Method for constructing pleural mesothelioma animal model for simulating immunotherapy response and application of pleural mesothelioma animal model
Through organoids and gene editing technology, a pleural mesothelioma mouse model that can efficiently simulate the characteristics of pleural mesothelioma and respond to drug treatment was constructed, solving the problems of long model preparation cycle and low tumor growth rate in the prior art, and achieving 100% construction success rate and highly consistent tumor simulation.
Patent Information
- Application Number
- CN202510243996.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-03
- Publication Date
- 2025-06-06
AI Technical Summary
It is difficult for the prior art to effectively construct an animal model that simulates the characteristics of pleural mesothelioma and responds to clinical drug treatment, and the existing models have problems such as long preparation cycle, low tumor growth rate, and high cost.
Using organoids and gene editing technology, human or mouse lung cells are cultured into organoids, and genetically modified, knocked out tumor suppressor genes, and overexpressed Sox2 and Myc genes, a cell suspension that highly simulates the characteristics of pleural mesothelioma was prepared and injected into the lungs of the mouse to construct a pleural mesothelioma mouse model.
A pleural mesothelioma mouse model with rapid preparation and 100% construction success rate was achieved, which can dynamically display the entire picture of the tumor from initiation to development, highly consistent with the real tumor development, and is suitable for drug screening, toxicity assessment and immunotherapy trials.
Smart Images

Figure CN120099102A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of tumor animal models, and in particular to a pleural mesothelioma mouse animal model that can simulate the drug response of patients, has a short preparation cycle and is highly efficient. The present invention belongs to the field of genetic engineering technology, and in particular belongs to the scope of tumor animal model research. Background Art
[0002] Pleural mesothelioma can occur anywhere in the visceral and parietal pleura, regardless of age, but the high-risk age group is between 40 and 60 years old, and its incidence is increasing year by year. Malignant pleural mesothelioma is extremely invasive, and when patients are diagnosed, they usually have progressed to the late stage (stage III-IV), resulting in limited effectiveness of local treatments such as surgery and radiotherapy, and there is currently a lack of ideal treatment strategies.
[0003] The pleural mesothelioma cell model is a key tool for exploring the disease mechanism and evaluating drug efficacy. However, long-term culture often leads to genetic information variation in the model cells, such as the loss or increase of chromosome fragments. Given that both normal tissues and tumors show significant heterogeneity, a single cell line is difficult to fully reflect the complex conditions in the body, and genetic differences in drug response cannot accurately simulate the actual situation of pleural mesothelioma patients.
[0004] Although animal models are more realistic in simulating pleural mesothelioma, existing models have their own limitations.
[0005] The subcutaneous transplantation model requires a large number of tumor cell lines to be implanted subcutaneously into immunodeficient mice. However, these cell lines are difficult to accurately represent the characteristics of the patient's tumor, and the subcutaneous tumor environment cannot reflect the true ecology of the lung tissue.
[0006] The gene knockout mouse model has a clear background, but has a low tumor formation rate, high mortality before modeling, high cost and a long breeding cycle.
[0007] The patient-derived tumor xenograft (PDX) model also faces the limitation of subcutaneous transplantation. In addition, due to individual differences among patients and differences in sample collection, the success rate of the model is highly dependent on the sample quality. In addition, the breeding cost of severely immunodeficient mice is high and the technical difficulty is great.
[0008] Chinese invention patent CN112852714B discloses a method for constructing an in situ primary lung cancer animal model, which is to culture mouse lung cells into organoids in a specific culture medium, then gene-edit the organoids and inject them back into the mouse lungs to develop them into tumors. However, the in situ tumor animal model of small cell lung cancer in this patent method is different from the pathogenesis of pleural mesothelioma. The animal model constructed by this method cannot simulate the pathogenesis of pleural mesothelioma and cannot be used for the development of treatment technology and drugs for pleural mesothelioma. Summary of the invention
[0009] In view of the shortcomings of the existing technology for simulating pleural mesothelioma animal models, the present invention aims to provide a novel method for constructing a pleural mesothelioma mouse animal model, which can efficiently prepare a model that highly simulates the characteristics of pleural mesothelioma and responds to clinical drug treatment.
[0010] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions:
[0011] A method for constructing a pleural mesothelioma mouse animal model comprises the following steps:
[0012] S1. Cultivate human or mouse lung cells into the first organoids;
[0013] S2, resuspending and digesting the first type of organ with TrypLE into single cells, and genetically modifying them; then culturing the genetically modified lung cells into the second type of organ;
[0014] Genetic modification refers to gene editing, which can be one of the following:
[0015] I. Knockout of Trp53, Pten, Cdkn2a, and Cdkn2b genes, and overexpression of Sox2 mutant gene and Myc gene;
[0016] II. Knock out Trp53, Pten, Cdkn2a, Cdkn2b, and Bap1 genes, and overexpress Sox2 mutant gene and Myc gene.
[0017] S3, resuspending and digesting the second type of organ to prepare a cell suspension;
[0018] S4. Anesthetize the mouse, cut the skin, muscle and fascia along the left / right chest of the mouse, and find the intercostal space; use an insulin needle to extract the cell suspension obtained in S3, hold the insulin needle with the syringe almost perpendicular to the intercostal muscle, push the insulin needle piston, and inject the cell suspension into the visceral pleura of the mouse.
[0019] S5. Cultivate the mice obtained in S4 for 90-120 days to construct a pleural mesothelioma mouse model.
[0020] The present invention uses organoids and gene editing technology to develop a new pleural mesothelioma model. In view of the difficulty in constructing a pleural mesothelioma mouse animal model, mouse lung cells activated by organoids are digested and resuspended, and lung cells in a suitable active state are selected. Then, genetic modification is carried out to knock out tumor suppressor genes, and the second organoid is cultured again to form a second organoid. The resuspended and digested cell suspension is used for injection into the intercostal lung tissue of mice. Different from the traditional subcutaneous injection model, which has a low success rate, this model has the characteristics of rapid preparation and the ability to simulate immunotherapy responses, and is closer to the tumor microenvironment and anti-tumor treatment effects of clinical patients.
[0021] Further, the method further includes S6, after the pleural mesothelioma mouse model constructed in S5 is successfully constructed, extracting the pleural mesothelioma tissue of the model mouse, preparing a single cell suspension, and injecting the suspension into the lungs of another mouse, and constructing more pleural mesothelioma mouse models.
[0022] Further, in S1, mouse lung cells are cultured into a first type of organ, specifically by the following method: mixing lung cells with Matrigel, adding organoid culture medium for culture after Matrigel solidifies, and obtaining a first type of organ. For example, mouse lung tissue is cultured to obtain mouse lung organoids, which are recorded as the first type of organ and distinguished from the second type of organ cultured by cells after subsequent genetic modification.
[0023] The organoid culture medium is based on DMEM / F12 and is supplemented with the following compound additives.
[0024] Compound additive ingredients Addition amount B27 50±5 times concentration dilution N-acetylcysteine 1±0.1mM EGF 50±5ng / mL Noggin 100±10ng / mL R-spondin 1 250±25ng / mL A83-01 200±20nM FGF10 500±50ng / mL Nicotinamide 10±1mM Y-27632 10±1uM WNT3a 25±2.5ng / mL Glutamax 100±10 times concentration dilution N2 100±10 times concentration dilution
[0025] In the table,
[0026] M stands for molar concentration, which refers to the amount of solute contained in a unit volume of solution, and its unit is mol / L.
[0027] mM stands for millimolar concentration, and its unit is mmol / L.
[0028] uM stands for micromolar concentration, and its unit is umol / L.
[0029] 50-fold dilution means that the concentration of the added corresponding component in the prepared final solution is diluted 50 times the original concentration of the component.
[0030] 100-fold dilution means that the amount of the added component is diluted 100 times the original concentration of the component in the final solution. For example, if N2 is diluted 100 times, then every 100 parts of the composite additive contains 1 part of N2 stock solution.
[0031] Furthermore, in S1, lung cells were isolated by the following method: using final concentrations of 1 mg / mL collagenase I and 0.5 mg / mL collagenase IV to digest lung tissue blocks; filtering using a 100 μm mesh to obtain single cells, washing with DMEM / F12 medium, and centrifuging to terminate the enzymatic digestion reaction.
[0032] Preferably, animal lung cells are primary cultured and then used to culture the first organoid.
[0033] Furthermore, in S2, the genetic modification refers to knocking out tumor suppressor genes and / or increasing the copy number of oncogenes.
[0034] CRISPR / Cas9 technology was used to knock out the Trp53, Pten, Cdkn2a, Cdkn2b, and Bap1 genes.
[0035] Specifically:
[0036] The Trp53 gene was knocked out by CRISPR / Cas9 and the sgRNA method was used for knockout. The sgRNA sequences used were sgTrp53-F and sgTrp53-R.
[0037] The nucleotide sequence of sgTrp53-F is shown in SEQ ID NO.1;
[0038] The nucleotide sequence of sgTrp53-R is shown in SEQ ID NO.2.
[0039] The Pten gene was knocked out using CRISPR / Cas9 and the sgRNA method, and the sgRNA sequences used were sgPten-F and sgPten-R.
[0040] The nucleotide sequence of sgPten-F is shown in SEQ ID NO.3.
[0041] The nucleotide sequence of sgPten-R is shown in SEQ ID NO.4.
[0042] CRISPR / Cas9 was used to knock out the Cdkn2a gene, and the sgRNA method was used for knockout. The sgRNA sequences used were sgCdkn2a-F and sgCdkn2a-R.
[0043] The nucleotide sequence of sgCdkn2a-F is shown in SEQ ID NO.5.
[0044] The nucleotide sequence of sgCdkn2a-R is shown in SEQ ID NO.6.
[0045] CRISPR / Cas9 was used to knock out the Cdkn2b gene, and the sgRNA method was used for knockout. The sgRNA sequences used were sgCdkn2b-F and sgCdkn2b-R.
[0046] The nucleotide sequence of sgCdkn2b-F is shown in SEQ ID NO.7.
[0047] The nucleotide sequence of sgCdkn2b-R is shown in SEQ ID NO.8.
[0048] The Bap1 gene was knocked out by CRISPR / Cas9 and the sgRNA method was used for knockout. The sgRNA sequences used were sgBap1-F and sgBap1-R.
[0049] The nucleotide sequence of sgBap1-F is shown in SEQ ID NO.9.
[0050] The nucleotide sequence of sgBap1-R is shown in SEQ ID NO.10.
[0051] SEQ ID No. sgRNA primers Sequence (5'-3') 1 sgTrp53-F gtgaagccctccgagtgtc 2 sgTrp53-R gacactcggagggcttcac 3 sgPten-F aacaaaaggagatatcaag 4 sgPten-R cttgatatctccttttgttc 5 sgCdkn2a-F ggtacgaccgaaagagttcg 6 sgCdkn2a-R cgaactctttcggtcgtacc 7 sgCdkn2b-F ttgggcggcagcagtgacg 8 sgCdkn2b-R cgtcactgctgccgcccaa 9 sgBap1-F cgccgcaaggtttctacgt 10 sgBap1-R acgtagaaaccttgcggcg 13 sgScarmble-F acatttctttccccactgg 14 sgScarmble-R ccagtggggaaagaaatgtc
[0052] Then, Myc gene and Sox2 gene were introduced so that the cells overexpressed Myc gene and Sox2 gene.
[0053] Furthermore, in S2, the nucleotide sequence of the Myc gene is shown as SEQ ID NO.11, and the nucleotide sequence of the overexpressed Sox2 gene is shown as SEQ ID NO.12.
[0054]
[0055] Sox2 gene, SEQ ID NO.12 Sequence 5'-3': gatctatgtataacatgatggagacggagctgaagccgccgggcccgca gcaagcttcggggggcggcggcggaggaggcaacgccacggcggcggcgaccggcggcaaccagaagaacagcccggaccgcgtcaagaggcccatgaacgccttcatggtatggtcccgggggcagcggcgtaagatggcccaggagaaccccaagatgcacaactcggagatcagcaagcgcctgggcgcggagtggaaacttttgtccgagaccgagaagcggccgttcatcgacgaggccaagcggctgcgcgctctgcacatgaaggagcacccggattataaataccggccgcggcggaaaaccaagacgctcatgaagaaggataagtacacgcttcccggaggcttgctggcccccggcgggaacagcatggcgagcggggttggggtgggcgccggcctgggtgcgggcgtgaaccagcgcatggacagctacgcgcacatgaacggctggagcaacggcagctacagcatgatgcaggagcagctgggctacccgcagcacccgggcctcaacgctcacggcgcggcacagatg caaccgatgcaccgctacgacgtcagcgccctgcagtacaactccatgaccagctcgcagacctacatgaacggctcgcccacctacagcatgtcctactcgcagcagggcacccccggtatggcgctgggctccatgggctctgtggtcaagtccgaggccagctccagcccccccgtggttacctcttcctcccactccagggcgccctgccaggccggggacctccgggacatgatcagcatgtacctccccggcgccgaggtgccggagcccgctgcgcccagtagactgcacatggcccagcactaccagagcggcccggtgcccggcacggccattaacggcacactgcccctgtcgcacatgtgattaacgaatt, 975bp.
[0056] Furthermore, in S2, gene editing also includes the introduction of fluorescent marker genes into organoids.
[0057] Furthermore, in S2, the genetically modified lung cells are cultured into a second type of organ. The specific method is as follows: the genetically modified lung cells are mixed with Matrigel, and after the Matrigel solidifies, organoid culture medium is added for culture to obtain the second type of organ.
[0058] Furthermore, in S1, mouse lung cells were used.
[0059] Application of the animal model prepared by the above method in the screening of anti-lung cancer and pleural mesothelioma drugs, toxicity evaluation and immunotherapy experiments. That is, the animal model preparation method described above is suitable for the screening of anti-lung cancer and pleural mesothelioma drugs, toxicity evaluation and immunotherapy experiments.
[0060] Compared with genetically engineered animal models, the tumor model constructed by the present invention not only has a significantly shortened preparation cycle, but also almost avoids the death of animals before tumor formation, achieving a 100% construction success rate. The new pleural mesothelioma mouse model created can simulate the normal cell carcinogenesis process driven by genetic mutations in the human body, and dynamically display the full picture of the tumor from initiation to development. In terms of genetic characteristics, tumor microenvironment, tumor evolution and pathophysiology, the model is highly consistent with the actual tumor development.
[0061] In summary, compared with the prior art, the present invention has achieved the following technical effects:
[0062] The method of the present invention innovatively proposes a pleural mesothelioma model construction technology, focusing on simulating the patient's pathological conditions and clinical drug responses. It uses specific culture conditions to promote the development of normal lung cells in mice into organoid morphology, and then genetically modifies these organoids and re-implants the modified cells into the mouse lungs to induce them to develop into pleural mesothelioma. Compared with traditional genetically engineered tumor animal models, it not only has a shorter preparation cycle and a higher tumor formation efficiency, but more importantly, it can effectively simulate the drug response characteristics of clinical patients.
[0063] Therefore, the method of the present invention can efficiently prepare a model that highly simulates the characteristics of pleural mesothelioma and responds to clinical drug treatment, meeting the needs of clinical research. This model provides a powerful tool for researchers in exploring the pathogenesis of pleural mesothelioma, finding and optimizing new treatment methods, etc. Obviously, based on the core concept of the present invention, combined with technical knowledge and conventional means in this field, various forms of adjustment, replacement or innovation can be carried out without deviating from the basic technical ideas.
[0064] Compared with the transplanted tumor animal model, the animal model constructed by the method of the present invention has higher accuracy in simulating the real clinical patient conditions because it retains the natural microenvironment of tumor occurrence and development in the body. BRIEF DESCRIPTION OF THE DRAWINGS
[0065] Figure 1 Schematic diagram of the process for constructing the mouse model.
[0066] Figure 2 This is the result diagram of T7 gene editing.
[0067] Figure 3 Photo of gene-edited organoids.
[0068] Figure 4 This is a live tumor imaging image.
[0069] Figure 5 This is a stereo fluorescence microscope detection image.
[0070] Figure 6 HE staining of tumor.
[0071] Figure 7 This is an immunohistochemical detection diagram. DETAILED DESCRIPTION
[0072] The present invention will be described in more detail below through specific examples. However, please note that these examples should not be regarded as limiting the scope of the present invention. Any technical innovation based on the concept of the present invention should be regarded as an integral part of the present invention.
[0073] The terms "horizontal", "vertical", "parallel", etc. in the present invention do not mean that the corresponding devices / components / elements are required to be absolutely horizontal, vertical or parallel, but can be slightly tilted or have deviations. It can be simply understood that the corresponding devices / components / elements are set in the "horizontal", "vertical", "parallel" and other directions, and can have an error / deviation of ±10% relative to the corresponding direction setting, more preferably an error / deviation within ±8%, more preferably an error / deviation within ±6%, more preferably an error / deviation within ±5%, and more preferably an error / deviation within ±4%. As long as the corresponding device / component / element is within the error / deviation range, it can still achieve its role in the scheme of the present invention.
[0074] The specifications and models of reagents used in the following embodiments / comparative examples of the present invention are as follows, including various culture media and biochemical reagents.
[0075] Specifically, some English abbreviations are explained as follows:
[0076] DMEM: It is a widely used culture medium that can be used for many mammalian cell cultures. It was purchased from GIBCO.
[0077] F12: F12 medium (Ham's F 12 nutrient medium) is an animal cell culture medium purchased from GIBCO.
[0078] DMEM / F12: F12 medium and DMEM medium are combined in a 1:1 ratio, called DMEM / F12 medium. It combines the advantages of F12 containing richer ingredients and DMEM containing higher concentrations of nutrients. It was purchased from GIBCO.
[0079] Matrigel: isolated from EHS mouse tumors rich in extracellular matrix proteins, its main components are laminin, type IV collagen, nestin, heparin sulfate glycoprotein, etc., and also contains growth factors and matrix metalloproteinases. Purchased from BD.
[0080] B27: B27 supplement, a commercial product, can be used to prepare culture medium. It contains biotin, cholesterol, linoleic acid, linolenic acid, progesterone, putrescine, retinol, retinol acetate, sodium selenite, triiodothyronine (T3), DL-α-tocopherol (vitamin E), albumin, insulin and transferrin, and the balance is other ingredients. B27 supplement is provided as a 50-fold liquid concentrate and is purchased from Life Technologies.
[0081] N-acetylcysteine: N-acetylcysteine was purchased from Sigma.
[0082] EGF: epidermal growth factor, a commercially available product purchased from R&D Company.
[0083] Noggin: a cell growth protein component, a commercially available product purchased from Peprotech.
[0084] R-spondin 1: a human cell growth-encoded protein, a commercial product purchased from Peprotech.
[0085] A83-01: TGF-β inhibitor, purchased from Tocris Bioscience.
[0086] FGF10: fibroblast growth factor, purchased from Peprotech.
[0087] Nicotinamide: Nicotinamide, purchased from Sigma.
[0088] Y-27632*: ROCK specific pathway blocker, purchased from Abmole Bioscience.
[0089] WNT3a: WNT agonist, a factor that activates TCF / LEF-mediated transcription in cells, purchased from PeproTech.
[0090] Glutamax: A commercially available cell culture supplement purchased from GIBCO.
[0091] N2: N2 supplement, provided as a 100-fold liquid concentrate, containing 500 μg / mL human transferrin, 500 μg / mL, purchased from GIBCO.
[0092] TrypLE: a recombinant digestion enzyme used to dissociate adherent mammalian cells, purchased from GIBCO.
[0093] Collagenase I: Type I collagenase is a crude collagenase preparation that can be used to isolate primary cells or for tissue separation by enzymatic methods. It is used to isolate cells in culture and has been successfully used to pass down human embryonic stem cells cultured in Millipore's HEScGROTM animal component-free medium, purchased from GIBCO.
[0094] Collagenase IV: also known as type IV collagenase, can be used to isolate primary cells or perform tissue separation by enzymatic methods, purchased from GIBCO.
[0095] The sgRNA sequences used in the Examples / Comparative Examples of the present invention are summarized in Table 1 below.
[0096] Table 1 Summary of sgRNA sequences
[0097]
[0098]
[0099] Note: sgRNA knockout is a single-site knockout on the genome. The subsequent non-homologous repair of the cell will cause garbled gene sequences, affecting genes by 1.3kb-1MB. It is a random event and there is no specific fragment length.
[0100] The Myc gene and Sox2 gene sequences used in the following examples / comparative examples of the present invention are summarized in Table 2 below.
[0101] Table 2 Sequences of Myc and Sox2 genes introduced for overexpression
[0102]
[0103]
[0104] Example 1
[0105] Method for establishing mouse pleural mesothelioma model
[0106] The first step is to culture ordinary lung cell organoids, that is, to culture the first type of organ.
[0107] In this example, mouse lung tissue was used for the experiment. The first lung organoid was prepared from fresh mouse lung tissue in the following steps:
[0108] (1) Take fresh mouse lung tissue and cut it into small pieces on ice.
[0109] (2) Resuspend the chopped tissue pieces with collagenase (1 mg / mL collagenase I and 0.5 mg / mL collagenase IV) and use gentalMACS TM The fully automatic tissue processor runs the Mouse Tumor program 1 in the C tube; wherein the amount of chopped tissue blocks is 1 to 2 grams, and the amount of collagenase is 10 mL.
[0110] (3) The collagenase-treated tissue blocks were shaken at 37°C at 220 rpm for 30 min to allow the tissue cells to be fully dispersed.
[0111] (4) Transfer the digested solution to the fully automated tissue processor gentalMACS TM On. In gentalMACS TM , run the Mouse Lung program.
[0112] (5) filtering the liquid containing lung tissue cells treated in step (4) through a 100 μm cell sieve;
[0113] (6) After filtration, centrifuge at room temperature, 1500 rpm, for 5 min to remove the supernatant;
[0114] (7) Add 5 mL of DMEM / F12 to resuspend, centrifuge at room temperature, 1500 rpm, for 5 min, and remove the supernatant;
[0115] (8) After cell counting, 30 μL of Matrigel was mixed for every 15,000-25,000 cells and dropped in the center of a 48-well plate well;
[0116] (9) Transfer to 37°C 5% CO 2 Incubator to solidify Matrigel for 10-20 min.
[0117] (10) Add 150 μL of cell culture medium to each well and culture in a cell culture incubator. The cell culture medium is an organoid culture medium. The organoid culture medium is prepared by adding DMEM / F12 and the compound additives shown in Table 3.
[0118] Table 3 Composition of organoid culture medium composite supplement
[0119] Compound additive ingredients Addition amount B27 50-fold dilution N-acetylcysteine 1mM EGF 50ng / mL Noggin 100ng / mL R-spondin 1 250ng / mL or 30% conditioned medium A83-01 200nM FGF10 500ng / mL Nicotinamide 10mM Y-27632* 10uM WNT3a 25 ng / mL or 10% conditioned medium Glutamax 100-fold dilution N2 100-fold dilution
[0120] Note 1:
[0121] In the table, M represents molar concentration, which refers to the amount of solute contained in a unit volume of solution, and its unit is mol / L. mM represents millimolar concentration, and its unit is mmol / L; uM represents micromolar concentration, and its unit is umol / L.
[0122] Note 2:
[0123] 50 times dilution means that the concentration of the added component in the final solution is 50 times the original concentration of the component. 100 times dilution means that the concentration of the added component in the final solution is 100 times the original concentration of the component. For example, if N2 is diluted 100 times, then every 100 parts of the composite additive contains 1 part of N2 stock solution.
[0124] (11) The culture medium is replaced every 2-3 days, i.e., the organoid culture medium in step (10), to culture normal mouse lung organoids, i.e., the first type of organ.
[0125] (12) Take organoids that have been cultured for about 7 days, resuspend and digest the organoids with TrypLE, transfer them to a 15-mL centrifuge tube, and add 3 mL of TrypLE to one well of a 48-well plate. Pipette 10 to 20 times until the matrix gel is completely broken up, and digest in a 37°C water bath for 5 min.
[0126] (13) Remove from the water bath, blow and beat again 20 to 30 times, digest at 37°C for 5 minutes, and then blow and beat for a third time (20 to 30 times). When observing the organoids under a microscope, digestion will be into single cells. If single cells are not formed, repeat the water bath and blow and beat until they become single cells.
[0127] (14) Centrifuge at 1500 rpm at room temperature for 5 min and remove the supernatant.
[0128] (15) After cell counting, 30 μL of Matrigel was added for every 2000 cells to resuspend the cells and the cells were dropped into the wells of a 48-well plate.
[0129] (16) Transfer to an incubator and allow the Matrigel to solidify for 10-20 min.
[0130] (17) Add 150 μL of the cell culture medium shown in Table 1 to each well and incubate at 37°C with 5% CO 2 Culture in a cell culture incubator.
[0131] (18) The culture medium was replaced every 2-3 days to culture a sufficient number of mouse lung organoids, i.e., the first type of organoids.
[0132] The second step is gene editing.
[0133] The first type of organ obtained in the first step is genetically modified, mainly including digesting the organoid into single cells, and then knocking out tumor suppressor genes and / or introducing oncogenes.
[0134] The specific steps are as follows:
[0135] (1) Take the first organoid cultured for about two weeks, resuspend the digested organoid with TrypLE, transfer it to a 15 mL centrifuge tube, add 3 mL of TrypLE to one well of a 48-well plate, pipette 10 to 20 times until the matrix gel is completely broken up, and digest it in a 37°C water bath for 5 min;
[0136] (2) Remove from the water bath, blow and beat again 15-20 times, digest at 37℃ for 5 minutes, and then blow and beat for the third time (15-20 times). When observing the organoids under a microscope, digestion will be into single cells. If single cells are not formed, repeat the water bath and blow and beat until they become single cells.
[0137] Centrifuge at 1500 rpm at room temperature for 5 min and remove the supernatant.
[0138] (3) First, add 400 μL-800 μL of retrovirus or lentivirus to one well of a 24-well plate. According to the experimental requirements, take 100 μL-200 μL of DMEM / F12 to resuspend the digested organoid cells and add them to the 24-well plate to which the virus was previously added. The virus carries the gene encoding Cas9 in the CRISPR / Cas9 technology and the sgRNA targeting the tumor suppressor gene; and / or, the virus carries an oncogene.
[0139] In this example, CRISPR / Cas9 technology was used to knock out tumor suppressor genes Trp53, Pten, Cdkn2a, and Cdkn2b; and lentivirus was used to introduce oncogenes Sox2 and Myc to achieve overexpression of Sox2 and Myc genes.
[0140] The Trp53 gene was knocked out by CRISPR / Cas9 and the sgRNA method was used for knockout. The sgRNA sequences used were sgTrp53-F and sgTrp53-R. The nucleotide sequence of sgTrp53-F is shown in SEQ ID NO.1; the nucleotide sequence of sgTrp53-R is shown in SEQ ID NO.2.
[0141] The Pten gene was knocked out using CRISPR / Cas9 and the sgRNA method, and the sgRNA sequences used were sgPten-F and sgPten-R. The nucleotide sequence of sgPten-F is shown in SEQ ID NO.3; the nucleotide sequence of sgPten-R is shown in SEQ ID NO.4.
[0142] CRISPR / Cas9 was used to knock out the Cdkn2a gene, and the sgRNA method was used for knockout. The sgRNA sequences used were sgCdkn2a-F and sgCdkn2a-R. The nucleotide sequence of sgCdkn2a-F is shown in SEQ ID NO.5; the nucleotide sequence of sgCdkn2a-R is shown in SEQ ID NO.6.
[0143] CRISPR / Cas9 was used to knock out the Cdkn2b gene, and the sgRNA method was used for knockout. The sgRNA sequences used were sgCdkn2b-F and sgCdkn2b-R. The nucleotide sequence of sgCdkn2b-F is shown in SEQ ID NO.7; the nucleotide sequence of sgCdkn2b-R is shown in SEQ ID NO.8
[0144] Then, Myc and Sox2 genes were introduced for overexpression, wherein the nucleotide sequence of the Myc gene is shown in SEQ ID NO.11, and the nucleotide sequence of the Sox2 gene is shown in SEQ ID NO.12.
[0145] (4) Add polybrene at 1:1000, centrifuge at 2000 rpm, 31°C for 60 min; transfer to an incubator and incubate for 2 h. Polybrene is a polycationic polymer that is commonly used in DNA transfection experiments in mammalian cells to enhance the transfection efficiency of liposomes. Polybrene is currently widely used in retrovirus-mediated gene transfection and lentivirus-mediated gene transfection. Its mechanism of action may be to promote adsorption by neutralizing the electrostatic repulsion between cell surface sialic acid and viral particles.
[0146] (5) Then collect the cells, centrifuge at 1500 rpm at room temperature for 5 min, remove the supernatant, and use appropriate amount of Resuspend and drop into the wells of a 48-well plate; transfer to an incubator to solidify Matrigel for 10-20 minutes;
[0147] (6) Add 150 μL of organoid culture medium (same as above, DMEM / F12, plus the organoid culture medium additive components in Table 1) to each well and incubate at 37°C, 5% CO 2Culture in a cell culture incubator; replace the culture medium every 2-3 days.
[0148] (7) When the cells grow to a density of 70% to 80%, add 10 μL of luciferase substrate to the wells and incubate at 37°C in the dark for 10 min. Use a microplate reader to detect the intensity of the luciferase signal to confirm that Myc and Sox2 editing is successful.
[0149] (8) During the passage, approximately 1 million cells were taken, digested with TNES and proteinase K, the cell genome was extracted, and T7E1 enzyme digestion was performed to determine whether the targeted gene was successfully knocked out. Among them, TNES, i.e., TNES buffer, is prepared from Tris, NaCl, EDTA, and SDS: 50mM Tris, pH 7.5, 400mM NaCl, 20mM EDTA, and 0.5% SDS. T7E1 enzyme digestion was detected and analyzed using T7 endonuclease I (T7EI) to confirm that the gene editing was successful.
[0150] (9) When the cell density reaches 80% to 90%, digest and centrifuge the organoids using the method of steps (12) to (14) in the first step "Cultivating the first organoid". After centrifugation, resuspend the cells with a mixture of phosphate buffered saline (PBS) (pH = 7.4) and Matrigel (volume ratio 1:1). Resuspend the cells in one well of a 48-well plate with about 20 μL of the mixture to obtain a cell suspension, which is placed on ice for later use.
[0151] The third step is transplantation into mice.
[0152] The genetically modified cells were injected into the lungs of mice. The specific steps were as follows:
[0153] (1) Anesthetize mice using isoflurane breathing anesthesia. After anesthesia, fix the mice in the left / right side position. Use an insulin needle to extract the cell suspension obtained in the second step "gene editing" step (9).
[0154] (2) Cut the skin, muscles and fascia along the left / right side of the mouse's chest, find the intercostal space, hold the insulin needle, and push the insulin needle piston almost perpendicular to the intercostal muscles to inject the cell suspension into the visceral pleura of the mouse. That is, the surface of the mouse's lung tissue, so that the cell suspension enters the area between the lung and the pleura.
[0155] (3) The mice were cultured for 90-120 days, and a new pleural mesothelioma mouse model was constructed. We named the pleural mesothelioma mouse model constructed in this way as Organoid-initiated Precision Cancer Models (OPCM).
[0156] The flowchart of the above construction is as follows Figure 1 As shown, the beneficial effects of the present invention are further illustrated in the form of experimental examples below.
[0157] 2.1 Experimental methods
[0158] A control group and an experimental group were set up, with 5 mice in each group. A "new pleural mesothelioma mouse model" was constructed according to the above method. The difference between the experimental group and the control group was that the genes for genetic modification were different.
[0159] The control group was knocked out using CRISPR / Cas9 technology using the Scramble control sequence.
[0160] The experimental group used CRISPR / Cas9 technology to knock out the tumor suppressor genes Trp53, Pten, Cdkn2a, and Cdkn2b, and used lentivirus to transfer the oncogenes Sox2 and Myc.
[0161] in,
[0162] The sgRNA nucleotide sequences used to knock out Trp53 are shown in SEQ ID NO.1 and SEQ ID NO.2.
[0163] The sgRNA nucleotide sequences used to knock out Pten are shown in SEQ ID NO.3 and SEQ ID NO.4.
[0164] The sgRNA nucleotide sequences used to knock out Cdkn2a are shown in SEQ ID NO.5 and SEQ ID NO.6.
[0165] The sgRNA nucleotide sequences used to knock out Cdkn2b are shown in SEQ ID NO.7 and SEQ ID NO.8.
[0166] The nucleotide sequences of the control sequences used for knocking out the Scramble gene are shown in SEQ ID NO.13 and SEQ ID NO.14.
[0167] 2.2 Experimental Results
[0168] T7 endonuclease I was used to identify the infected organoids. Figure 2 As shown, it indicates that the gene knockout was successful.
[0169] like Figure 3 As shown, the morphology of the organoids in the experimental group was significantly changed compared with that in the control group. The red and green fluorescent staining of the organoid cells in the experimental group showed vacuolar shape, and the growth was obvious; while the cell tissue in the control group was solid, and the growth was smaller.
[0170] like Figure 4 As shown in the figure, the tumor in vivo imaging results after 24, 43, and 68 days of transplantation showed obvious fluorescence signals in the left lung of the experimental group mice, especially on days 43 and 68, indicating that the transplanted cells had significantly expanded. The control group had no fluorescence signals, indicating that although the Scr gene was knocked out by CRISPR / Cas9 technology in the control group, the transplanted cells in the control group did not expand, and the mouse model was not successfully constructed.
[0171] The mice were killed after they developed shortness of breath and weakness. Tumor nodules appeared in the chest cavity of the mice. Stereo fluorescence microscopy showed that the nodules in the experimental group mice emitted red and green fluorescence. Figure 5 shown.
[0172] HE staining was performed on the tumor tissues of the experimental group mice, and the pathology was similar to that of clinical mesothelioma patients, such as Figure 6 Fluorescence staining photos show that the tumor tissue in the mouse lungs has significantly expanded and proliferated in large quantities, showing the characteristics of rapid proliferation of malignant tumor cells.
[0173] The immunohistochemical staining results of WT1 and VIM, clinical pleural mesothelioma molecular markers, in the lung tissues of mice in the experimental group were positive. Figure 7 shown.
[0174] The results of this experiment showed that mice in the experimental group developed pleural mesothelioma.
[0175] The experimental group eventually obtained 5 new pleural mesothelioma mice with a 100% modeling success rate, while the mice in the control group showed no tumor symptoms.
[0176] 2.3 Discussion of beneficial effects
[0177] Compared with the existing animal models of pleural mesothelioma, the model constructed by the present invention not only has a significantly shortened preparation cycle, but also almost avoids the death of animals before tumor formation, achieving a 100% construction success rate. In addition, the model can dynamically display the whole picture of the tumor from initiation to development, and is highly consistent with the real tumor development in terms of genetic characteristics, tumor microenvironment, tumor evolution and pathophysiology.
[0178] Therefore, the novel pleural mesothelioma mouse model of the present invention has broad application prospects in exploring the pathogenesis of pleural mesothelioma, finding and optimizing new treatment methods, etc.
[0179] Example 2
[0180] Method for constructing pleural mesothelioma model
[0181] The method for constructing a pleural mesothelioma model was performed with reference to the scheme of Example 1, except that the genetically modified genes were different. CRISPR / Cas9 technology was used for gene knockout to knock out Trp53, Pten, Cdkn2a, Cdkn2b, and Bap1 genes. In the gene knockout process, the sgRNA sequences used are shown in Table 1.
[0182] Right now,
[0183] Trp53 gene knockout used sgTrp53-F and sgTrp53-R of SEQ ID No. 1 and SEQ ID No. 2.
[0184] For Pten gene knockout, sgPten-F and sgPten-R of SEQ ID No. 3 and SEQ ID No. 4 were used.
[0185] For Cdkn2a gene knockout, sgCdkn2a-F and sgCdkn2a-R of SEQ ID No. 5 and SEQ ID No. 6 were used.
[0186] The Cdkn2b gene knockout used sgCdkn2b-F and sgCdkn2b-R of SEQ ID No. 7 and SEQ ID No. 8.
[0187] For the Bap1 gene knockout, sgBap1-F and sgBap1-R of SEQ ID No. 9 and SEQ ID No. 10 were used.
[0188] At the same time, the Sox2 gene and the Myc gene were introduced by lentivirus to achieve the effect of mutation overexpression. The remaining steps were the same as in Example 1. A pleural mesothelioma mouse model was successfully constructed, and the fluorescent staining photos showed that the tumor tissue was significantly amplified and proliferated in the mouse lungs, showing the characteristics of rapid proliferation of malignant tumor cells, indicating that the animal model was successfully constructed.
[0189] Comparative Example 1
[0190] The mouse animal model was constructed by referring to the method of Example 1. As in Example 2, the steps of isolating lung tissue cells, culturing organoids, and transplanting them into mice were exactly the same as in Example 1. The only difference compared with Example 1 was that: 1.2 In step (3) of genetic modification of lung cells, the genes to be knocked out or overexpressed were different.
[0191] CRISPR / Cas9 technology was also used for gene editing, and the Bap1 gene was knocked out in Example 1A, the Pten gene was knocked out in Example 1B, and the Cdkn2a gene was knocked out in Example 1C. At the same time, lentivirus was used to introduce overexpression of oncogenes Sox2 and Myc in all three examples.
[0192] Comparative Example 1A uses CRISPR / Cas9 to knock out the Bap1 gene, and uses the sgRNA method for knockout, and the sgRNA sequences used are sgBap1-F and sgBap1-R. The nucleotide sequence of sgBap1-F is shown in SEQ ID NO.9; the nucleotide sequence of sgBap1-R is shown in SEQ ID NO.10.
[0193] Comparative Example 1B uses CRISPR / Cas9 to knock out the Pten gene, and uses the sgRNA method for knockout, and the sgRNA sequences used are sgPten-F and sgPten-R. The nucleotide sequence of sgPten-F is shown in SEQ ID NO.3; the nucleotide sequence of sgPten-R is shown in SEQ ID NO.4.
[0194] Comparative Example 1C uses CRISPR / Cas9 to knock out the Cdkn2a gene, and uses the sgRNA method for knockout, and the sgRNA sequences used are sgCdkn2a-F and sgCdkn2a-R. The nucleotide sequence of sgCdkn2a-F is shown in SEQ ID NO.5; the nucleotide sequence of sgCdkn2b-R is shown in SEQ ID NO.6.
[0195] Meanwhile, in Comparative Example 1A, Comparative Example 1B and Comparative Example 1C, Myc gene and Sox2 gene were introduced by lentivirus, wherein the nucleotide sequence of the Myc gene is shown in SEQ ID NO.11; and the nucleotide sequence of the Myc gene is shown in SEQ ID NO.12.
[0196] T7E1 detection confirmed that the gene editing was successful. In vivo fluorescence imaging of the tumor 60 days after organoid transplantation in mice confirmed the development of the tumor. The results showed that there was no fluorescent signal in the tumor in vivo fluorescence imaging, indicating that the transplanted cells in the control group did not proliferate and failed to form pleural mesothelioma. The experimental results show that Comparative Example 1A, Comparative Example 1B, and Comparative Example 1C knocked out the Bap1, Pten, and Cdkn2a genes, respectively, and all used lentivirus to introduce oncogenes Sox2 and Myc, but none of them could construct a mouse animal model. When constructing an animal model of pleural mesothelioma with mice with full immunity, the difficulty of successfully constructing the model is greatly increased because mice with full immunity are used. Partial knockout of tumor suppressor genes combined with the introduction of Myc genes and overexpression of Sox2 genes cannot effectively construct an animal model and cannot be used in animal experimental research scenarios for immunotherapy.
[0197] Therefore, the mouse model with full immune function is different from the physiological characteristics of traditional nude mice / immunodeficient mice, resulting in different gene editing processes and pathological types. Simply knocking out some genes or introducing oncogenes Sox2 and Myc cannot effectively construct the required pleural mesothelioma mouse model and does not meet the experimental requirements. A group of genes must be selected for simultaneous knockout and combined with appropriate oncogene introduction to achieve overexpression in order to induce an in situ pleural mesothelioma mouse model.
[0198] It should be noted that the above description of the reagents used in the embodiments / comparative examples does not limit the specific specifications or models of the various reagents. It is well known to those skilled in the art that reagents with equivalent functions / effects can be replaced without affecting the implementation of the scheme of the present invention.
Claims
1. A method for constructing a pleural mesothelioma mouse animal model, characterized in that: The following steps are involved: S1. Cultivate human or mouse lung cells into the first organoids; S2, resuspending and digesting the first type of organ with TrypLE into single cells, and genetically modifying them; then culturing the genetically modified lung cells into the second type of organ; Genetic modification refers to gene editing, which can be one of the following: I. Knockout of Trp53, Pten, Cdkn2a, and Cdkn2b genes, and overexpression of Sox2 mutant gene and Myc gene; II. Knock out Trp53, Pten, Cdkn2a, Cdkn2b, and Bap1 genes, and overexpress Sox2 mutant gene and Myc gene. S3, resuspending and digesting the second type of organ to prepare a cell suspension; S4, anesthetize the mouse, cut the skin, muscle and fascia along the left / right chest of the mouse, and find the intercostal space; use an insulin needle to extract the cell suspension obtained in S3, hold the insulin needle, with the syringe almost perpendicular to the intercostal muscle, push the insulin needle piston, and inject the cell suspension into the visceral pleura of the mouse; S5. Cultivate the mice obtained in S4 for 90-120 days to construct a pleural mesothelioma mouse model.
2. The method for constructing a pleural mesothelioma mouse animal model according to claim 1, characterized in that: The following steps are involved: The method also includes S6. After the pleural mesothelioma mouse model constructed by S5 is successfully established, the pleural mesothelioma tissue of the model mouse is extracted, made into a single cell suspension, and injected into the chest cavity of another mouse.
3. The method for constructing a pleural mesothelioma mouse animal model according to claim 1, characterized in that: In S1, mouse lung cells are cultured into a first type of organ, and the culture is specifically carried out by the following method: the lung cells are mixed with Matrigel, and after the Matrigel solidifies, the organoid culture medium is added for culture to obtain the first type of organ.
4. The method for constructing a pleural mesothelioma mouse animal model according to claim 1, characterized in that: The organoid culture medium is based on DMEM / F12 and is supplemented with the following compound additives:
5. The method for constructing a pleural mesothelioma mouse animal model according to claim 4, characterized in that: In S1, lung cells were isolated by digesting lung tissue blocks with collagenase I and collagenase IV at a final concentration of 1 mg / mL and 0.5 mg / mL, filtering through a 100 μm mesh to obtain single cells, washing with DMEM / F12 medium, and centrifuging to terminate the enzymatic digestion reaction.
6. The method for constructing a pleural mesothelioma mouse animal model according to claim 5, characterized in that: or primary cultures of animal lung cells, which are then used to grow the first organoids.
7. The method for constructing a pleural mesothelioma mouse animal model according to claim 1, characterized in that: In S2, the genetic modification refers to knocking out tumor suppressor genes and / or increasing the copy number of oncogenes.
8. The method for constructing a pleural mesothelioma mouse animal model according to claim 7, characterized in that: The Trp53 gene was knocked out using CRISPR / Cas9 and the sgRNA method was used for knockout. The sgRNA sequences used were sgTrp53-F and sgTrp53-R; The nucleotide sequence of sgTrp53-F is shown in SEQ ID NO.1; The nucleotide sequence of sgTrp53-R is shown in SEQ ID NO.2; The Pten gene was knocked out using CRISPR / Cas9 and the sgRNA method was used for knockout. The sgRNA sequences used were sgPten-F and sgPten-R; The nucleotide sequence of sgPten-F is shown in SEQ ID NO.3; The nucleotide sequence of sgPten-R is shown in SEQ ID NO.4; CRISPR / Cas9 was used to knock out the Cdkn2a gene, and the sgRNA method was used for knockout. The sgRNA sequences used were sgCdkn2a-F and sgCdkn2a-R; The nucleotide sequence of sgCdkn2a-F is shown in SEQ ID NO.5; The nucleotide sequence of sgCdkn2a-R is shown in SEQ ID NO.6; CRISPR / Cas9 was used to knock out the Cdkn2b gene, and the sgRNA method was used for knockout. The sgRNA sequences used were sgCdkn2b-F and sgCdkn2b-R; The nucleotide sequence of sgCdkn2b-F is shown in SEQ ID NO.7; The nucleotide sequence of sgCdkn2b-R is shown in SEQ ID NO.8; The Bap1 gene was knocked out using CRISPR / Cas9 and the sgRNA method was used for knockout. The sgRNA sequences used were sgBap1-F and sgBap1-R; The nucleotide sequence of sgBap1-F is shown in SEQ ID NO.9; The nucleotide sequence of sgBap1-R is shown in SEQ ID NO.
10.
9. The method for constructing a pleural mesothelioma mouse animal model according to claim 8, characterized in that: In S2, gene editing also includes the introduction of fluorescent marker genes into organoids.
10. Use of the animal model prepared by the method for constructing a pleural mesothelioma mouse animal model according to any one of claims 1 to 9 in the screening of anti-lung cancer and pleural mesothelioma drugs, toxicity evaluation and immunotherapy experiments.
Citation Information
Patent Citations
Methods for constructing animal models of primary lung cancer in situ
CN112852714B