino acid sequence of the humanized TRBC1 protein comprises SEQ ID NO: 24, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the amino acid sequence of SEQ ID NO: 24.

[0019] In one aspect, a humanized TRBC2 protein is provided, the humanized TRBC2 protein comprising all or part of a human TRBC2 protein. In some embodiments, the humanized TRBC2 protein comprises all or part of the extracellular region of a human TRBC2 protein. In some embodiments, the humanized TRBC2 protein comprises the amino acid sequence shown in SEQ ID NO: 4, 3-144 of SEQ ID NO: 4, 1-149 of SEQ ID NO: 4, or 1-163 of SEQ ID NO: 4; or comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity with the amino acid sequence shown in SEQ ID NO: 4, 3-144 of SEQ ID NO: 4, 1-149 of SEQ ID NO: 4, or 1-163 of SEQ ID NO: 4. In some embodiments, the humanized TRBC2 protein further comprises all or part of an endogenous TRBC2 protein of a non-human animal. In some embodiments, the humanized TRBC2 protein comprises SEQ ID NO: 3, positions 1-2 and 146-172 of SEQ ID NO: 3, positions 146-172 of SEQ ID NO: 3, or positions 160-172 of SEQ ID NO: 3; or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.5% identical to the amino acid sequence of SEQ ID NO: 3, positions 1-2 and 146-172 of SEQ ID NO: 3, positions 146-172 of SEQ ID NO: 3, or positions 160-172 of SEQ ID NO: 3. In some embodiments, the amino acid sequence of the humanized TRBC2 protein comprises SEQ ID NO: 25, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.5% identical to the amino acid sequence of SEQ ID NO: 25.

[0020] In one aspect, the present invention provides a humanized TRBC gene, which encodes the humanized TRBC protein. In some embodiments, the humanized TRBC gene comprises a portion of exon 1 to a portion of exon 3 of the human TRBC1 gene, wherein the portion of exon 1 of the human TRBC1 gene preferably comprises at least 5 bp of continuous nucleotide sequence; the portion of exon 3 of the human TRBC1 gene preferably comprises at least 5 bp of continuous nucleotide sequence. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises the nucleotide sequence at positions 142791702-142792735 of NCBI accession number NC_000007.14; or comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity with the nucleotide sequence at positions 142791702-142792735 of NCBI accession number NC_000007.14. In some embodiments, the humanized TRBC gene comprises a portion of exon 1 to a portion of exon 3 of a human TRBC2 gene, wherein the portion of exon 1 of a human TRBC2 gene preferably comprises at least 5 bp of continuous nucleotide sequence; the portion of exon 3 of a human TRBC2 gene preferably comprises at least 5 bp of continuous nucleotide sequence. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC comprises the nucleotide sequence 142801049-142802133 of NCBI accession number NC_000007.14 or a variant thereof; or comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to the nucleotide sequence 142801049-142802133 of NCBI accession number NC_000007.14 or a variant thereof. In some embodiments, the variant includes a mutation from G to A at position 142801129, a mutation from T to C at position 142802045, and a mutation from A to G at position 142802078. In some embodiments, the humanized TRBC gene further comprises an endogenous TRBD2 gene and / or TRBJ gene (preferably comprising TRBJ2-1, TRBJ2-2, TRBJ2-3, TRBJ2-4, TRBJ2-5, TRBJ2-6, and TRBJ2-7 genes) of a non-human animal. In some embodiments, the humanized TRBC gene further comprises a portion of exon 3 of an endogenous TRBC1 gene of a non-human animal to a portion of exon 1 of an endogenous TRBC2 gene of a non-human animal.In some embodiments, the nucleotide sequence comprising human or chimeric TRBC further comprises the nucleotide sequence at positions 41516207-41523671 of NCBI accession number NC_000072.7; or comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity with the nucleotide sequence at positions 41516207-41523671 of NCBI accession number NC_000072.7. In some embodiments, the humanized TRBC gene further comprises a portion of exon 3 to all of exon 4 of an endogenous TRBC2 gene of a non-human animal. In some embodiments, the humanized TRBC gene further comprises a nucleotide sequence from a portion of exon 3 to the stop codon of an endogenous TRBC2 gene of a non-human animal, preferably further comprises a 3'UTR, and further preferably further comprises at least 5 bp of continuous nucleotide sequence downstream of the 3'UTR. In some embodiments, the humanized TRBC gene further comprises a portion of exon 3 of the endogenous TRBC2 gene of a non-human animal to at least 5 bp of continuous nucleotide sequence downstream of the 3'UTR. In some embodiments, the nucleotide sequence comprising human or chimeric TRBC further comprises the nucleotide sequence at positions 41524735-41525760 of NCBI accession number NC_000072.7; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence at positions 41524735-41525760 of NCBI accession number NC_000072.7. In some embodiments, the humanized TRBC gene comprises, from the 5' end to the 3' end, a portion of exon 1 of the endogenous TRBC1 gene of a non-human animal, a portion of exon 1 to a portion of exon 3 of the human TRBC1 gene, a portion of exon 3 of the endogenous TRBC1 gene of a non-human animal to a portion of exon 1 of the endogenous TRBC2 gene of a non-human animal, a portion of exon 1 to a portion of exon 3 of the human TRBC2 gene, and a portion of exon 3 of the endogenous TRBC2 gene of a non-human animal to at least 5 bp of continuous nucleotide sequence downstream of the 3'UTR. In some embodiments, the humanized TRBC gene comprises SEQ ID NOs: 5, 6,.

[0021] 7, 8, 9, 10, 11, 26, 27, 28, 29, 30, the nucleotide sequence of positions 142791702-142792735 of NCBI accession number NC_000007.14, the nucleotide sequence of positions 41516207-41523671 of NCBI accession number NC_000072.7, the nucleotide sequence of positions 142801049-142802133 of NCBI accession number NC_000007.14 or a variant thereof, or the nucleotide sequence of positions 41524735-41525760 of NCBI accession number NC_000072.7; or comprising the nucleotide sequence of SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 26, 27, 28, 29, 30, the nucleotide sequence of positions 142791702-142792735 of NCBI Accession No. NC_000007.14, the nucleotide sequence of positions 41516207-41523671 of NCBI Accession No. NC_000072.7, the nucleotide sequence of positions 142801049-142802133 of NCBI Accession No. NC_000007.14 or its variants, or the nucleotide sequence of positions 41524735-41525760 of NCBI Accession No. NC_000072.7, the nucleotide sequence of which is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical. In some embodiments, the variant comprises a mutation from G to A at position 142801129, a mutation from T to C at position 142802045, and a mutation from A to G at position 142802078.

[0022] In one aspect, the present invention provides a humanized TRBC1 gene, which encodes the humanized TRBC1 protein. In some embodiments, the humanized TRBC1 gene comprises a portion of exon 1 to a portion of exon 3 of the human TRBC1 gene, wherein the portion of exon 1 of the human TRBC1 gene preferably comprises at least 5bp of continuous nucleotide sequence; the portion of exon 3 of the human TRBC1 gene preferably comprises at least 5bp of continuous nucleotide sequence. In some embodiments, the humanized TRBC1 gene further comprises a portion of exon 1, a portion of exon 3 to all of exon 4 of an endogenous TRBC1 gene of a non-human animal. In some embodiments, the humanized TRBC1 gene further comprises a portion of exon 1, a portion of exon 3 to a nucleotide sequence to a stop codon of an endogenous TRBC1 gene of a non-human animal, preferably further comprises a 3'UTR, and further preferably further comprises a nucleotide sequence downstream of the 3'UTR. In some embodiments, the portion of exon 1 of an endogenous TRBC1 gene of a non-human animal preferably comprises at least 5bp of continuous nucleotide sequence, and the portion of exon 3 of an endogenous TRBC1 gene of a non-human animal preferably comprises at least 5bp of continuous nucleotide sequence. In some embodiments, the mRNA transcribed from the humanized TRBC1 gene comprises the nucleotide sequence shown in SEQ ID NO: 26; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence shown in SEQ ID NO: 26.

[0023] On the one hand, a humanized TRBC2 gene is provided, and the humanized TRBC2 gene encodes the humanized TRBC2 protein. In some embodiments, the humanized TRBC2 gene comprises a portion of exon 1 to a portion of exon 3 of the human TRBC2 gene, wherein the portion of exon 1 of the human TRBC2 gene preferably comprises at least 5bp of continuous nucleotide sequence; the portion of exon 3 of the human TRBC2 gene preferably comprises at least 5bp of continuous nucleotide sequence. In some embodiments, the humanized TRBC2 gene further comprises a portion of exon 1, a portion of exon 3 to all of exon 4 of an endogenous TRBC2 gene of a non-human animal. In some embodiments, the humanized TRBC2 gene further comprises a portion of exon 1, a portion of exon 3 to a nucleotide sequence to a stop codon of an endogenous TRBC2 gene of a non-human animal, preferably further comprises a 3'UTR, and further preferably further comprises a nucleotide sequence downstream of a 3'UTR. In some embodiments, the portion of exon 1 of an endogenous TRBC2 gene of a non-human animal preferably comprises at least 5bp of continuous nucleotide sequence; the portion of exon 3 of an endogenous TRBC2 gene of a non-human animal preferably comprises at least 5bp of continuous nucleotide sequence. In some embodiments, the mRNA transcribed from the humanized TRBC2 gene comprises the nucleotide sequence shown in SEQ ID NO: 27; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence shown in SEQ ID NO: 27.

[0024] In one aspect, the present invention provides a cell, tissue or organ, which expresses the humanized TRBC protein, the humanized TRBC1 protein and / or the humanized TRBC2 protein, and / or the genome of the cell, tissue or organ contains the humanized TRBC gene, the humanized TRBC1 gene and / or the humanized TRBC2 gene.

[0025] In one aspect, the present invention provides an animal model, wherein the animal model expresses the humanized TRBC protein, the humanized TRBC1 protein and / or the humanized TRBC2 protein, and / or the genome of the animal model comprises the humanized TRBC gene, the humanized TRBC1 gene and / or the humanized TRBC2 gene.

[0026] On the one hand, a part of the non-human animal, the non-human animal obtained by the construction method, the humanized TRBC protein, the humanized TRBC1 protein, the humanized TRBC2 protein, the humanized TRBC gene, the humanized TRBC1 gene, the humanized TRBC2 gene, the cells, tissues or organs or the animal model is provided, and the applications include: A) application in the development of products involving TRBC-related immune processes in human cells; B) application in a model system related to TRBC for pharmacology, immunology, microbiology and medical research; C) application in the production and use of animal experimental disease models for pathological research related to TRBC and / or for the development of diagnostic strategies and / or for the development of treatment strategies; D) application in the screening, efficacy testing, efficacy evaluation, verification or evaluation of human TRBC signaling pathway regulators in vivo; or, E) application in studying TRBC gene function, studying drugs and efficacy targeting human TRBC target sites, and studying tumor treatment drugs related to TRBC (preferably also including application in studying therapeutic drugs for inflammatory or immune diseases related to TRBC).

[0027] The term "all or part" in the present invention, "all" refers to the whole, and "part" refers to a part of the whole, or an individual part that constitutes the whole.

[0028] The term "TRBC gene" of the present invention includes one or more subtypes of the TRBC gene. For example, in the present application, the TRBC gene includes the TRBC1 gene, and preferably also includes the TRBC2 gene.

[0029] The term "TRBC protein" of the present invention includes one or more subtypes of TRBC protein. For example, in the present application, the TRBC protein includes TRBC1 protein, and preferably also includes TRBC2 protein.

[0030] The term "locus" in the present invention refers to the position of a gene on a chromosome in a broad sense, and refers to a DNA fragment on a gene in a narrow sense, which can be a gene or a part or regulatory region of a gene, or can include all or part of one or more genes on the same gene cluster. For example, the "TRBC locus" described in the present application includes a DNA fragment randomly selected from exons 1-4 of the TRBC1 gene, and can also include a DNA fragment randomly selected from exons 1-4 of the TRBC2 gene, and of course can also include gene fragments between the TRBC1 gene and the TRBC2 gene, such as all or part of the TRBD2 gene, and / or all or part of the TRBJ gene.

[0031] The term "portion of exon XX" in the present invention means that the continuous or intermittent several, dozens or hundreds of nucleotides are consistent with the entire exon nucleotide sequence or consistent with the coding region nucleotide sequence of the exon. For example, the portion of exon 1 of the human TRBC1 gene preferably contains at least 5-387bp, such as 5, 10, 50, 100, 150, 200, 250, 300, 350, 379, 380, 385 or 387bp of continuous nucleotide sequence, preferably including the nucleotide sequence of the coding region.

[0032] The term "exon XX to exon XXX" or "exon XX-XXX" or "all of exons XX-XXX" or "all of exon XX to all of exon XXX" in the present invention refers to the entire nucleotide sequence from one exon to another exon and the introns therebetween, for example, exons 1-4 of the TRBC1 gene include the nucleotide sequence of all exon 1, all intron 1, all exon 2, all intron 2, all exon 3, all intron 3 and the entire exon 4.

[0033] The term "part of exon XX to part of exon XXX" in the present invention refers to the nucleotide sequence from all or part of one exon to part of another exon and the introns therebetween, for example, part of exon 1 to part of exon 3 includes the nucleotide sequence of part of exon 1, all of intron 1, all of exon 2, all of intron 2 and part of exon 3.

[0034] The term "intron xx" in the present invention refers to an intron between two exons, for example, intron 1 refers to an intron between exon 1 and exon 2.

[0035] The term "include" or "comprising" in the present invention is an open-ended writing method, which contains the specified components or steps described, as well as other specified components or steps that will not be substantially affected. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the same or similar activity as the original sequence.

[0036] The term "and / or" of the present invention includes all combinations of items connected by the term, and each combination should be deemed to have been listed separately in the present application, for example, "A and / or B" includes "A", "B" and "A and B". For another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C" and "A and B and C".

[0037] In order to determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are compared for the purpose of optimal comparison (e.g., for optimal comparison, gaps can be introduced in one or both of the first and second amino acid or nucleic acid sequences, and non-homologous sequences can be ignored for the purpose of comparison). The amino acid residues or nucleotides on the corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, which needs to be introduced to achieve the optimal comparison of the two sequences, taking into account the number of gaps and the length of each gap. For example, the comparison of the sequences and the determination of the percent identity between the two sequences can be completed using the Blossum 62 scoring matrix with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5.

[0038] The percentage (homology percentage) of conservative residues with similar physicochemical properties, such as leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues with similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine and isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). In many cases, the homology percentage is higher than the identity percentage.

[0039] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as those commonly understood by those of ordinary skill in the art to which the invention belongs. This application describes methods and materials for use in the present invention; other suitable methods and materials known in the art may be used. The materials, methods, and examples are exemplary and non-limiting only. All publications, patent applications, patents, sequences, database entries, and other references mentioned in this application are incorporated by reference in their entirety. In the event of a conflict, the present specification (including definitions) shall prevail.

[0040] Those skilled in the art can easily discern other aspects and advantages of the present application from the following detailed description.

[0041] Carrier

[0042] The present invention provides a targeting vector, comprising: a) a DNA fragment homologous to the 5' end of the conversion region to be changed (5' arm or 5' homologous arm), which is selected from the genomic DNA of the TRBC1 gene and has a length of 100-10000 nucleotides; b) a donor region; and c) a DNA fragment homologous to the 3' end of the conversion region to be changed (3' arm or 3' homologous arm), which is selected from the genomic DNA of the TRBC2 gene and has a length of 100-10000 nucleotides.

[0043] In some embodiments, a) the DNA fragment homologous to the 5' end of the switch region to be altered is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000072.7; c) the DNA fragment homologous to the 3' end of the switch region to be altered is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000072.7.

[0044] In some embodiments, a) a DNA fragment homologous to the 5' end of the switch region to be altered is selected from the nucleotide sequence 41511487 to 41515159 of NCBI Accession No. NC_000072.7; c) a DNA fragment homologous to the 3' end of the switch region to be altered is selected from the nucleotide sequence 41525761 to 41529797 of NCBI Accession No. NC_000072.7.

[0045] In some embodiments, the length of the genomic nucleotide sequence selected for the targeting vector can exceed 0.8 kb, 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 15 kb, 16 kb, 17 kb, 18 kb, 19 kb or 20 kb.

[0046] In some embodiments, the switch region to be changed is located on the endogenous TRBC locus of the non-human animal, preferably on the nucleotide sequence downstream of exon 1 of the endogenous TRBC1 of the non-human animal to the 3'UTR of the endogenous TRBC2 of the non-human animal.

[0047] In some embodiments, the 5' arm comprises SEQ ID NO: 5. In some embodiments, the 3' arm comprises SEQ ID NO: 6.

[0048] In some embodiments, the b) donor region comprises a human sequence or a chimeric sequence of a human / non-human animal.

[0049] In some embodiments, the b) donor region comprises SEQ ID NO:7.

[0050] In some embodiments, the targeting vector comprises one or more marker genes (or resistance genes), for example, a resistance gene for positive clone screening or a coding gene for a negative screening marker. In some embodiments, the resistance gene for positive clone screening is a neomycin phosphotransferase coding sequence Neo, and preferably, the targeting vector also includes two Frt recombination sites arranged in the same direction on both sides of the marker gene. In some embodiments, the coding gene for the negative screening marker is a coding gene for the diphtheria toxin A subunit (DTA).

[0051] The present invention also provides a vector for constructing a humanized animal model or a knockout model. In some embodiments, the vector comprises an sgRNA sequence, wherein the sgRNA sequence targets the TRBC locus. In some embodiments, the target site of the sgRNA on the switch region to be changed is unique and satisfies the sequence arrangement rule of 5'-NNN(20)-NGG3' or 5'-CCN-N(20)-3'.

[0052] In some embodiments, the present invention relates to a plasmid construct comprising an sgRNA (an sgRNA vector, such as pT7-sgRNA) and / or a cell comprising the construct.

[0053] In some embodiments, the present invention also relates to a cell comprising a targeting vector and / or an sgRNA vector as described above.

[0054] In some embodiments, the present invention further provides a non-human mammalian cell having any of the above-mentioned vectors and one or more in vitro transcripts of the plasmid constructs described in the present application. In some embodiments, the non-human mammalian cell comprises Cas9 mRNA or its in vitro transcript.

[0055] In some embodiments, the gene in the non-human mammal cell is heterozygous. In some embodiments, the gene in the non-human mammal cell is homozygous.

[0056] In some embodiments, the non-human mammal cell is a mouse cell. In some embodiments, the non-human mammal cell is a fertilized egg cell. In some embodiments, the non-human mammal cell is an embryonic stem cell. In some embodiments, the non-human mammal cell is any cell capable of expressing TRBC1 protein and / or TRBC2 protein.

[0057] Genetically modified non-human animals

[0058] The "genetically modified non-human animal" or "genetically modified non-human animal" described in the present invention refers to a non-human animal in which at least one chromosome in the genome of the non-human animal has exogenous DNA. In some embodiments, at least one or more cells, for example, at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40% or 50% of the cells in the genetically modified non-human animal or genetically modified non-human animal have exogenous DNA. Cells with exogenous DNA can be various cells, for example, somatic cells, immune cells (including T cells, B cells, NK cells, antigen presenting cells, macrophages, dendritic cells), germ cells, blastocysts or tumor cells. In some embodiments, a genetically modified non-human animal is provided, the non-human animal comprising a modified endogenous locus, comprising an exogenous sequence (e.g., a human sequence), for example, replacing one or more endogenous sequences of the non-human animal with a human sequence, or a chimeric sequence endogenous to a human / non-human animal, or inserting one or more chimeric sequences endogenous to a human and / or non-human animal. Non-human animals are often able to pass genetic modifications to their offspring through germline transmission.

[0059] The "chimeric (X) gene" or "chimeric (X) nucleic acid" of the present invention refers to a gene or a nucleic acid. In some embodiments, two or more parts of the gene or nucleic acid are from different species, or at least one sequence of the gene or nucleic acid is different from the nucleic acid in a wild-type animal. In some embodiments, at least a portion of the sequence of a chimeric (X) gene or a chimeric (X) nucleic acid has two or more different sources, for example, sequences encoding different proteins or sequences encoding the same (or homologous) proteins of two or more different species. In some embodiments, a chimeric (X) gene or a chimeric (X) nucleic acid refers to a humanized (X) gene or a humanized (X) nucleic acid.

[0060] The "chimeric (X) protein" or "chimeric (X) polypeptide" of the present invention refers to a protein or polypeptide. In some embodiments, two or more parts of the polypeptide or protein are from different species, or at least one sequence of the protein or polypeptide is different from the amino acid sequence in a wild-type animal. In some embodiments, at least a portion of the sequence of a chimeric (X) protein or chimeric (X) polypeptide has two or more different sources, for example, the same (or homologous) protein of different species. In some embodiments, a chimeric (X) protein or chimeric (X) polypeptide refers to a humanized (X) protein or humanized (X) polypeptide.

[0061] The "humanized (X) protein" or "humanized (X) polypeptide" of the present invention refers to a protein or polypeptide. In some embodiments, at least a portion of the protein or polypeptide is derived from a human (X) protein or a human (X) polypeptide. In some embodiments, at least a portion of the protein or polypeptide is derived from a non-human animal (X) protein or a non-human animal (X) polypeptide. In some embodiments, a humanized (X) protein or a humanized (X) polypeptide refers to a human (X) protein or (X) polypeptide.

[0062] The "humanized (X) nucleic acid" and "humanized (X) gene" of the present invention refer to nucleic acids or genes. In some embodiments, at least a portion of the nucleic acid or gene is derived from a human (X) gene or a human (X) nucleic acid. In some embodiments, at least a portion of the nucleic acid or gene is derived from a non-human animal (X) gene or a non-human animal (X) nucleic acid. In some embodiments, the nucleic acids or genes in the humanized (X) nucleic acid or humanized (X) gene are all derived from a human (X) gene or a human (X) nucleic acid. In some embodiments, the humanized (X) nucleic acid or humanized (X) gene refers to a humanized exon, and the humanized exon may be a human exon or a chimeric exon.

[0063] In some embodiments, the chimeric TRBC gene or chimeric TRBC nucleic acid is a humanized TRBC gene or humanized TRBC nucleic acid (including a humanized TRBC1 gene or humanized TRBC1 nucleic acid, and / or, a humanized TRBC2 gene or humanized TRBC2 nucleic acid). In some embodiments, at least a portion of the humanized TRBC gene or humanized TRBC nucleic acid is derived from a human TRBC gene. In some embodiments, at least a portion of the humanized TRBC gene or humanized TRBC nucleic acid is derived from a non-human animal TRBC gene. In some embodiments, the humanized TRBC gene or humanized TRBC nucleic acid comprises a sequence encoding a TRBC protein. The encoded TRBC protein has at least one activity, such as the activity of a human TRBC protein and / or an endogenous TRBC protein of a non-human animal.

[0064] In some embodiments, the chimeric TRBC protein or chimeric TRBC polypeptide is a humanized TRBC protein or humanized TRBC polypeptide (including a humanized TRBC1 protein or humanized TRBC1 polypeptide, and / or, a humanized TRBC2 protein or humanized TRBC2 polypeptide). In some embodiments, at least one or more parts of the amino acid sequence of the humanized TRBC protein or humanized TRBC polypeptide are from human TRBC protein. In some embodiments, at least one or more parts of the humanized TRBC protein or humanized TRBC polypeptide are from non-human animal TRBC protein. In some embodiments, the humanized TRBC protein or humanized TRBC polypeptide is functional, or has at least one activity, such as the activity of human TRBC protein and / or non-human animal endogenous TRBC protein.

[0065] The non-human animal of genetic modification can be various non-human animals, for example, mice, rats, rabbits, pigs, cattle (for example, cattle, bulls, buffaloes), deer, sheep, goats, chickens, cats, dogs, ferrets, primates (for example, marmosets, rhesus monkeys). For the non-human animals that are not easy to obtain suitable genetically modified embryonic stem cells (ES), alternative methods are used to construct the non-human animals comprising genetic modification. Such methods include, for example, modifying non-ES cell genomes (for example, fibroblasts or induced pluripotent stem cells) and using nuclear transplantation to transfer the modified genome to suitable cells, such as oocytes, and incubating modified cells (for example, modified oocytes) in non-human animals under appropriate conditions to form embryos. The above-mentioned construction method is known in the art, and is described in "A.Nagy, et al., "Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition), " Cold Spring Harbor Laboratory Press, 2006 ", the entire contents of which are incorporated herein by reference.

[0066] In one aspect, the non-human animal is a mammal. In some embodiments, the genetically modified non-human animal is a rodent. In some embodiments, the rodent may be selected from mice, rats and hamsters. In one embodiment, the rodent is selected from the family Muridae. In one embodiment, the genetically modified non-human animal is from a family selected from the family Cricetidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamsters, New World rats and mice, voles), Muroidea (mice and rats, gerbils, spiny mice, crested rats), Isla Muscidae (climbing mice, rock mice, tailed rats, Madagascar rats and mice), Spiny Dormouse (e.g., spiny dormouse) and Muridae (e.g., mole rats, bamboo rats and zokors). In a specific embodiment, the genetically modified rodent is selected from mice or rats (Muroidea), gerbils, spiny mice and crested rats. In one embodiment, the genetically modified mouse is from a member of the Muridae family. In one embodiment, the non-human animal is a rodent. In a specific embodiment, the rodent is selected from mice and rats. In one embodiment, the non-human animal is a mouse.

[0067] In some embodiments, the non-human animal can be an immunodeficient non-human mammal. For example, an immunodeficient rodent, an immunodeficient rabbit, an immunodeficient pig, an immunodeficient monkey, etc. In some embodiments, the animal is a mouse of the C57BL strain, and the C57BL strain is selected from C57BL / a, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 10, C57BL10ScSn, C57BL / 10Cr and C57BL / Ola. In some embodiments, the mouse is a 129 strain selected from 129 / J, 129 / ReJ, 129 / OlaHsd, 129 / Sv, 129 / SvJ, 129 / Re, 129 / RrJ, 129 / Sv-ter / +. These mice are described in, for example, Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999); Auerbach et al., Establishment and Chimera Analysis of 129 / SvEv-and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines (2000), the relevant contents of which are incorporated herein by reference in their entirety. In some embodiments, the genetically modified mouse is a hybrid of the 129 strain and the C57BL / 6 strain. In some embodiments, the mouse is a hybrid of the 129 strain, or a hybrid of the C57BL / 6 strain. In some embodiments, the mouse is a BALB strain, such as a BALB / c strain. In some embodiments, the mouse is a hybrid of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50% BALB / c-50% 12954 / Sv; or 50% C57BL / 6-50% 129). In certain embodiments, non-human animals are rodents. In certain embodiments, non-human animals are mice with BALB / c, BALB / cHeAn, BALB / cJ, BALB / cR1, BALB / cWt, C57BL / 10, C57BL / 10ScSn, C57BL (C57BL / 10Cr and C57BL / Ola), C58, CBA / Br, CBA / Ca, CBA / J, CBA / st or CBA / H strains. In certain embodiments, non-human animals are rats. Rats can be selected from Wistar rats, LEA strains, Sprague-Dawley strains, Fischer strains, F344, F6 and Dark Agouti.In certain embodiments, the rat strain is a hybrid species of two or more strains selected from Wistar, LEA, Sprague-Dawley, Fischer, F344, F6 and Dark Agouti. Non-human animals may have one or more other genetic modifications and / or other modifications suitable for the specific purpose of preparing humanized animals. For example, suitable mice for maintaining xenografts (e.g., human cancers or tumors) may have one or more modifications that damage, inactivate or destroy all or part of the immune system of non-human animals. Damage, inactivation or destruction of the immune system of non-human animals may include, for example, by chemical means (e.g., administration of toxins), physical means (e.g., irradiation of animals), and / or genetic modification (e.g., knocking out one or more genes). Non-limiting examples of such mice include, for example, NOD mice, SCID mice, NOD / SCID mice, IL2Rγ knockout mice, NOD / SCID / γc. null Mice (Ito, M. et al., NOD / SCID / γc null mouse:an excellent recipient mouse model for engraftment of human cells, Blood 100(9):3175-3182, 2002), nude mice, and Rag1 and / or Rag2 knockout mice. These mice can be optionally irradiated or otherwise treated to destroy one or more immune cell types. Therefore, in various embodiments, a genetically modified mouse is provided, which can include humanization of at least a portion of the endogenous TRBC locus of a non-human animal, and also includes damage, inactivation or partial destruction of the immune system (or one or more cell types of the immune system) of a non-human animal. In some embodiments, the mouse modification type is selected from NOD mice, SCID mice, NOD / SCID mice, IL-2Rγ knockout mice, NOD / SCID / γc null Mice, nude mice, Rag1 and / or Rag2 knockout mice, NOD Prkdc scid IL-2Rγ null Mouse, NOD Rag1 - / - IL - / - (NRG) mouse, Rag2 - / - IL - / -(RG) mice and modifications of combinations thereof. These transgenic animals are described, for example, in US10820580B2, which is incorporated herein by reference in its entirety. In some embodiments, the mouse may include replacing all or part of the mouse endogenous mature TRBC1 coding sequence and all or part of the mouse endogenous mature TRBC2 coding sequence with all or part of the human mature TRBC1 coding sequence and all or part of the human mature TRBC2 coding sequence.

[0068] In some embodiments, the genetically modified non-human animal includes modification of an endogenous TRBC gene site (locus) of the non-human animal. In some embodiments, the modification comprises a nucleotide sequence encoding at least a portion of a mature TRBC1 protein and / or a mature TRBC2 protein (e.g., comprising a nucleotide sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to or identical to a nucleotide sequence encoding all or part of a mature TRBC1 protein and / or all or part of a mature TRBC2 protein). Although cells (e.g., ES cells, somatic cells) that may comprise the genetic modification are provided in the present invention.

[0069] In some embodiments, the genetically modified non-human animal can express human TRBC protein and / or chimeric (e.g., humanized) TRBC protein at the endogenous TRBC locus of the non-human animal. In some embodiments, the nucleotide sequence encoding the endogenous TRBC region in the genome of the non-human animal is replaced (replaced) or inserted by a nucleotide sequence comprising all or part of the human TRBC gene, a nucleotide sequence encoding the corresponding region of human TRBC, or a nucleotide sequence having at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97% or 99.5% identity with the human TRBC sequence. In some embodiments, the endogenous TRBC locus of the non-human animal is modified by a nucleic acid sequence comprising all or part of the nucleic acid sequence encoding the mature human TRBC protein. In some embodiments, the TRBC protein includes TRBC1 protein and / or TRBC2 protein.

[0070] In some embodiments, genetically modified non-human animals can express human TRBC and / or chimeric TRBC (e.g., humanized TRBC) under the control of endogenous or exogenous regulatory elements. Insertion or replacement at the endogenous locus of non-human animals provides non-human animals that express human TRBC and / or chimeric TRBC (e.g., humanized TRBC) in suitable cells and in a manner that does not cause potential pathology observed in some other transgenic mice known in the art. Human TRBC or chimeric TRBC (e.g., humanized TRBC) expressed in non-human animals can maintain one or more functions of wild-type non-human animal TRBC or human TRBC in non-human animals. In addition, in some embodiments, non-human animals do not express endogenous TRBC. In some embodiments, compared with the TRBC expression level in wild-type non-human animals, the endogenous TRBC expression level of non-human animals is reduced. The term "endogenous TRBC" of the present invention refers to a TRBC protein expressed by an endogenous TRBC nucleotide sequence of a non-human animal (e.g., mouse) before any genetic modification.

[0071] In some embodiments, the genetically modified non-human animal may have one or more cells expressing human or chimeric TRBC (e.g., humanized TRBC) proteins. In some embodiments, the humanized TRBC protein comprises a humanized TRBC1 protein, and preferably further comprises a humanized TRBC2 protein. In some embodiments, the humanized TRBC1 protein comprises a cytoplasmic region, a transmembrane region, and a cytoplasmic region (preferably comprising or not comprising a signal peptide), the extracellular region is endogenous to the non-human animal or human or humanized, the transmembrane region is endogenous to the non-human animal or humanized, and the cytoplasmic region is endogenous to the non-human animal. In some embodiments, the humanized TRBC2 comprises an extracellular region, a transmembrane region, and a cytoplasmic region (preferably comprising or not comprising a signal peptide), the extracellular region is endogenous to the non-human animal or human or humanized, the transmembrane region is endogenous to the non-human animal or humanized, and the cytoplasmic region is endogenous to the non-human animal. In some embodiments, the sequence of human TRBC1 and non-human animal endogenous TRBC1 (e.g., mouse endogenous TRBC1), and / or the sequence of human TRBC2 and non-human animal endogenous TRBC2 (e.g., mouse endogenous TRBC2) are different, so antibodies that can bind to human TRBC1 and / or TRBC2 may not necessarily have the same affinity or effect as endogenous TRBC1 and / or TRBC2 of non-human animals. Therefore, genetically modified non-human animals with human or humanized extracellular regions (preferably also with humanized transmembrane regions) can better evaluate the effects of therapeutic agents targeting human TRBC in animal models.

[0072] In some embodiments, the humanized TRBC locus comprises the 5'UTR of the human TRBC1 gene. In some embodiments, the humanized TRBC locus comprises the 5'UTR of the non-human animal endogenous (e.g., mouse endogenous) TRBC1 gene. In some embodiments, the humanized TRBC locus comprises the 3'UTR of the human TRBC1 gene. In some embodiments, the humanized TRBC locus comprises the 3'UTR of the non-human animal endogenous (e.g., mouse endogenous) TRBC1 gene. In some embodiments, the humanized TRBC locus comprises the 5'UTR of the human TRBC2 gene. In some embodiments, the humanized TRBC locus comprises the 5'UTR of the non-human animal endogenous (e.g., mouse endogenous) TRBC2 gene. In some embodiments, the humanized TRBC locus comprises the 3'UTR of the human TRBC2 gene. In some embodiments, the humanized TRBC locus comprises the 3'UTR of the non-human animal endogenous (e.g., mouse endogenous) TRBC2 gene. Under appropriate circumstances, it can be reasonably assumed that based on the similarity of the TRBC1 gene sequence between non-human animals and humans, and the similarity of the TRBC2 gene sequence between non-human animals and humans, they appear to be similarly regulated. As shown in the present application, a humanized non-human animal containing an inserted or replaced TRBC gene at the endogenous TRBC locus of a non-human animal, which retains the endogenous regulatory elements of the non-human animal (e.g., promoter, 5'UTR and / or 3'UTR) but contains humanization of the TRBC1 coding sequence and / or TRBC2 coding sequence, does not exhibit pathological phenomena. In some embodiments, both heterozygous or homozygous genetically modified mice of the humanized TRBC gene are normal.

[0073] The present invention further relates to the TRBC genomic DNA sequence of humanized mice, a DNA sequence obtained by reverse transcription of mRNA that is consistent with or complementary to the DNA sequence; a construct expressing the amino acid sequence thereof; a cell comprising the construct thereof; and a tissue or organ comprising the cell thereof.

[0074] The present invention further relates to a non-human mammal produced by the above method. In some embodiments, its genome comprises human TRBC genes (including human TRBC1 gene, preferably also including human TRBC2 gene).

[0075] In some embodiments, the non-human mammal is a rodent, preferably, the non-human mammal is a mouse.

[0076] In some embodiments, the non-human mammal expresses a protein encoded by a humanized TRBC gene (including a humanized TRBC1 gene, and preferably also including a humanized TRBC2 gene).

[0077] In addition, the present invention also provides a non-human mammal model carrying a tumor, wherein the non-human mammal model is obtained by the construction method described in the present application. In some embodiments, the non-human mammal is a rodent (eg, mouse).

[0078] The present invention also provides a cell or cell line derived from a non-human mammal or its offspring, or a non-human mammal carrying a tumor, or a primary cell culture, which is derived from a non-human mammal or its offspring, or a non-human mammal carrying a tumor, or a tissue, organ, or culture thereof derived from a non-human mammal or its offspring. When it carries a tumor, it is derived from a tumor tissue of a non-human mammal or its offspring, or a non-human mammal carrying a tumor.

[0079] The present invention provides a non-human mammal produced by any of the methods described herein. In some embodiments, a non-human mammal, a genetically modified non-human animal, wherein the genome of the genetically modified non-human animal comprises DNA of a human or humanized TRBC is provided.

[0080] In some embodiments, a non-human mammal comprises a gene construct as described herein. In some embodiments, a non-human mammal expressing a human or humanized TRBC protein is provided. In some embodiments, a cell, tissue or organ specifically expressing a human or humanized TRBC protein is provided.

[0081] In some embodiments, the expression of human or humanized TRBC protein in non-human animals is controllable, such as by adding specific inducers or repressors. In some embodiments, the specific inducer is selected from the tetracycline system (Tet-Off System / Tet-On System) or the tamoxifen system (Tamoxifen System).

[0082] The non-human mammal can be any non-human animal known in the art, which can be used in the methods described herein. Preferably, the non-human mammal includes a rodent. In some embodiments, the non-human mammal is a mouse.

[0083] The non-human mammals described above are subjected to genetic, molecular and behavioral analyses. The present invention provides offspring produced by mating with non-human mammals of the same genotype or other genotypes.

[0084] The present invention provides a cell line or primary cell culture derived from a non-human mammal or its progeny. For example, a cell culture-based model can be prepared by the following method. The cell culture can be obtained by isolation from a non-human mammal, or cells can be obtained from a cell culture established using the same construct and standard cell transfection techniques. The integration of a genetic construct comprising a DNA sequence encoding a human or humanized TRBC protein can be detected by a variety of methods.

[0085] There are many analytical methods that can be used to detect exogenous DNA, including methods at the nucleic acid level (including the use of reverse transcription-polymerase chain reaction (RT-PCR) or Southern Blot and in situ hybridization) and protein level methods (including histochemical analysis, immunoblot analysis and in vitro binding studies). In addition, the expression level of the target gene can be quantified by ELISA methods well known to those skilled in the art. Many standard analytical methods can be used to complete quantitative detection. For example, RT-PCR and hybridization methods can be used to detect transcription levels, including RNAse protection analysis, Southern Blot, RNA dot hybridization analysis (RNAdot). Immunohistochemical staining, flow cytometry, Western Blot can also be used to detect the presence of human or humanized TRBC protein.

[0086] In some embodiments, the genetically modified non-human animals described herein (eg, TRBC gene humanized homozygous mice or TRBC gene humanized heterozygous mice) can express human or humanized TRBC in one or more cells.

[0087] Methods for constructing genetically modified non-human animals

[0088] Genetically modified non-human animals can be prepared by several techniques known in the art, including gene targeting technology, homologous recombination technology, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology, homing endonuclease or other molecular biology techniques using embryonic stem cells. In some embodiments, homologous recombination technology is preferably used. In some embodiments, CRISPR / Cas9 gene editing technology can construct genetically modified non-human animals. Many of these genome editing technologies are known in the art and are described in Yin et al. "Delivery technologies for genome editing," Nature Reviews Drug Discovery 16.6 (2017): 387-399, which is incorporated herein by reference. The present invention also provides many other methods for genome editing, for example, microinjecting transgenic cells into enucleated oocytes and fusing the enucleated oocytes with another transgenic cell.

[0089] In some embodiments, the endogenous genome of at least one cell of the non-human animal contains a nucleotide sequence encoding a human TRBC corresponding region. In some embodiments, the nucleotide sequence encoding an endogenous TRBC corresponding region in the endogenous genome of at least one cell of the non-human animal is replaced by a nucleotide sequence encoding a human TRBC corresponding region. In some embodiments, the replacement occurs in a cell such as a germ cell, a somatic cell, a blastocyst, or a fibroblast. The nucleus of a somatic cell or a fibroblast can be inserted into an enucleated oocyte.

[0090] The present invention provides a targeting vector. The targeting vector comprises a vector consisting of a 5' homology arm, a human or humanized TRBC gene fragment and a 3' homology arm. The process involves introducing the human or humanized TRBC gene fragment into the endogenous gene locus of a non-human animal using homologous recombination. In some embodiments, cleavage upstream and downstream of the target site (e.g., by zinc finger nuclease, TALEN or CRISPR) can result in a DNA double-strand break, and homologous recombination is used to replace the human or humanized TRBC gene fragment into the endogenous TRBC gene locus of a non-human animal.

[0091] In some embodiments, the method for preparing a genetically modified humanized animal includes replacing a nucleotide sequence of an endogenous TRBC region in the genome of a non-human animal (including a nucleotide sequence of a non-human animal TRBC1 corresponding region, and preferably also including a nucleotide sequence of a non-human animal TRBC2 corresponding region) with a nucleotide sequence comprising a human or chimeric TRBC corresponding region (including a nucleotide sequence of a human TRBC1 corresponding region, and preferably also including a nucleotide sequence of a human TRBC2 corresponding region) at an endogenous TRBC locus (or site) of the non-human animal.

[0092] The present invention also provides a method for establishing a TRBC gene humanized animal model, comprising the following steps:

[0093] (a) providing cells (e.g., fertilized egg cells) based on the method described in the present application;

[0094] (b) culturing the cells (preferably culturing the cells in a liquid culture medium);

[0095] (c) transplanting the cultured cells into the oviduct or uterus of a recipient female non-human mammal, allowing the cells to develop in the uterus of the female non-human mammal;

[0096] (d) identifying germline transmission in offspring of the genetically modified humanized non-human mammal of the pregnant female in step (c).

[0097] In some embodiments, the non-human mammal in the above methods is a mouse (eg, a C57BL / 6 mouse).

[0098] In some embodiments, the non-human mammal in step (c) is a female with pseudopregnancy (or pregnancy).

[0099] In some embodiments, the fertilized eggs used in the above methods are C57BL / 6 fertilized eggs. Other fertilized eggs that can also be used in the methods described herein include, but are not limited to, FVB / N fertilized eggs, BALB / c fertilized eggs, DBA / 1 fertilized eggs, and DBA / 2 fertilized eggs.

[0100] The fertilized egg can be from any non-human animal, such as any non-human animal described herein. In some embodiments, the fertilized egg cell is derived from a rodent. The gene construct can be introduced into the fertilized egg by microinjection. For example, by culturing the fertilized egg after microinjection, the cultured fertilized egg can be transferred to a pseudopregnant non-human animal, and then the pseudopregnant non-human animal gives birth to a non-human mammal, thereby producing the non-human mammal mentioned in the above method.

[0101] In some embodiments, a method for preparing a genetically modified non-human animal comprises modifying the endogenous TRBC locus of the non-human animal, for example, by replacing the nucleotide sequence of the endogenous TRBC region of the non-human animal with a nucleotide sequence (e.g., a genomic DNA sequence, a CDS sequence, or a cDNA sequence) comprising the corresponding region of human or chimeric TRBC under the control of the endogenous TRBC gene regulatory elements (e.g., a promoter, 5'UTR, and / or 3'UTR) of the non-human animal, such that human or humanized TRBC is expressed in the non-human animal.

[0102] In some embodiments, the method for preparing a genetically modified non-human animal comprises inserting a nucleotide sequence and / or an auxiliary sequence encoding a human or humanized TRBC protein after the endogenous TRBC gene regulatory element of the non-human animal. In some embodiments, the auxiliary sequence can be a stop codon or an insulator, so that the TRBC gene humanized animal model can express a human or humanized TRBC protein (e.g., a human or humanized TRBC1 protein, preferably also comprising a human or humanized TRBC2 protein) in vivo. In some embodiments, the auxiliary sequence comprises WPRE (WHP post-transcriptional response element), loxP, STOP and / or polyA.

[0103] In some embodiments, a method for preparing a genetically modified non-human animal comprises:

[0104] (1) providing a plasmid comprising a human or chimeric TRBC gene fragment, wherein the plasmid is flanked by a 5' homology arm and a 3' homology arm, wherein the 5' homology arm and the 3' homology arm target an endogenous TRBC locus of a non-human animal;

[0105] (2) providing one or more guide RNAs (sgRNAs) targeting the endogenous TRBC locus of a non-human animal;

[0106] (3) modifying the genome of a cell (e.g., a fertilized egg or an embryonic stem cell) by using the plasmid of step (1), the sgRNA of step (2), and Cas9;

[0107] (4) transplanting the fertilized egg obtained in step (3) into the oviduct of a pseudo-pregnant female mouse, or transplanting the embryonic stem cells obtained in step (3) into a blastocyst, and then transplanting the blastocyst into the oviduct of a pseudo-pregnant female mouse to produce offspring mice that functionally express the humanized TRBC protein. Preferably, the method further comprises:

[0108] (5) The offspring mice obtained in step (4) are mated to obtain homozygous mice.

[0109] In some embodiments, the fertilized egg is modified by CRISPR with sgRNAs targeting a 5'-terminal target site and a 3'-terminal target site.

[0110] In some embodiments, the sequence encoding the humanized TRBC protein is operably linked to human regulatory elements.

[0111] In some embodiments, the sequence encoding the humanized TRBC protein is operably linked to endogenous regulatory elements (eg, a promoter, 5'UTR, and / or 3'UTR) of the non-human animal.

[0112] In some embodiments, a method for preparing a genetically modified non-human animal comprises:

[0113] (1) providing a plasmid comprising a human or chimeric TRBC gene fragment, wherein the plasmid is flanked by a 5' homology arm and a 3' homology arm, wherein the 5' homology arm and the 3' homology arm target an endogenous TRBC locus of a non-human animal;

[0114] (2) providing one or more guide RNAs (sgRNAs) targeting the endogenous TRBC locus of a non-human animal;

[0115] (3) Modifying the genome of a cell (eg, a fertilized egg or embryonic stem cell) by inserting the human or chimeric TRBC gene fragment into the genome of a non-human animal.

[0116] In some embodiments, the nucleotide sequence encoding the endogenous TRBC protein in the genome of the non-human animal is deleted. In some embodiments, all or part of the nucleotide sequence encoding the endogenous TRBC1 protein in the genome of the non-human animal is deleted. In some embodiments, the nucleotide sequence encoding SEQ ID NO: 1 in the genome of the non-human animal is deleted. In some embodiments, all or part of the nucleotide sequence encoding the extracellular region of the endogenous TRBC1 protein in the genome of the non-human animal is deleted. In some embodiments, the nucleotide sequence encoding positions 3-145 of SEQ ID NO: 1, positions 1-145 of SEQ ID NO: 1, or positions 1-159 of SEQ ID NO: 1 in the genome of the non-human animal is deleted. In some embodiments, all or part of the nucleotide sequence encoding the endogenous TRBC2 protein in the genome of the non-human animal is deleted. In some embodiments, the nucleotide sequence encoding SEQ ID NO: 3 in the genome of the non-human animal is deleted. In some embodiments, all or part of the nucleotide sequence encoding the extracellular region of the endogenous TRBC2 protein in the genome of the non-human animal is deleted. In some embodiments, the nucleotide sequence encoding 3-145 of SEQ ID NO: 3, 1-145 of SEQ ID NO: 3, or 1-159 of SEQ ID NO: 3 in the genome of the non-human animal is deleted. In some embodiments, the nucleotide sequence encoding all or part of the endogenous TRBC1 protein and the nucleotide sequence encoding all or part of the endogenous TRBC2 protein in the genome of the non-human animal are deleted. In some embodiments, the nucleotide sequence encoding SEQ ID NO: 1 and 3 in the genome of the non-human animal is deleted. In some embodiments, the nucleotide sequence encoding 3-145 of SEQ ID NO: 1, 1-145 of SEQ ID NO: 1, or 1-159 of SEQ ID NO: 1 in the genome of the non-human animal is deleted, and the nucleotide sequence encoding 3-145 of SEQ ID NO: 3, 1-145 of SEQ ID NO: 3, or 1-159 of SEQ ID NO: 3 is deleted. In some embodiments, part of exon 1 to part of exon 3 of the TRBC1 gene in the genome of the non-human animal is deleted. In some embodiments, the exon 1 to exon 3 of the TRBC2 gene in the genome of the non-human animal is deleted. In some embodiments, the exon 1 to exon 3 of the TRBC1 gene in the genome of the non-human animal is deleted, and the exon 1 to exon 3 of the TRBC2 gene is deleted.

[0117] In some embodiments, the construction method comprises replacing the nucleotide sequence encoding the endogenous TRBC protein of the non-human animal in the genome of the non-human animal with the nucleotide sequence encoding the human TRBC protein (e.g., genomic DNA sequence, CDS sequence, or cDNA sequence). In some embodiments, the construction method comprises replacing all or part of the nucleotide sequence encoding the endogenous TRBC protein of the non-human animal in the genome of the non-human animal with the nucleotide sequence encoding the human TRBC1 protein. In some embodiments, the construction method comprises replacing all or part of the nucleotide sequence encoding the endogenous TRBC2 protein of the non-human animal in the genome of the non-human animal with the nucleotide sequence encoding the human TRBC2 protein. In some embodiments, the construction method comprises replacing all or part of the nucleotide sequence encoding the endogenous TRBC2 protein of the non-human animal in the genome of the non-human animal with the nucleotide sequence encoding the extracellular region of the human TRBC1 protein. In some embodiments, the construction method comprises replacing all or part of the nucleotide sequence encoding the extracellular region of the endogenous TRBC1 protein of the non-human animal in the genome of the non-human animal with the nucleotide sequence encoding the extracellular region of the human TRBC1 protein. In some embodiments, the construction method comprises replacing all or part of the nucleotide sequence encoding the extracellular region and transmembrane region of the human TRBC1 protein in the genome of the non-human animal with the nucleotide sequence encoding the extracellular region and transmembrane region of the human TRBC1 protein. In some embodiments, the construction method includes replacing all or part of the nucleotide sequence encoding the extracellular region of the human TRBC2 protein with all or part of the nucleotide sequence encoding the extracellular region of the endogenous TRBC2 protein of the non-human animal in the genome of the non-human animal. In some embodiments, the construction method includes replacing all or part of the nucleotide sequence encoding the extracellular region and transmembrane region of the human TRBC2 protein with all or part of the nucleotide sequence encoding the extracellular region and transmembrane region of the endogenous TRBC2 protein of the non-human animal in the genome of the non-human animal. In some embodiments, the construction method includes replacing all or part of the nucleotide sequence encoding the endogenous TRBC1 protein of the non-human animal and all or part of the nucleotide sequence encoding the endogenous TRBC2 protein of the non-human animal in the genome of the non-human animal with a nucleotide sequence comprising all or part of the nucleotide sequence encoding the human TRBC1 protein and all or part of the nucleotide sequence encoding the human TRBC2 protein. In some embodiments, the construction method comprises replacing all or part of the nucleotide sequence encoding the extracellular region of the non-human animal endogenous TRBC1 protein and all or part of the nucleotide sequence encoding the extracellular region of the non-human animal endogenous TRBC2 protein in the genome of the non-human animal with a nucleotide sequence comprising all or part of the extracellular region encoding the human TRBC1 protein and all or part of the extracellular region encoding the human TRBC2 protein.In some embodiments, in some embodiments, the construction method comprises replacing all or part of the nucleotide sequence encoding the extracellular region and transmembrane region of the endogenous TRBC1 protein of the non-human animal and all or part of the nucleotide sequence encoding the extracellular region and transmembrane region of the endogenous TRBC2 protein of the non-human animal genome with the nucleotide sequence encoding all or part of the extracellular region and transmembrane region of the endogenous TRBC2 protein of the non-human animal. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 2 with the nucleotide sequence encoding SEQ ID NO: 1 in the genome of the non-human animal. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 3-149 of the nucleotide sequence encoding SEQ ID NO: 2 with the nucleotide sequence encoding SEQ ID NO: 3-145 of the nucleotide sequence encoding SEQ ID NO: 1 in the genome of the non-human animal. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 1 with the nucleotide sequence encoding SEQ ID NO: 1 with the nucleotide sequence encoding SEQ ID NO: 2 with the nucleotide sequence encoding SEQ ID NO: 2 with the nucleotide sequence encoding SEQ ID NO: 2 with the nucleotide sequence encoding SEQ ID NO: 2 with the nucleotide sequence encoding SEQ ID NO: 1 ...1 with the nucleotide sequence encoding SEQ ID NO: 1 with the nucleotide sequence encoding SEQ ID NO: In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 1 at positions 1-159 in the genome of a non-human animal with the nucleotide sequence encoding SEQ ID NO: 1 at positions 1-163. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 3 in the genome of a non-human animal with the nucleotide sequence encoding SEQ ID NO: 4 at positions 3-144. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 3 at positions 3-145 in the genome of a non-human animal with the nucleotide sequence encoding SEQ ID NO: 3 at positions 3-144. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 3 at positions 1-145 in the genome of a non-human animal with the nucleotide sequence encoding SEQ ID NO: 3 at positions 1-149. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 3 at positions 1-159 in the genome of a non-human animal with the nucleotide sequence encoding SEQ ID NO: 3 at positions 1-163. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 1 and 3 in the genome of a non-human animal with the nucleotide sequence encoding SEQ ID NO: 2 and 4. In some embodiments, the construction method includes replacing the nucleotide sequence encoding positions 3-145 of SEQ ID NO: 1 and positions 3-145 of SEQ ID NO: 3 in the genome of a non-human animal with the nucleotide sequence encoding positions 3-149 of SEQ ID NO: 2 and positions 3-144 of SEQ ID NO: 4.In some embodiments, the construction method comprises replacing the nucleotide sequence encoding 1-149 of SEQ ID NO: 2 and 1-149 of SEQ ID NO: 4 with the nucleotide sequence encoding 1-145 of SEQ ID NO: 1 and 1-145 of SEQ ID NO: 3 in the genome of a non-human animal. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding 1-163 of SEQ ID NO: 2 and 1-163 of SEQ ID NO: 4 with the nucleotide sequence encoding 1-159 of SEQ ID NO: 1 and 1-159 of SEQ ID NO: 3 in the genome of a non-human animal. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding 1-159 of SEQ ID NO: 1 and 1-159 of SEQ ID NO: 3 in the genome of a non-human animal with the nucleotide sequence encoding 1-149 of SEQ ID NO: 2 and 1-149 of SEQ ID NO: 4. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding 1-159 of SEQ ID NO: 1 and 1-159 of SEQ ID NO: 3 in the genome of a non-human animal with all or part of the human TRBC gene (e.g., genomic DNA sequence, CDS sequence, or cDNA sequence). In some embodiments, the construction method comprises replacing the endogenous TRBC gene in the genome of a non-human animal with all or part of the human TRBC1 gene. In some embodiments, the construction method includes replacing part of exon 1 to part of exon 3 of the endogenous TRBC1 gene in the genome of a non-human animal with part of exon 1 to part of exon 3 of the human TRBC1 gene. In some embodiments, the construction method includes replacing all or part of the endogenous TRBC2 gene in the genome of a non-human animal with all or part of the human TRBC2 gene. In some embodiments, the construction method includes replacing part of exon 1 to part of exon 3 of the endogenous TRBC2 gene in the genome of a non-human animal with part of exon 1 to part of exon 3 of the human TRBC2 gene. In some embodiments, the construction method includes replacing all or part of the endogenous TRBC1 gene and all or part of the endogenous TRBC2 gene in the genome of a non-human animal with all or part of the human TRBC1 gene and all or part of the human TRBC2 gene. In some embodiments, the construction method comprises replacing the exon 1 to exon 3 of the endogenous TRBC1 gene and the exon 1 to exon 3 of the endogenous TRBC2 gene in the genome of the non-human animal with the exon 1 to exon 3 of the human TRBC1 gene and the exon 1 to exon 3 of the human TRBC2 gene. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 1 in the genome of the non-human animal with the nucleotide sequence encoding SEQ ID NO: 24. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 1 in the genome of the non-human animal with the nucleotide sequence shown in SEQ ID NO: 26.In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 3 in the genome of a non-human animal with the nucleotide sequence encoding SEQ ID NO: 25. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 3 in the genome of a non-human animal with the nucleotide sequence shown in SEQ ID NO: 27. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 1 and 3 in the genome of a non-human animal with the nucleotide sequence encoding SEQ ID NO: 24 and 25. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 1 and 3 in the genome of a non-human animal with the nucleotide sequence comprising SEQ ID NO: 26 and 27. In some embodiments, the construction method comprises replacing the corresponding sequence of the endogenous TRBC locus of a non-human animal with the chimeric sequence of a human and a non-human animal. In some embodiments, the construction method includes replacing the portion of exon 1 to exon 3 of the endogenous TRBC1 gene in the non-human animal genome to at least 5 bp of continuous nucleotide sequence downstream of the 3'UTR of the endogenous TRBC2 gene of the non-human animal by including the portion of exon 1 to exon 3 of the human TRB1 gene, the portion of exon 3 of the endogenous TRBC1 gene of the non-human animal to exon 1 of the endogenous TRBC2 gene of the non-human animal, the portion of exon 1 to exon 3 of the human TRBC2 gene, and the portion of exon 3 of the endogenous TRBC2 gene of the non-human animal to at least 5 bp of continuous nucleotide sequence downstream of the 3'UTR. In some embodiments, the construction method comprises the nucleotide sequence of positions 142791702-142792735 of NCBI accession number NC_000007.14, the nucleotide sequence of positions 142801049-142802133 of NCBI accession number NC_000007.14 or a variant thereof (preferably, the variant comprises a mutation of position 142801129 from G to A, a mutation of position 142802045 from T to C and ... 802078 mutated from A to G), the nucleotide sequence of positions 41516207-41523671 of NCBI accession number NC_000072.7, and the nucleotide sequence of positions 41524735-41525760 of NCBI accession number NC_000072.7 replace the part of exon 1 of the endogenous TRBC1 gene in the genome of the non-human animal to at least 5 bp of continuous nucleotide sequence downstream of the 3'UTR of the endogenous TRBC2 gene of the non-human animal. In some embodiments, the construction method includes replacing the part of exon 1 of the endogenous TRBC1 gene in the genome of the non-human animal to at least 5 bp of continuous nucleotide sequence downstream of the 3'UTR of the endogenous TRBC2 gene of the non-human animal with SEQ ID NO:7.

[0118] Use of genetically modified non-human animals

[0119] Replacing a non-human animal gene with a homologous or orthologous human gene or human sequence or inserting a homologous or orthologous human gene or human sequence into a non-human animal at a non-human animal endogenous locus and under the control of non-human animal endogenous regulatory elements (e.g., promoter, 5'UTR and / or 3'UTR) can produce a non-human animal with qualities and characteristics that may be significantly different from typical knockout plus transgenic animals. In typical knockout plus transgenic animals, the endogenous locus is removed or destroyed, and the full human transgene is inserted into the genome of the non-human animal and may be randomly integrated into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of the human gene and / or protein assay and / or functional assay.

[0120] Genetically modified non-human animals that express human or humanized TRBC proteins, e.g., in a physiologically appropriate manner, provide a variety of uses, including but not limited to developing treatments for human diseases and disorders, and evaluating the toxicity and / or efficacy of these human treatments in animal models.

[0121] The present invention also provides a use of the TRBC gene-modified non-human animal and the non-human animal obtained by any of the above construction methods.

[0122] In some embodiments, the application comprises:

[0123] A) Application in product development for TRBC-related immune processes involving human cells;

[0124] B) Application as a model system relevant to TRBC for pharmacological, immunological, microbiological and medical research;

[0125] C) Applications involving the production and use of animal experimental disease models for etiological studies related to TRBC and / or for the development of diagnostic strategies and / or for the development of therapeutic strategies;

[0126] D) in vivo studies on the screening, efficacy testing, efficacy assessment, validation or evaluation of modulators of human TRBC signaling pathways; or,

[0127] E) Study the function of TRBC gene, study the drugs and efficacy targeting human TRBC target sites, and study the application of therapeutic drugs for tumors, inflammation or immune diseases related to TRBC.

[0128] The present invention provides a non-human animal expressing human or humanized TRBC protein, which can be used for screening of human TRBC specific regulators. In some embodiments, the non-human animal is a human disease animal model. For example, the disease is genetically induced (knock-in or knock-out). In different embodiments, the genetically modified non-human animal also comprises an impaired immune system, such as a genetically modified human-derived tissue xenograft, including human solid tumors (e.g., breast cancer) or hematological tumors (e.g., leukemia, multiple myeloma, myelodysplastic syndrome, lymphocyte tumors (including B cell tumors and / or T cell tumors)).

[0129] In some embodiments, therapeutic agents (e.g., antibodies targeting TRBC, nucleic acid drugs targeting TRBC, and / or polypeptide drugs) block or inhibit TRBC-mediated signaling pathways. In some embodiments, the therapeutic agents described herein can block the interaction between TRBC complexes, thereby inhibiting the TRBC signaling pathway.

[0130] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents (e.g., antibodies targeting TRBC, nucleic acid drugs targeting TRBC, and / or polypeptide drugs) in treating various immune diseases. In some embodiments, the immune diseases include, but are not limited to, GVHD (graft versus host disease), atopic dermatitis, psoriasis, allergies, asthma, myocarditis, multiple sclerosis, nephritis, hepatitis (preferably non-alcoholic fatty hepatitis), systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain, or neurological disorders. In some embodiments, immune diseases include systemic lupus erythematosus, atopic dermatitis, psoriasis, asthma, rheumatoid arthritis, or multiple sclerosis.

[0131] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents (e.g., antibodies targeting TRBC, nucleic acid drugs targeting TRBC, and / or polypeptide drugs) in treating various inflammations (e.g., infections). In some embodiments, the inflammation includes acute inflammation and chronic inflammation. Specifically, it includes but is not limited to degenerative inflammation, exudative inflammation (serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotizing inflammation, catarrhal inflammation), proliferative inflammation, specific inflammation (tuberculosis, syphilis, leprosy, lymphogranuloma, etc.). In some embodiments, the inflammation is inflammatory bowel disease (IBD).

[0132] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents (e.g., antibodies targeting TRBC, nucleic acid drugs targeting TRBC, and / or polypeptide drugs) for treating cancer. In some embodiments, a therapeutic agent is administered to a non-human animal, wherein the non-human animal has cancer or a tumor, and the inhibitory effect of the therapeutic agent on the cancer or tumor is detected. In some embodiments, the detection includes determining the size and / or proliferation rate of tumor cells. In some embodiments, the detection method includes vernier caliper measurement, flow cytometry, and / or in vivo animal imaging detection. In some embodiments, the detection includes assessing individual body weight, fat mass, activation pathways, neuroprotective activity, or metabolic changes, including changes in food consumption or water consumption.

[0133] In some embodiments, the tumor cells include one or more cancer cells injected into a non-human animal (e.g., cancer cells derived from a human or non-human animal). In some embodiments, the therapeutic agent upregulates or inhibits the TRBC signaling pathway. In some embodiments, the therapeutic agent does not upregulate or inhibit the TRBC signaling pathway.

[0134] In some embodiments, genetically modified non-human animals can be used to detect whether a therapeutic agent (e.g., an antibody targeting TRBC, a nucleic acid drug targeting TRBC, and / or a polypeptide drug) is an agonist or antagonist. In some embodiments, the methods described herein can be used to detect the function of a therapeutic agent, for example, whether the therapeutic agent can upregulate an immune response or downregulate an immune response, and / or whether the therapeutic agent can induce complement-mediated cytotoxicity (CMC) or antibody-dependent cellular cytotoxicity (ADCC). In some embodiments, genetically modified non-human animals can be used to determine the effective dose of a therapeutic agent for treating a disease in a subject (e.g., a tumor, inflammation, or an immune disease). In some embodiments, the inhibitory effect on tumors can also be determined by methods known in the art, for example, measuring the tumor volume in an animal, and / or determining the tumor (volume) inhibition rate (TGI). TV ). The tumor growth inhibition rate can be calculated using the formula TGI TV (%)=(1–T Vt / T Vc ) x 100, where T Vt and T Vc is the average tumor volume (or weight) of the treatment group and the control group.

[0135] In some embodiments, therapeutic agents (e.g., antibodies targeting TRBC, nucleic acid drugs targeting TRBC, and / or polypeptide drugs) can be used to treat various cancers (tumors). The "cancer" or "tumor" described in the present invention refers to cells with autonomous growth ability, that is, abnormal states or conditions characterized by rapid proliferation of cell growth. The term is intended to include all types of cancerous growth or carcinogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of the histopathological type or invasive stage. The "tumor" or "tumor" described in the present invention includes, but is not limited to, lymphocyte tumors (e.g., T cell tumors and / or B cell tumors), cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, brain glioma, lung cancer (e.g., non-small cell lung cancer), bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, and sarcoma. Wherein, the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myeloid leukemia; In some embodiments, lymphocyte tumors include T cell tumors and / or B cell tumors. In some embodiments, the lymphocyte tumor is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B cell lymphoma, diffuse large B cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B cell lymphoma, T cell lymphoma, and Waldenstrom's macroglobulinemia; The sarcoma is selected from osteosarcoma, Ewing's sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. In some embodiments, the tumor is breast cancer, pancreatic cancer, endocrine cancer, head and neck cancer, gastrointestinal cancer, colorectal cancer, bladder cancer, non-small cell lung cancer, glioblastoma, prostate cancer, neuroendocrine tumor, mesothelial tumor, oropharyngeal tumor, female reproductive system cancer or meningioma. In some embodiments, the tumor comprises a solid tumor or a hematological tumor. In some embodiments, the tumor comprises one or more of glioma, leukemia, multiple myeloma, myelodysplastic syndrome, female reproductive system cancer, breast cancer, melanoma, lymphocyte tumor (e.g., T cell tumor and / or B cell tumor), head and neck cancer, liver cancer or lung cancer.

[0136] The present invention also provides a detection method for determining the toxicity of a therapeutic agent (e.g., an antibody targeting TRBC, a nucleic acid drug targeting TRBC, and / or a polypeptide drug). The method comprises administering a therapeutic agent to the non-human animal, assessing the weight change of the non-human animal, or performing a blood test. In some embodiments, the blood test includes, but is not limited to, red blood cell count, hematocrit, and / or hemoglobin content. In some embodiments, the therapeutic agent can reduce red blood cells (RBC), hematocrit, or hemoglobin by 20%, 30%, 40%, or more than 50%. In some embodiments, the body weight of the non-human animal is at least 5%, 10%, 20%, 30%, or 40% less than that of a control group (e.g., the average body weight of a non-human animal not treated with a therapeutic agent).

[0137] The present invention also provides an animal model constructed by the method described in the present application for developing products related to human cellular immune processes, producing human antibodies, or a model system for pharmacology, immunology, microbiology and medical research.

[0138] In some embodiments, an animal model generated by the methods described herein is provided for producing and utilizing animal experimental disease models of immune processes of human cells, studying pathogens, or developing new diagnostic strategies and / or therapeutic strategies.

[0139] The present invention also provides an animal model generated by the method described in the present application to screen, verify, evaluate or study the TRBC gene function, human TRBC antibodies, drugs or effectiveness of human TRBC target-related diseases (such as tumors, inflammation or immune diseases, preferably tumors).

[0140] In some embodiments, the present application provides a method for verifying the in vivo efficacy of TCR-T, CAR-T and / or other immunotherapies (e.g., T cell adoptive transfer therapy). For example, the method includes transplanting human tumor cells into non-human animals described in the present application, and applying human CAR-T to animals with human tumor cells. The effectiveness of CAR-T treatment can be determined and evaluated. In some embodiments, the non-human animal is selected from a TRBC gene humanized non-human animal prepared by the method described in the present application, a double gene or multi-gene humanized non-human animal (or its offspring) produced by the method described in the present application, a non-human animal expressing a human or humanized TRBC protein, or a tumor-bearing or inflammatory animal model described in the present application. In some embodiments, TCR-T, CAR-T and / or other immunotherapies can treat the TRBC-related diseases (e.g., tumors, inflammation or immune diseases). In some embodiments, TCA-T, CAR-T and / or other immunotherapies provide an evaluation method for treating the TRBC-related diseases (e.g., tumors, inflammation or immune diseases).

[0141] Non-human animal models with two or more human or chimeric genes

[0142] The present invention also provides an animal model or non-human animal having two or more human or chimeric genes. The non-human animal or animal model may contain a human or chimeric TRBC gene and a sequence encoding an additional human or chimeric protein.

[0143] In some embodiments, the additional human or chimeric protein comprises at least one of NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, or CTLA4. In some embodiments, the non-human animal also expresses at least one of human or humanized NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, or CTLA4 protein.

[0144] The present invention also provides a method for constructing a non-human animal with two or more human or chimeric genes, the method comprising:

[0145] (1) Providing the above-mentioned construction method to obtain a non-human animal;

[0146] (ii) mating, in vitro fertilization or direct gene editing of the non-human animals provided in step (i) with other genetically modified non-human animals, and screening to obtain multi-gene modified non-human animals.

[0147] In some embodiments, the other genetically modified non-human animals include non-human animals humanized with one or a combination of two or more of the genes NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, or CTLA4.

[0148] In some embodiments, TRBC gene humanization is performed directly on a non-human animal with at least one genetic modification of human or chimeric NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, or CTLA4.

[0149] Since these proteins may involve different mechanisms, a combination therapy targeting two or more of these proteins may be a more effective treatment method. In fact, many related clinical trials are underway and show good results. The multi-gene modified non-human animal model can be used to determine the effectiveness of a combination therapy targeting two or more proteins, for example, a therapeutic agent (e.g., an antibody targeting TRBC, a nucleic acid drug targeting TRBC and / or a polypeptide drug), and an additional therapeutic agent for treating a disease (e.g., a tumor, inflammation or immune disease, preferably a tumor). The method includes administering a therapeutic agent and an additional therapeutic agent to a non-human animal, wherein the non-human animal has a disease (e.g., a tumor, inflammation or immune disease), and determining the effect of the combination therapy on the disease. In some embodiments, the additional therapeutic agent is an antibody specifically binding to NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1 or CTLA4, or a nucleic acid drug and / or polypeptide drug targeting the above-mentioned target. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab), an anti-PD-1 antibody (e.g., pembrolizumab or nivolumab), or an anti-PD-L1 antibody. In some embodiments, the non-human animal further comprises a sequence encoding a human or humanized PD-1, a sequence encoding a human or humanized PD-L1, or a sequence encoding a human or humanized CTLA-4. In some embodiments, the tumor comprises one or more tumor cells expressing PD-L1 and / or PD-L2. In some embodiments, the combined treatment method is used to treat various cancers (tumors). In some embodiments, the combined treatment is designed to treat the immune disease, such as psoriasis. In some embodiments, the method can be used to evaluate combined treatments with some other methods. Methods for treating cancer that can be used alone or in combination with the methods described herein include, for example, treating the subject with chemotherapy, such as camphor, doxorubicin, cisplatin, carboplatin, procarbazine, methylclorazepam, cyclophosphamide, doxorubicin, ifosfamide, melphalan, chloramphenicol, pyrimidine, nitrosourea, dacrynic acid, bleomycin, primycin, mitomycin, etoposide, verapamil, podophyllotoxin, tamoxifen, paclitaxel, transplatin, 5-fluorouric acid, vincristine, vinblastine and / or methotrexate. Alternatively, in addition, the method can include performing surgery on the subject to remove at least a portion of the cancer, for example, removing a portion or all of a tumor from the patient. BRIEF DESCRIPTION OF THE DRAWINGS

[0150] Figure 1 : Schematic comparison of mouse TRBC locus and human TRBC locus (not to scale);

[0151] Figure 2 : Schematic diagram of TRBC gene targeting strategy and targeting vector design (not to scale);

[0152] Figure 3 : PCR identification results of TRBC gene humanized mouse F1 generation, where WT is wild-type control, M is marker, H is 2 O is water control;

[0153] Figure 4 : RT-PCR identification results of F1 generation of TRBC gene humanized mice, where + / + is wild-type mice, H / H is homozygous TRBC gene humanized mice, and H 2 O is water control, GAPDH is internal control;

[0154] Figure 5 :Flow cytometry results of the proportion of leukocyte subsets in the spleen, + / + is wild-type mice, H / H is TRBC gene humanized homozygous mice, TC is T cells, BC is B cells, NK is NK cells, DC is dendritic cells, MC is monocytes, is a macrophage, NE is a neutrophil;

[0155] Figure 6 :Flow cytometry results of the proportion of T cell subsets in the spleen, + / + represents wild-type mice, H / H represents homozygous TRBC gene humanized mice, Th represents CD4+T cells, Tc represents CD8+T cells, and Treg represents Tregs cells.

[0156] Figure 7 : The percentage of CD69+ activated T cells (mCD45+mCD69+) in leukocytes (mCD45+) after 24 hours of stimulation ( Figure 7 A), and the percentage of CD25+ activated T cells (mCD45+mCD25+) in leukocytes (mCD45+) after 24 hours of stimulation ( Figure 7 B), + / + is wild-type mouse, H / H is TRBC gene humanized homozygous mouse;

[0157] Figure 8 : Mean fluorescence intensity of CD69+ activated T cells (mCD69+) after 24 hours of stimulation ( Figure 8 A), and the mean fluorescence intensity of CD25+ activated T cells (mCD25+) after 24 hours of stimulation ( Figure 8 B), + / + is wild-type mouse, H / H is TRBC gene humanized homozygous mouse;

[0158] Fig. 9: The percentage of CD69+ activated T cells (mCD69+) in T cells (mCD45+mCD3+) after 42 hours of stimulation ( Fig. 9 A), and the percentage of CD25+ activated T cells (mCD25+) to T cells (mCD45+mCD3+) after 42 hours of stimulation ( Fig. 9 B), + / + is wild-type mouse, H / H is TRBC gene humanized homozygous mouse;

[0159] Fig.10 : Mean fluorescence intensity of CD69+ activated T cells (mCD69+) after 42 hours of stimulation ( Fig.10 A), and the mean fluorescence intensity of CD25+ activated T cells (mCD25+) after 42 hours of stimulation ( Fig.10 B), + / + is wild-type mouse, H / H is TRBC gene humanized homozygous mouse;

[0160] Fig.11 : ELISPOT results, where + / + refers to wild-type C57BL / 6 mice, H / H refers to TRBC gene humanized homozygous mice, NC1 and NC2 are negative control groups, G1-G8 are treatment groups, and PC1 and PC2 are positive control groups. DETAILED DESCRIPTION

[0161] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0162] In each of the following examples, equipment and materials were obtained from the following companies:

[0163] C57BL / 6 mice and Flp transgenic mice were purchased from the National Rodent Laboratory Animal Seed Center, China Food and Drug Inspection Institutes;

[0164] Brilliant Violet 510 TM Anti-mouse CD45 was purchased from Biolegend, catalog number 103138;

[0165] FITC anti-Mouse CD19 was purchased from Biolegend, catalog number 115506;

[0166] V450 Rat Anti-mouse CD3 Molecular Complex was purchased from Biolegend, catalog number 561389;

[0167] Brilliant Violet 711 TM Anti-mouse NK-1.1Antibody was purchased from Biolegend, catalog number 108745;

[0168] Purified anti-human TCR Cβ1Antibody was purchased from Biolegend, catalog number 383502;

[0169] Mouse Pan T Cell Isolation Kit II was purchased from Miltenyi Biotec, catalog number 130-095-130;

[0170] anti-mouse CD3E antibody was purchased from BioXcell, catalog number BE0001-1;

[0171] anti-mouse CD28 antibody was purchased from BioXcell, catalog number BE0015-1;

[0172] Human TRBC1 antibody was purchased from Biolegend, catalog number 383502;

[0173] Anti-mouse CD69 antibody was purchased from Biolegend, catalog number 104514;

[0174] anti-mouse CD25 antibody was purchased from Biolegend, catalog number 102008;

[0175] Human CD3E antibody was purchased from BioXcell, catalog number BE0001-2;

[0176] Human CD69 antibody was purchased from Biolegend, catalog number 310912;

[0177] Human CD25 antibody was purchased from Biolegend, catalog number 302610.

[0178] Example 1 TRBC gene humanized mice

[0179] The mouse TRBC locus includes the TRBC1 gene (NCBI Gene ID: 100125262, located at positions 41515153 to 41516599 of chromosome 6 NC_000072.7) and the TRBC2 gene (NCBI Gene ID: 100125263, located at positions 41523664 to 41525115 of chromosome 6 NC_000072.7), and the human TRBC locus includes the TRBC1 gene (NCBI Gene ID: 28639, located at positions 142791694 to 142793141 of chromosome 7 NC_000007.14) and the TRBC2 gene (NCBI Gene ID: 28638, located at positions 142801041 to 142802529 of chromosome 7 NC_000007.14). The comparison diagram of the mouse TRBC locus and the human TRBC locus is shown in FIG. Figure 1 shown.

[0180] In order to achieve the purpose of the present invention, a nucleotide sequence encoding a human TRBC protein can be introduced into the mouse endogenous TRBC locus so that the mouse expresses a human or humanized TRBC protein. Specifically, using gene editing technology, under the control of mouse TRBC gene regulatory elements (such as promoters, 5'UTR and / or 3'UTR), a partial nucleotide sequence of about 1.1 Kb containing exons 1-3 of the human TRBC1 gene and a partial nucleotide sequence of about 1.1 Kb containing exons 1-3 of the human TRBC2 gene are used to replace a partial nucleotide sequence of about 1.1 Kb containing exons 1-3 of the mouse TRBC1 gene and a partial nucleotide sequence of about 1.1 Kb containing exons 1-3 of the mouse TRBC2 gene, to obtain a humanized TRBC locus, thereby achieving humanization of the mouse TRBC gene.

[0181] In order to realize the targeting strategy of the present invention, a targeting vector ( Figure 2), the targeting vector contains homology arm sequences upstream and downstream of the mouse TRBC gene, and fragment A (SEQ ID NO: 7). The A fragment sequentially contains the human TRBC1 fragment (identical to the nucleotide sequence of positions 142791702-142792735 of NCBI accession number NC_000007.14), the mouse fragment 1 containing part of the mouse TRBC1 gene and part of the mouse TRBC2 gene (identical to the nucleotide sequence of positions 41516207-41523671 of NCBI accession number NC_000072.7), the human TRBC2 fragment (identical to the nucleotide sequence of positions 142791702-142792735 of NCBI accession number NC_000007.14), and the mouse fragment 2 containing part of the mouse TRBC1 gene and part of the mouse TRBC2 gene (identical to the nucleotide sequence of positions 41516207-41523671 of NCBI accession number NC_000072.7). The nucleotide sequence identity of positions 2801049-142802133 is greater than 99%, including a mutation at position 142801129 from G to A, a mutation at position 142802045 from T to C and a mutation at position 142802078 from A to G) and a mouse fragment 2 comprising mouse TRBC2 (identical to the nucleotide sequence at positions 41524735-41525760 of NCBI Accession No. NC_000072.7), the upstream 5' homology arm sequence (SEQ ID NO: 5) is identical to the nucleotide sequence at positions 41511487 to 41515159 of NCBI Accession No. NC_000072.7, and the downstream 3' homology arm sequence (SEQ ID NO: 6) is identical to the nucleotide sequence at positions 41525761 to 41529797 of NCBI Accession No. NC_000072.7. The connection design between human TRBC1 fragment and mouse fragment 1 is: 5'-AGGGGTCCTGTCTGCCACCATCCTCT ATGA GATCCT GCTAGGGAAAGCCACCCTGTATGCTGT-3' (SEQ ID NO: 28), wherein the sequence " ATGAG The last "G" in " is the last nucleotide where the human TRBC1 fragment joins the mouse fragment 1. " ATCCT The "A" in the fragment is the first nucleotide of mouse segment 1; the connection between mouse segment 1 and the 5' end of human TRBC2 segment is designed as: 5'-CCTCTCTTTAC TTTCCAGAGG ATCTGAAAAAC GTGTTCCCACCCAAGGTCGCTGTGTTT-3' (SEQ ID NO: 29), wherein the sequence " ATCTG "G" in " is the last nucleotide of mouse segment 1," AAAAAC The first "A" in " is the first nucleotide of the human TRBC2 fragment; the connection between the 3' end of the human TRBC2 fragment and the mouse fragment 2 is designed as: 5'-CTTGTCAACAGAGTCTTACCAGCAAGGGGTCCTGT CTGCCACCATCCTCTATGAGATCCTACTGGGGAAGGC CACCCT-3' (SEQ ID NO: 9), wherein the sequence " CTGCC The last "C" in " is the last nucleotide where the 3' end of human TRBC2 fragment joins with mouse fragment 2. " ACCAT The first "A" in " is the first nucleotide of mouse segment 2. The connection between the upstream sequence of the human TRBC1 segment and the mouse sequence is designed as: 5'-CAGACCATTCGTACTCTCTTTACTTTCC AGAGG ATCTGAACAA GGTGTTCCCACCCGAGGTCGCTGTGTTTGAG-3' (SEQ ID NO: 8), wherein the sequence " ATCTG The "G" in " is the last nucleotide in the upstream junction between the mouse sequence and the human TRBC1 fragment sequence. A ACAA The first "A" in " is the first nucleotide of the human TRBC1 fragment sequence.

[0182] The targeting vector also includes a resistance gene for positive clone screening, namely the neomycin phosphotransferase coding sequence Neo, and two site-specific recombination system Frt recombination sites arranged in the same direction are installed on both sides of the resistance gene to form a Neo cassette. The connection between the 5' end of the Neo cassette and the mouse fragment 2 is designed as: 5'-CTCCAGGACTCTGTCTCACAGAACCAGGCTCTA G GTGGAATAT TGTCGACGGTATCGATAAGCTTGATATCGAATTCCGAAGTTCCTAT-3' (SEQ ID NO: 10), wherein the sequence " GGTGG The last "G" in " is the last nucleotide of mouse fragment 2 connected to the 5' end of the Neo box, the sequence " AATAT The first "A" in the " is the first nucleotide of the Neo box; the connection between the 3' end of the Neo box and the mouse gene is designed as: 5'-CTATTCTCTAGAAAGTATAGGAACTTCATCAGTCAGGTACATAATGGTG GATCCGGGTC TAGAAGAGATTAAGGCATTACCCATGAAATGTCAC-3' (SEQ ID NO: 11), wherein the sequence " GATCC The last "C" in the sequence is the last nucleotide of the Neo box. GGGTCThe first "G" in " is the first nucleotide of the mouse gene connected to the 3' end of the Neo box. The A fragment and the Neo box constitute the A1 fragment. The mRNA transcribed from the modified TRBC1 gene in the humanized TRBC gene-transformed mouse is shown in SEQ ID NO: 26, the mRNA transcribed from the modified TRBC2 gene is shown in SEQ ID NO: 27, the expressed humanized TRBC1 protein sequence is shown in SEQ ID NO: 24, and the expressed humanized TRBC2 protein sequence is shown in SEQ ID NO: 25.

[0183] The construction of the targeting vector can be carried out by conventional methods, such as enzyme digestion and ligation. After the constructed targeting vector is initially verified by enzyme digestion, it is sent to a sequencing company for sequencing verification. The targeting vector verified by sequencing is electroporated and transfected into the embryonic stem cells of C57BL / 6 mice, and the obtained cells are screened using the positive clone screening marker gene to screen the correct positive clone cells. The screened correct positive clone cells (black mice) are introduced into the separated blastocysts (white mice) according to the technology known in the art, and the obtained chimeric blastocysts are transferred to the culture medium for short-term culture and then transplanted into the oviduct of the recipient mother mouse (white mouse), and F0 generation chimeric mice (black and white) can be produced. F0 generation chimeric mice are backcrossed with wild-type mice to obtain F1 generation mice, and then F1 generation heterozygous mice are mated with each other to obtain F2 generation homozygous mice. Positive mice can also be mated with Flp tool mice to remove the positive clone screening marker gene, and then TRBC gene humanized homozygous mice can be obtained by mating with each other.

[0184] The PCR method can be used to identify the somatic cell genotype of F1 generation mice, and the primers are shown in Table 1. The identification results of exemplary F1 generation mice are shown in Figure 3 , all six mice numbered F1-1 to F1-6 were positive.

[0185] Table 1 Primer sequences and recombinant fragment sizes for PCR detection of F1 genotypes

[0186]

[0187] The expression of mRNA in the humanized TRBC gene mice can be detected by RT-PCR. Specifically, one C57BL / 6 mouse (+ / +) and one homozygous humanized TRBC gene (H / H) prepared in this example were selected, and spleen tissue was obtained after euthanasia by cervical dislocation. RT-PCR detection was performed using the primer sequences shown in Table 2 below. The detection results are shown in FIG. Figure 4 As shown. Figure 4As can be seen, only mouse TRBC1 mRNA and mouse TRBC2 mRNA were detected in C57BL / 6 mice; only humanized TRBC1 mRNA and humanized TRBC2 mRNA were detected in TRBC gene homozygous mice.

[0188] Table 2 RT-PCR primer sequences and target fragment sizes

[0189]

[0190] The expression of humanized TRBC1 protein in TRBC gene humanized mice can be detected by flow cytometry. Specifically, one C57BL / 6 mouse (+ / +) and one homozygous TRBC gene humanized mouse (H / H) prepared in this example were selected, and the spleens were taken out after euthanasia by cervical dislocation. Splenocytes were isolated and expressed in vitro using anti-CD45 antibody Brilliant Violet510. TM anti-mouse CD45(mCD45), anti-CD19 antibody FITC anti-Mouse CD19(mCD19), anti-CD3 antibody V450 Rat Anti-mouse CD3 Molecular Complex(mCD3), Brilliant Violet 711 TM Flow cytometry detection was performed after identification and staining with anti-mouse NK-1.1Antibody and anti-human TRBC1 antibody Purified anti-human TCR Cβ1Antibody (hTRBC).

[0191] The test results are shown in Table 3 below. The expression of humanized TRBC1 protein can be detected in the spleen T cells of TRBC gene homozygous mice, while human or humanized TRBC1 protein is not detected in the spleen T cells of C57BL / 6 mice (+ / +).

[0192] Table 3 Flow cytometry detection results

[0193] Cell Type TRBC1-positive cell characteristics + / + H / H T cells mCD45+mCD3+mCD19-hTRBC+ 1.26％ 39.7％ B cells mCD45+mCD3-mCD19+hTRBC+ 1.22％ 0.68％ NK cells mCD45+mCD3-mCD19-mNK1.1+hTRBC+ 0.80％ 2.22％

[0194] Furthermore, flow cytometry was used to detect the immunophenotyping of spleen tissues of C57BL / 6 wild-type mice and TRBC gene homozygous mice (H / H). The results of leukocyte subtypes and T cell subtypes in the spleen were as follows: Figure 5 and Figure 6 As shown, from Figure 5 and Figure 6It can be seen that in the spleen of TRBC gene humanized homozygous mice, there are B cells (BC, mCD45+mCD3-mCD19+), T cells (TC, mCD45+mCD3+mCD19-), NK cells (NK, mCD45+mCD3-mCD19-mNK1.1+), neutrophils (Neutrophils, NE, mCD45+mLy-6G+mCD11b+), dendritic cells (Dendritic cells, DC, mCD45+mLy-6G-mCD11c+mNKp46-), and macrophages (Macrophages, The leukocyte subtypes such as mCD45+mLy-6G-mCD11c-mNKp46-mF4 / 80+mCD11b+ and monocytes (MC, mCD45+mLy-6G-mCD11c-mNKp46-mF4 / 80-mCD11b+) were basically consistent with those of C57BL / 6 wild-type mice ( Figure 5 ), the percentages of T cell subtypes such as CD4+T cells (Th), CD8+T cells (Tc) and Tregs cells (Treg) were basically the same as those of C57BL / 6 wild-type mice ( Figure 6 ), the above results indicate that humanization of the TRBC gene will not change the proportion and distribution of immune cells in the spleen of mice.

[0195] To confirm that T cells in mice can be activated normally, 3 (n=3) wild-type C57BL / 6 mice (+ / +) and 3 (n=3) homozygous TRBC humanized mice (H / H) were taken from the spleen. Pan T cells were purified using the Mouse Pan T Cell Isolation Kit II, and different doses of anti-mouse CD3E antibody (mCD3E), anti-mouse CD28 antibody (mCD28) and / or anti-human TRBC antibody (hTRBC) were added to stimulate T cells (specific grouping and stimulation scheme are shown in Table 4 below), and the activation of T cells was detected by FACS after 24 hours and 42 hours of stimulation. Specifically, 24 hours after stimulation, staining was performed using anti-mouse CD69 antibody and anti-mouse CD25 antibody, and FACS detection was performed to calculate the percentages and average fluorescence intensity of CD69+ activated T cells (mCD69+) and CD25+ activated T cells (mCD25+) in leukocytes (mCD45+), respectively; 42 hours after stimulation, FACS detection was performed again to calculate the percentages and average fluorescence intensity of CD69+ activated T cells (mCD69+) and CD25+ activated T cells (mCD25+) in T cells (mCD45+mCD3+), respectively.

[0196] Table 4 Group stimulation scheme

[0197]

[0198] The results showed that (stimulation for 24 hours, Figure 7-8 ), anti-mCD3E antibody can activate T cells from wild-type C57BL / 6 mice (+ / +) and TRBC gene humanized homozygous mice (H / H) (G2), adding anti-mouse CD28 antibody stimulation can increase the activation ratio of T cells (G5); but anti-human TRBC1 antibody can only activate T cells from TRBC gene humanized homozygous mice (H / H), and the higher the dose of anti-human TRBC1 antibody, the higher the activation ratio (G3, G4), adding anti-mouse CD28 antibody stimulation can increase the activation ratio of T cells (G6, G7). In addition, after prolonging the stimulation time (stimulation for 42 hours, Figure 9-10), compared with the results after 24 hours of stimulation, the average fluorescence intensity of CD69+ activated T cells (mCD69+) in the spleen cells of TRBC gene homozygous mice (H / H) increased, and the activation ratio increased. This shows that the humanized TRBC1 protein expressed in TRBC gene homozygous mice can correctly form a complex with mouse TCRa chain and mouse CD3, and can effectively transmit signals to activate T cells. Combined with the RT-PCR results, the humanized TRBC protein can be normally expressed in the TRBC gene homozygous mice constructed using the method of this embodiment.

[0199] OVA peptide 257–264 It is a restricted epitope peptide of ovalbumin (OVA) presented by MHC class I molecule H-2Kb. OVA peptide 257–264 The amino acid sequence is SIINFEKL (SEQ ID NO: 30).

[0200] The expression and function of humanized TRBC protein in mice can also be verified by ELISPOT. Specifically, three 8-9 week old female wild-type C57BL / 6 mice (+ / +) and three 8-9 week old female TRBC homozygous mice (H / H) were randomly selected. On days 0 and 7, all mice were intraperitoneally injected with 0.5 mg OVA peptide. 257–264 (Simga, A5503-25MG) and 50μg poly(I:C) (InvivoGen, tlrl-pic) were used for immunization. On the 14th day, all mice were euthanized, spleen tissues were collected, and spleen cells were obtained for enzyme-linked immunosorbent spot (ELISPOT) assay. Specifically, spleen tissues of wild-type C57BL / 6 mice (+ / +) and TRBC gene humanized homozygous mice (H / H) were ground with a 40μm cell sieve to obtain spleen cells, diluted to different concentrations and placed in 96-well plates, and divided into negative control groups (NC1 and NC2), treatment groups (G1, G2, G3, G4, G5, G6, G7 and G8) and positive control groups (PC1 and PC2) according to Table 5, and stimulants were added respectively. Specifically, different concentrations of OVA peptide were added to the treatment groups. 257–264 The negative control group was added with an equal volume of culture medium, and the positive control group was added with an equal volume of Cell Activation Cocktail (Biolegend, 423302) without Brefeldin A. The spleen cells and stimulators were incubated at 37°C and 5% CO 2 After 24 h of co-incubation under the same conditions, IFN-γ was detected by an ELISA instrument, and the spot-forming units (one spot-forming unit represents one active T cell secreting IFN-γ) were counted. The results are shown in Fig.11 shown.

[0201] Table 5 ELISPOT splenocyte grouping

[0202]

[0203]

[0204] When TRBC1 and TRBC2 proteins function normally, OVA peptide 257–264 After stimulation, the MHC class I molecule H-2Kb presents antigens to T cells, activates intracellular signaling pathways, and secretes IFN-γ. Fig.11 As shown, compared with wild-type C57BL / 6 mice (+ / +), there was no significant difference in the number of spot-forming units in TRBC gene humanized homozygous mice (H / H), indicating that TRBC gene humanized homozygous mice (H / H) had normal T cell immunogenicity similar to that of wild-type C57BL / 6 mice (+ / +). This indicates that the TRBC gene humanized mice prepared by this method can express humanized TRBC1 and TRBC2 proteins.

[0205] Example 2 Pharmacodynamic Model

[0206] The TRBC gene humanized mice prepared in Example 1 can be used to evaluate the in vivo safety and in vivo efficacy of regulators targeting human TRBC when used to treat tumor diseases. For example, homozygous TRBC humanized mice were subcutaneously inoculated with MC38 cells, and the tumor volume grew to about 100 mm. 3 The mice were then divided into a control group or a treatment group according to the tumor volume. The treatment group randomly selected drugs targeting human TRBC, and the control group was injected with an equal volume of saline. The tumor volume was measured regularly and the mice were weighed. By comparing the weight changes of the mice and the tumor size, the in vivo safety and in vivo efficacy of the compound can be effectively evaluated.

[0207] Example 3 Preparation of double-gene or multi-gene humanized mice

[0208] The TRBC gene humanized mouse prepared in Example 1 of the present application can also be used to prepare a multi-gene humanized mouse model. For example, in the aforementioned Example 1, the embryonic stem cells used for microinjection can be selected from mice containing at least one gene modification of NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1 or CTLA4, or, on the basis of humanized TRBC mice, the separation of mouse ES embryonic stem cells and gene recombination targeting technology can be used to obtain a double gene humanized or multi-gene humanized mouse model. The homozygous or heterozygous humanized mouse of the TRBC gene obtained in the present application can also be mated with other gene-modified mice, and the offspring can be screened. According to the Mendel's law of inheritance, there is a certain probability of obtaining a multi-gene mouse modified with the humanized TRBC gene and other genes, and then the heterozygotes can be mated with each other to obtain a homozygous modified by double genes or multiple genes.

[0209] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0210] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0211] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A method for constructing a genetically modified non-human animal, characterized in that: The genome of the non-human animal comprises at least one chromosome comprising a nucleotide sequence encoding a human or chimeric T cell receptor B chain constant region (TRBC) protein.

2. The construction method according to claim 1, characterized in that: The chromosome comprises a nucleotide sequence encoding a human or chimeric TRBC1 protein; Preferably, the chimeric TRBC1 protein comprises all or part of the extracellular region of the human TRBC1 protein; preferably, it also comprises all or part of the transmembrane region of the human TRBC1 protein; Further preferably, the amino acid sequence of the chimeric TRBC1 protein comprises SEQ ID NO: 2, positions 3-149 of SEQ ID NO: 2, positions 1-149 of SEQ ID NO: 2, or positions 1-163 of SEQ ID NO: 2; or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the amino acid sequence shown in SEQ ID NO: 2, positions 3-149 of SEQ ID NO: 2, positions 1-149 of SEQ ID NO: 2, or positions 1-163 of SEQ ID NO: 2; Preferably, the chimeric TRBC1 protein comprises a human or humanized extracellular region, a non-human animal endogenous or humanized transmembrane region, and a non-human animal endogenous cytoplasmic region; Preferably, the amino acid sequence of the chimeric TRBC1 protein comprises SEQ ID NO: 24, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to SEQ ID NO:

24.

3. The construction method according to claim 1 or 2, characterized in that: The chromosome also comprises a nucleotide sequence encoding a human or chimeric TRBC2 protein; Preferably, the chimeric TRBC2 protein comprises all or part of the extracellular region of the human TRBC2 protein, and preferably also comprises all or part of the transmembrane region of the human TRBC2 protein; Further preferably, the amino acid sequence of the chimeric TRBC2 protein comprises SEQ ID NO: 4, positions 3-144 of SEQ ID NO: 4, positions 1-149 of SEQ ID NO: 4, or positions 1-163 of SEQ ID NO: 4; or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the amino acid sequence shown in SEQ ID NO: 4, positions 3-144 of SEQ ID NO: 4, positions 1-149 of SEQ ID NO: 4, or positions 1-163 of SEQ ID NO: 4; Preferably, the chimeric TRBC2 protein comprises a human or humanized extracellular region, a non-human animal endogenous or humanized transmembrane region, and a non-human animal endogenous cytoplasmic region; Preferably, the amino acid sequence of the chimeric TRBC2 protein comprises SEQ ID NO:25, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to SEQ ID NO:

25.

4. A method for constructing a genetically modified non-human animal, characterized in that: At the non-human animal endogenous TRBC gene locus, the nucleotide sequence of the corresponding region of the non-human animal endogenous TRBC is replaced with a nucleotide sequence comprising human or chimeric TRBC.

5. The construction method according to claim 4, characterized in that: The nucleotide sequence comprising human or chimeric TRBC comprises a nucleotide sequence encoding a human or chimeric TRBC1 protein; preferably comprises a nucleotide sequence encoding all or part of the extracellular region of the human TRBC1 protein, and further preferably comprises a nucleotide sequence encoding all or part of the transmembrane region of the human TRBC1 protein; Preferably, the nucleotide sequence comprising human or chimeric TRBC comprises a portion of exon 1 to a portion of exon 3 of the human TRBC1 gene, wherein the portion of exon 1 of the human TRBC1 gene preferably comprises at least 5 bp of continuous nucleotide sequence; the portion of exon 3 of the human TRBC1 gene preferably comprises at least 5 bp of continuous nucleotide sequence; Preferably, the nucleotide sequence comprising human or chimeric TRBC comprises the nucleotide sequence of positions 142791702-142792735 of NCBI Accession No. NC_000007.14; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence of positions 142791702-142792735 of NCBI Accession No. NC_000007.

14.

6. The construction method according to claim 4 or 5, characterized in that: The nucleotide sequence comprising human or chimeric TRBC comprises a nucleotide sequence encoding a human or chimeric TRBC2 protein; preferably comprises a nucleotide sequence encoding all or part of the extracellular region of the human TRBC2 protein, and further preferably comprises a nucleotide sequence encoding all or part of the transmembrane region of the human TRBC2 protein; Preferably, the nucleotide sequence comprising human or chimeric TRBC comprises a portion of exon 1 to a portion of exon 3 of the human TRBC2 gene, wherein the portion of exon 1 of the human TRBC2 gene preferably comprises at least 5 bp of continuous nucleotide sequence; the portion of exon 3 of the human TRBC2 gene preferably comprises at least 5 bp of continuous nucleotide sequence; Preferably, the nucleotide sequence comprising human or chimeric TRBC comprises the nucleotide sequence 142801049-142802133 of NCBI Accession No. NC_000007.14 or a variant thereof; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence 142801049-142802133 of NCBI Accession No. NC_000007.14 or a variant thereof; Preferably, the variant comprises a mutation from G to A at position 142801129, a mutation from T to C at position 142802045 and a mutation from A to G at position 142802078.

7. The construction method according to any one of claims 4 to 6, characterized in that: The nucleotide sequence comprising human or chimeric TRBC further comprises a portion of exon 3 of an endogenous TRBC1 gene of a non-human animal to a portion of exon 1 of an endogenous TRBC2 gene of a non-human animal, wherein the portion of exon 3 of an endogenous TRBC1 gene of a non-human animal preferably comprises at least 5 bp of continuous nucleotide sequence, and the portion of exon 1 of an endogenous TRBC2 gene of a non-human animal preferably comprises at least 5 bp of continuous nucleotide sequence; Preferably, the nucleotide sequence comprising human or chimeric TRBC further comprises the nucleotide sequence at positions 41516207-41523671 of NCBI accession number NC_000072.7; or comprises a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to the nucleotide sequence at positions 41516207-41523671 of NCBI accession number NC_000072.7; Preferably, the nucleotide sequence comprising human or chimeric TRBC further comprises a portion of exon 3 to the entirety of exon 4 of an endogenous TRBC2 gene of a non-human animal, wherein the portion of exon 3 of an endogenous TRBC2 gene of a non-human animal preferably comprises at least 5 bp of continuous nucleotide sequence; Preferably, the nucleotide sequence comprising human or chimeric TRBC further comprises a nucleotide sequence from part of exon 3 to the stop codon of an endogenous TRBC2 gene of a non-human animal, further preferably further comprises a 3'UTR, and more preferably further comprises at least 5 bp of continuous nucleotide sequence downstream of the 3'UTR; Preferably, the nucleotide sequence comprising human or chimeric TRBC further comprises a continuous nucleotide sequence of at least 5 bp from a portion of exon 3 of the endogenous TRBC2 gene of a non-human animal to the downstream of the 3'UTR; Preferably, the nucleotide sequence comprising human or chimeric TRBC further comprises the nucleotide sequence at positions 41524735-41525760 of NCBI Accession Number NC_000072.7; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence at positions 41524735-41525760 of NCBI Accession Number NC_000072.

7.

8. The construction method according to any one of claims 4 to 7, characterized in that: The nucleotide sequence comprising human or chimeric TRBC comprises, from the 5' end to the 3' end, a portion of exon 1 to a portion of exon 3 of a human TRBC1 gene, a portion of exon 3 of an endogenous TRBC1 gene of a non-human animal to a portion of exon 1 of an endogenous TRBC2 gene of a non-human animal, a portion of exon 1 to a portion of exon 3 of a human TRBC2 gene, and a portion of exon 3 of an endogenous TRBC2 gene of a non-human animal to at least 5 bp of a continuous nucleotide sequence downstream of the 3'UTR; Preferably, the nucleotide sequence comprising human or chimeric TRBC comprises SEQ ID NO:7; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence shown in SEQ ID NO:

7.

9. The construction method according to any one of claims 4 to 8, characterized in that: The nucleotide sequence of the corresponding region of endogenous TRBC of a non-human animal comprises a nucleotide sequence encoding an endogenous TRBC1 protein of a non-human animal, preferably comprises a nucleotide sequence encoding all or part of the extracellular region of an endogenous TRBC1 protein of a non-human animal, and further preferably comprises a nucleotide sequence encoding all or part of the transmembrane region of an endogenous TRBC1 protein of a non-human animal; Preferably, the nucleotide sequence of the corresponding region of endogenous TRBC of a non-human animal comprises a nucleotide sequence encoding positions 1-145 of SEQ ID NO: 1, positions 3-145 of SEQ ID NO: 1, or positions 1-159 of SEQ ID NO: 1, or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to a nucleotide sequence encoding positions 1-145 of SEQ ID NO: 1, positions 3-145 of SEQ ID NO: 1, or positions 1-159 of SEQ ID NO: 1; Preferably, the nucleotide sequence of the corresponding region of endogenous TRBC of non-human animals includes part of exon 1 to part of exon 3 of the endogenous TRBC1 gene of non-human animals, wherein the part of exon 1 of the endogenous TRBC1 gene of non-human animals preferably contains at least 5bp of continuous nucleotide sequence; the part of exon 3 of the endogenous TRBC1 gene of non-human animals preferably contains at least 5bp of continuous nucleotide sequence.

10. The construction method according to any one of claims 4 to 9, characterized in that: The nucleotide sequence of the corresponding region of endogenous TRBC of a non-human animal comprises a nucleotide sequence encoding an endogenous TRBC2 protein of a non-human animal; preferably comprises a nucleotide sequence encoding all or part of the extracellular region of an endogenous TRBC2 protein of a non-human animal, and further preferably comprises a nucleotide sequence encoding all or part of the transmembrane region of an endogenous TRBC2 protein of a non-human animal; Preferably, the nucleotide sequence of the corresponding region of endogenous TRBC of a non-human animal comprises a nucleotide sequence encoding positions 1-145 of SEQ ID NO: 3, positions 3-145 of SEQ ID NO: 3, or positions 1-159 of SEQ ID NO: 3, or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to a nucleotide sequence encoding positions 1-145 of SEQ ID NO: 3, positions 3-145 of SEQ ID NO: 3, or positions 1-159 of SEQ ID NO: 3; Preferably, the nucleotide sequence of the corresponding region of the endogenous TRBC of the non-human animal includes a portion of exon 1 to a portion of exon 3 of the endogenous TRBC2 gene of the non-human animal, wherein the portion of exon 1 of the endogenous TRBC2 gene of the non-human animal preferably contains at least 5bp of continuous nucleotide sequence; the portion of exon 3 of the endogenous TRBC2 gene of the non-human animal preferably contains at least 5bp of continuous nucleotide sequence.

11. The construction method according to any one of claims 4 to 10, characterized in that: The nucleotide sequence of the corresponding region of the endogenous TRBC of the non-human animal includes a part of exon 1 of the endogenous TRBC1 gene of the non-human animal to at least 5 bp of continuous nucleotide sequence downstream of the 3'UTR of the endogenous TRBC2 gene of the non-human animal.

12. The construction method according to any one of claims 1 to 11, characterized in that: The nucleotide sequence encoding human or chimeric TRBC protein, or, the nucleotide sequence comprising human or chimeric TRBC is operably linked to an endogenous regulatory element (eg, a promoter, 5'UTR and / or 3'UTR) of an endogenous TRBC locus; Preferably, the endogenous TRBC protein of the non-human animal is not expressed or is expressed at a reduced level compared to TRBC in wild-type animals; Preferably, the modified TRBC gene in the genome of the non-human animal is homozygous or heterozygous for the endogenous replaced locus.

13. The construction method according to any one of claims 1 to 12, characterized in that: The non-human animal is a mammal, such as a monkey or a rodent; preferably, the rodent includes a mouse or a rat; Preferably, the mRNA transcribed from the modified TRBC1 gene in the genome of the non-human animal comprises SEQ ID NO: 26; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence of SEQ ID NO: 26; Preferably, the mRNA transcribed from the modified TRBC2 gene in the genome of the non-human animal comprises SEQ ID NO: 27; or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence of SEQ ID NO: 27; Preferably, the non-human animal further comprises a nucleotide sequence encoding other human or chimeric proteins, and the other human or chimeric proteins preferably comprise at least one of NKG2D, TFR1, NKP46, ICOS, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1 or CTLA4.

14. A method for determining the effectiveness or toxicity of a therapeutic agent in treating a disease, characterized in that: The method comprises: 1) administering a therapeutic agent to a non-human animal obtained by the construction method according to any one of claims 1 to 13; 2) Determine the effect of therapeutic agents on non-human animals or diseases; Preferably, the therapeutic agent comprises an antibody targeting TRBC, a nucleic acid drug targeting TRBC and / or a polypeptide drug; Further preferably, the therapeutic agent further comprises an additional therapeutic agent, and the additional therapeutic agent preferably comprises one or more of an anti-PD-1 antibody, an anti-PD-L1 antibody or an anti-CTLA4 antibody; Preferably, the disease is a tumor; Preferably, the tumor comprises a solid tumor or a hematological tumor; Further preferably, the tumor includes one or more of glioma, leukemia, female reproductive system cancer, breast cancer, melanoma, lymphocyte tumor (such as T cell tumor), head and neck cancer, liver cancer or lung cancer.

15. A humanized TRBC protein, characterized in that: The humanized TRBC protein comprises all or part of the human TRBC1 protein, preferably comprises all or part of the extracellular region of the human TRBC1 protein; Preferably, the humanized TRBC protein comprises a humanized TRBC1 protein; Preferably, the amino acid sequence of the humanized TRBC1 protein comprises SEQ ID NO: 24, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the amino acid sequence of SEQ ID NO: 24; Preferably, the humanized TRBC protein further comprises all or part of the human TRBC2 protein; further preferably comprises all or part of the extracellular region of the human TRBC2 protein; Preferably, the humanized TRBC protein comprises a humanized TRBC2 protein; Preferably, the amino acid sequence of the humanized TRBC2 protein comprises SEQ ID NO: 25, or comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the amino acid sequence shown in SEQ ID NO:

25.

16. A humanized TRBC gene, characterized in that: The humanized TRBC gene encodes the humanized TRBC protein according to claim 15; Preferably, the humanized TRBC gene comprises a portion from exon 1 to exon 3 of the human TRBC1 gene, wherein the portion of exon 1 of the human TRBC1 gene preferably comprises at least 5 bp of continuous nucleotide sequence; the portion of exon 3 of the human TRBC1 gene preferably comprises at least 5 bp of continuous nucleotide sequence; Preferably, the humanized TRBC gene comprises a portion from exon 1 to exon 3 of the human TRBC2 gene, wherein the portion of exon 1 of the human TRBC2 gene preferably comprises at least 5 bp of continuous nucleotide sequence; the portion of exon 3 of the human TRBC2 gene preferably comprises at least 5 bp of continuous nucleotide sequence; Preferably, the humanized TRBC gene comprises SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 26, 27, 28, 29, 30, the nucleotide sequence of positions 142791702-142792735 of NCBI accession number NC_000007.14, the nucleotide sequence of positions 41516207-41523671 of NCBI accession number NC_000072.7, the nucleotide sequence of positions 142801049-142802133 of NCBI accession number NC_000007.14 or a variant thereof, or the nucleotide sequence of positions 41524735-41525760 of NCBI accession number NC_000072.7; or comprises the nucleotide sequence of positions 142801049-142802133 of NCBI accession number NC_000072.7; NO: 5, 6, 7, 8, 9, 10, 11, 26, 27, 28, 29, 30, the nucleotide sequence of positions 142791702-142792735 of NCBI Accession No. NC_000007.14, the nucleotide sequence of positions 41516207-41523671 of NCBI Accession No. NC_000072.7, the nucleotide sequence of positions 142801049-142802133 of NCBI Accession No. NC_000007.14 or a variant thereof, or the nucleotide sequence of positions 41524735-41525760 of NCBI Accession No. NC_000072.7 with a nucleotide sequence identity of at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5%; Preferably, the variant comprises a mutation from G to A at position 142801129, a mutation from T to C at position 142802045 and a mutation from A to G at position 142802078.

17. A cell, tissue or organ, characterized in that: The cell, tissue or organ expresses the humanized TRBC protein according to claim 15, and / or the genome of the cell, tissue or organ contains the humanized TRBC gene according to claim 16.

18. Use of the non-human animal obtained by the construction method according to any one of claims 1 to 13, the humanized TRBC protein according to claim 15, the humanized TRBC gene according to claim 16, or the cell, tissue or organ according to claim 17, characterized in that: The applications described include: A) Application in product development for TRBC-related immune processes involving human cells; B) Application as a model system relevant to TRBC for pharmacological, immunological, microbiological and medical research; C) Applications involving the production and use of animal experimental disease models for etiological studies related to TRBC and / or for the development of diagnostic strategies and / or for the development of therapeutic strategies; D) in vivo studies on the screening, efficacy testing, efficacy assessment, validation or evaluation of modulators of human TRBC signaling pathways; or, E) Study the function of TRBC gene, study the drugs and efficacy targeting human TRBC target sites, and study the application of TRBC-related tumor treatment drugs.

Images