Hereditary thrombophilia gene detection kit based on multiple PCR-melting curve analysis and application of hereditary thrombophilia gene detection kit

Abstract

The invention discloses a hereditary thrombophilia gene detection kit based on multiple PCR-melting curve analysis and application of the hereditary thrombophilia gene detection kit, and relates to the technical field of gene detection. The kit comprises three tubes of PCR reaction liquid, and each tube of PCR reaction liquid contains a specific primer and a fluorescent probe and covers 12 SNP sites. According to the hereditary thrombophiliosis gene detection kit based on multiple PCR-melting curve analysis and the application of the hereditary thrombophiliosis gene detection kit, high-throughput typing of 12 SNP loci is achieved through a multi-channel fluorescent PCR and melting curve analysis technology. The kit has the advantages of simplicity and convenience in operation, high sensitivity, low cost and the like, and is suitable for clinical early screening and precise intervention.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis and application thereof. Background Art

[0002] Thrombophilia refers to a disease or state that is prone to thromboembolism due to hereditary or acquired defects in anticoagulant proteins, coagulation factors, fibrinolytic proteins, etc., or the presence of acquired risk factors. It is also called a prothrombotic state, and its main clinical manifestation is venous thromboembolism (VTE). Based on clinical symptoms, signs and laboratory tests, thrombophilia is mainly divided into two categories: hereditary thrombophilia and acquired thrombophilia.

[0003] Hereditary thrombophilia is caused by a certain gene defect in the patient's body, which leads to a decrease or abnormality in the corresponding protein content. Its risk factors mainly include: abnormal procoagulant factors, such as the Leiden mutation of the coagulation factor V gene (F5G1601A) and the G20210A mutation of the prothrombin gene (F2 G20210A); metabolic defects, such as the C677T mutation of the methylenetetrahydrofolate reductase (MTHFR) gene and the C.66A>G mutation of the MTRR gene; anticoagulant protein defects, such as protein C (PROC) gene mutations (such as C.565C>T, C.574-576del), protein S (PROS1) gene mutations (such as C.1680T>A, 252del, etc.), antithrombin (AT) deficiency, etc.; abnormal fibrinolytic system, such as mutations in the plasminogen activator inhibitor-1 (PAI-1).

[0004] Acquired thrombophilia refers to a group of diseases that are extremely likely to cause thrombosis and a dangerous state that is extremely likely to cause thrombosis. The risk factors mainly include: advanced age, surgery, trauma, prolonged immobilization, malignant tumors, oral contraceptives and hormone replacement therapy, pregnancy and postpartum period, antiphospholipid syndrome, paroxysmal nocturnal hemoglobinuria, myeloproliferative diseases, undifferentiated connective tissue disease, autoimmune diseases, and medical complications (hypertension, diabetes, chronic nephritis, etc.), with antiphospholipid syndrome being the most common.

[0005] Currently, the detection methods for inherited thrombophilias have the following limitations:

[0006] (1) PCR-RFLP: The operation is cumbersome, time-consuming, and has the risk of false positives.

[0007] (2) Sequencing method: high cost, long detection cycle, not suitable for large-scale screening.

[0008] (3) qPCR: It requires the design of specific probes, which is costly and difficult to achieve multiplex detection of multiple gene loci.

[0009] The present invention realizes simultaneous detection of multiple gene loci by optimizing the primer-probe combination and the reaction system, thereby improving detection efficiency and accuracy. Summary of the invention

[0010] In order to overcome the shortcomings of the prior art, the present invention provides a hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis and an application method thereof, aiming to achieve rapid, accurate and low-cost detection of multiple thrombophilia-related gene polymorphic sites.

[0011] To achieve the above objectives, in a first aspect, the present invention provides a hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis, comprising 3 tubes of PCR reaction solution, each tube of PCR reaction solution containing specific primers and fluorescent probes, covering 12 SNP sites.

[0012] Preferably, the three tubes of PCR reaction solution include: PCR reaction solution 1, PCR reaction solution 2 and PCR reaction solution 3;

[0013] The SNP sites detected by PCR reaction solution 1 included PAI 4G / 5G, MTRR C.66A>G, ​​PROS1 C.1680T>A, and SERPINC1 C.481C>T;

[0014] The SNP sites detected by PCR reaction solution 2 included FGG C.10034C>T, PROCC.565C>T, PROS1 C.252del, and SERPINC1 C.1273C>T;

[0015] The SNP sites detected by PCR reaction solution 3 include F2 G20210A, MTHFR C677T, PROS1 C.1063C>T, and SERPINC1 C.235C>T.

[0016] Preferably, the specific primers and fluorescent probe sequences in the PCR reaction solution 1 include:

[0017] Specific primers PAI-F, PAI-R and fluorescent probe PAI42 designed for PAI 4G / 5G gene, the sequence number of PAI-F is shown in SEQ ID NO.1, the sequence number of PAI-R is shown in SEQ ID NO.2, and the sequence number of PAI42 is shown in SEQ ID NO.3;

[0018] and specific primers MTRR-F, MTRR-R and fluorescent probe MTRR1 designed for MTRR C.66A>G gene, MTRR-F sequence number is shown in SEQ ID NO.4, MTRR-R sequence number is shown in SEQ ID NO.5, MTRR1, sequence number is shown in SEQ ID NO.6;

[0019] and specific primers PROS1-F, P1680-R11 and fluorescent probe P1680A3 designed for PROS1 C.1680T>A gene, PROS1-F sequence number is shown in SEQ ID NO.7, P1680-R11 sequence number is shown in SEQ ID NO.8, P1680A3 sequence number is shown in SEQ ID NO.9;

[0020] And specific primers 481-F, 481-R and fluorescent probe S481C>T designed for the SERPINC1 C.481C>T gene, the sequence number of 481-F is shown in SEQ ID NO.10, the sequence number of 481-R is shown in SEQ ID NO.11, and the sequence number of S481C>T is shown in SEQ ID NO.12.

[0021] Preferably, the specific primers and fluorescent probe sequences in the PCR reaction solution 2 include:

[0022] Specific primers FGG-F and FGG-R and fluorescent probe FGG1 designed for FGG C.10034C>T gene, the sequence number of FGG-F is shown in SEQ ID NO.13, the sequence number of FGG-R is shown in SEQ ID NO.14, and the sequence number of FGG1 is shown in SEQ ID NO.15;

[0023] and specific primers PRO-F, PROC2-R and fluorescent probe PROC11 designed for PROC C.565C>T gene, PRO-F sequence number is shown in SEQ ID NO.16, PROC2-R sequence number is shown in SEQ ID NO.17, PROC11 sequence number is shown in SEQ ID NO.18;

[0024] and specific primers 252del-F, 252del-R and fluorescent probe 252com-P1 designed for PROS1 C.252del gene, the sequence number of 252del-F is shown in SEQ ID NO.19, the sequence number of 252del-R is shown in SEQ ID NO.20, and the sequence number of 252com-P1 is shown in SEQ ID NO.21;

[0025] And specific primers 1273-F, 1273-R and fluorescent probe S1273C>T designed for the SERPINC1 C.1273C>T gene, the sequence number of 1273-F is shown in SEQ ID NO.22, the sequence number of 1273-R is shown in SEQ ID NO.23, and the sequence number of S1273C>T is shown in SEQ ID NO.24.

[0026] Preferably, the specific primers and fluorescent probe sequences in the PCR reaction solution 3 include:

[0027] Specific primers F2-F and F2-R and fluorescent probe F21 designed for the F2 G20210A gene, the sequence number of F2-F is shown in SEQ ID NO.25, the sequence number of F2-R is shown in SEQ ID NO.26, and the sequence number of F21 is shown in SEQ ID NO.27;

[0028] and specific primers MTHF, MTH-R and fluorescent probe MTHFR1 designed for MTHFR C677T gene, the sequence number of MTH-F is shown in SEQ ID NO.28, the sequence number of MTH-R is shown in SEQ ID NO.29, and the sequence number of MTHFR1 is shown in SEQ ID NO.30;

[0029] and specific primers 1063C-F and 1063-R designed for PROS1 C.1063C>T gene and fluorescent probe P1063C>T2, the sequence number of 1063C-F is shown in SEQ ID NO.31, the sequence number of 1063-R is shown in SEQ ID NO.32, and the sequence number of P1063C>T2 is shown in SEQ ID NO.33;

[0030] And specific primers S235-F11, S235-R11 and fluorescent probe S235C>T designed for the SERPINC1 C.235C>T gene, the sequence number of S235-F11 is shown in SEQ ID NO.34, the sequence number of S235-R11 is shown in SEQ ID NO.35, and the sequence number of S235C>T is shown in SEQ ID NO.36.

[0031] In a second aspect, the present invention provides an application of the above-mentioned hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis, including application in hereditary thrombophilia diagnosis for non-medical purposes, thrombosis risk assessment or personalized medication guidance.

[0032] Therefore, the hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis and its application in the present invention have the following beneficial effects:

[0033] (1) Real-time fluorescence quantitative PCR technology was used in combination with asymmetric PCR, fluorescent probes and melting curve analysis technology to qualitatively detect polymorphic SNPs of PAI (4G / 5G), MTRR (C.66A>G), PROS1 (C.1680T>A), SERPINC1 (C.481C>T), FGG (C.10034C>T), PROC (C.565C>T), PROS1 (252del), SERPINC1 (C.1273C>T), F2 (G20210A), MTHFR (C677T), PROS1 (C.1063C>T), and SERPINC1 (C.235C>T) in DNA samples;

[0034] (2) Using FAM, HEX, ROX, and CY5 four-channel fluorescent probes combined with asymmetric amplification technology to achieve simultaneous amplification of multiple targets;

[0035] (3) Use specific primers and probes to perform high-precision PCR amplification of the target sequence, and perform SNP typing by analyzing and comparing the changes in the Tm value of the melting curve generated by the specific fluorescent probe and the target sequence;

[0036] (4) It has the advantages of simple operation, high sensitivity, and low cost, making it suitable for early clinical screening and precise intervention.

[0037] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0039] Figure 1 This is the detection spectrum of the reaction tube 1 in the test example 1 of the present invention;

[0040] Figure 2 This is the detection spectrum of reaction tube 2 in test example 1 of the present invention;

[0041] Figure 3 This is the detection spectrum of the reaction tube 3 in the test example 1 of the present invention. DETAILED DESCRIPTION

[0042] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0043] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0044] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0045] Embodiment 1

[0046] A hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis, the components of which are shown in Table 1 below:

[0047] Table 1 Kit composition

[0048]

[0049] Among them, PCR reaction solution 1 detected PAI (4G / 5G), MTRR (C.66A>G), PROS1 (C.1680T>A) and SERPINC1 (C.481C>T) gene polymorphisms, PCR reaction solution 2 detected FGG (C.10034C>T), PROC (C.565C>T), PROS1 (252del) and SERPINC1 (C.1273C>T) gene polymorphisms, and PCR reaction solution 3 detected F2 (G20210A), MTHFR (C677T), PROS1 (C.1063C>T) and SERPINC1 (C.235C>T) gene polymorphisms.

[0050] The primers and fluorescent probe sequences in PCR reaction solution 1 are:

[0051] PAI-F, the sequence number is shown in SEQ ID NO. 1, which is AAGGTTGTTGACACAAGAGAGCC;

[0052] PAI-R, the sequence number is shown in SEQ ID NO. 2, which is GTCTTTCCCTCATCCCTGCC;

[0053] Fluorescent probe PAI42, the sequence number is shown in SEQ ID NO. 3, which is FAM-ACACGTGGGGGAGTCAGCCGTGT-BHQ1;

[0054] MTRR-F, the sequence number is shown in SEQ ID NO. 4, which is ATATGCTACACAGCAGGGACAGG;

[0055] MTRR-R, the sequence number is shown in SEQ ID NO. 5, which is AAGATCTGCAGAAAATCCATGTACC;

[0056] Fluorescent probe MTRR1, the sequence number is shown in SEQ ID NO. 6, which is VIC-CGCAGAAGAAATATGTGAGCAAGCTGCG-BHQ1;

[0057] PROS1-F, the sequence number is shown in SEQ ID NO. 7, which is GAATCTTTGCTCTGCTCTTCAGG;

[0058] P1680-R11, the sequence number is shown in SEQ ID NO. 8, which is GATGGTTTCTATTTTAAGTGGTGTCG;

[0059] Fluorescent probe P1680A3, the sequence number is shown in SEQ ID NO.9, which is ROX-CGAGTAATATATCGGATACAGGCCCTAAGTCTCG-BHQ2

[0060] 481-F, the sequence number is shown in SEQ ID NO. 10, which is AAGTTTGACACCATATCTGAGAAAACATC;

[0061] 481-R, the sequence number is shown in SEQ ID NO. 11, which is AGGCGATTGGCTGATACTAACTTG;

[0062] The fluorescent probe S481C>T, the sequence number is shown in SEQ ID NO.12, which is CY5-CCGGAACTGAACTGCCGACTCTATCGAAACCGG-BHQ3.

[0063] The primers and fluorescent probe sequences in PCR reaction solution 2 are:

[0064] FGG-F, the sequence number is shown in SEQ ID NO. 13, which is TTTTATGCTGATGATAATTTATCTACATGC;

[0065] FGG-R, the sequence number is shown in SEQ ID NO. 14, which is GGTAAATTGGCAAAAAGTGGTGG;

[0066] Fluorescent probe FGG1, the sequence number is shown in SEQ ID NO. 15, which is FAM-CATGGTACCTTTATTGACCATg-BHQ1;

[0067] PRO-F, the sequence number is shown in SEQ ID NO. 16, which is AGTCTCGGGAGGAGTGCCTG;

[0068] PROC2-R, the sequence number is shown in SEQ ID NO. 17, which is GTCTTCTTGGTCTTCTGTGTCTCG;

[0069] Fluorescent probe PROC11, the sequence number is shown in SEQ ID NO. 18, which is VIC-CCCTGGAAGCGGATGGAGAAGGG-BHQ1;

[0070] 252del-F, the sequence number is shown in SEQ ID NO. 19, which is ATGAAATTTAGGTTTGCTAAGATATGTTT;

[0071] 252del-R, the sequence number is shown in SEQ ID NO. 20, which is AACATATCTAAGTTCCCTTCCATTTCTAA;

[0072] Fluorescent probe 252com-P1, the sequence number is shown in SEQ ID NO. 21, which is ROX-CCGTTTTGAACTTACCTAAGTATTTTGGATAAAACGG-BHQ2;

[0073] 1273-F, the sequence number is shown in SEQ ID NO. 22, which is ATGAAGAAGGCAGTGAAGCAGC;

[0074] 1273-R, the sequence number is shown in SEQ ID NO. 23, which is GCCTGTTGGCCTTGAAAGTC;

[0075] The fluorescent probe S1273C>T, the sequence number is shown in SEQ ID NO.24, which is CY5-CCGGTGATTGCTGGCCGTTCGCTACCGG-BHQ3.

[0076] The primers and fluorescent probe sequences in PCR reaction solution 2 are:

[0077] F2-F, the sequence number is shown in SEQ ID NO. 25, which is GTGTTTCTAAAACTATGGTTCCCAATAA;

[0078] F2-R, the sequence number is shown in SEQ ID NO. 26, which is GAGCTGCCCATGAATAGCACT;

[0079] Fluorescent probe F21, the sequence number is shown in SEQ ID NO. 27, which is FAM-catTGACTCTCAGCGAGCCTCAATG-BHQ1;

[0080] MTH-F, the sequence number is shown in SEQ ID NO. 28, which is AGGCTGACCTGAAGCACTTGAA;

[0081] MTH-R, the sequence number is shown in SEQ ID NO. 29, which is GCGGAAGAATGTGTCAGCCTC;

[0082] Fluorescent probe MTHFR1, the sequence number is shown in SEQ ID NO. 30, VIC-tgatgcgggagccgatttcatca-BHQ1;

[0083] 1063C-F, the sequence number is shown in SEQ ID NO. 31, which is GGCGTGATACTGTACGCAGAATCT;

[0084] 1063-R, the sequence number is shown in SEQ ID NO. 32, which is CCAGTTGTGATTTTGGATGTATGTTC;

[0085] Fluorescent probe P1063C>T2, the sequence number is shown in SEQ ID NO. 33, which is ROX-cCCTGATTGCACTTCGTGGTGGAAAGAggg-BHQ2;

[0086] S235-F11, the sequence number is shown in SEQ ID NO. 34, which is AGAAGAAGGCAACTGAGGATGAG;

[0087] S235-R11, the sequence number is shown in SEQ ID NO. 35, which is AGTGGTAGCAAAGCGGGAAT;

[0088] The fluorescent probe S235C>T, the sequence number is shown in SEQ ID NO.36, which is CY5-agttCACCAACCGGCGTGTCTGGGAACT-BHQ3.

[0089] The genetic detection kit for hereditary thrombophilia uses multiple PCR-melting curve analysis technology, using multiple pairs of specific primers to simultaneously amplify multiple target gene sites, each pair of primers corresponding to a gene site to ensure specific amplification. Each pair of primers corresponds to a specific fluorescent probe, which dissociates at a specific temperature after binding to the target sequence, resulting in changes in the fluorescent signal. By monitoring the signal changes of different fluorescent channels, a melting curve is drawn. Based on the differences in Tm values ​​of different gene sites, multiple gene polymorphisms can be distinguished.

[0090] Embodiment 2

[0091] A genetic detection kit for hereditary thrombophilia based on multiplex PCR-melting curve analysis comprises the following steps:

[0092] S1. Sample processing: DNA was extracted from human peripheral blood using commercial nucleic acid extraction reagents. The extracted product could be stored at -20°C for more than 6 months.

[0093] S3. Reagent preparation:

[0094] Take out PCR reaction solution 1, PCR reaction solution 2, PCR reaction solution 3 and enzyme from the test kit, melt and shake at room temperature, and centrifuge at 2000rpm for 10 seconds. Calculate the number of reaction reagents required for testing n. The complete test reaction system of each sample requires 3 tubes of reaction solution for simultaneous testing. Each test reaction system is prepared as follows:

[0095] Table 3 Reaction system configuration

[0096] Components Reaction tube 1 Reaction tube 2 Reaction tube 3 PCR reaction solution 1 17μL PCR reaction solution 2 17μL PCR reaction solution 3 17μL Enzymes 1μL 1μL 1μL Total volume 18μL 18μL 18μL

[0097] The calculation formula for the number of reaction reagent tests n required is:

[0098] n = number of samples + number of negative controls + number of positive controls.

[0099] Calculate the amount of each reagent in the reaction system according to n tests, add it to a centrifuge tube of appropriate volume and mix well. Dispense 18 μL into 8-tube PCR thin-wall tubes, and then transfer to the sample processing area for subsequent sample addition.

[0100] S4, add sample:

[0101] The total volume of a single reaction is 20 μL, so add 2 μL of negative control, 2 μL of positive control, and 2 μL of sample to the PCR thin-walled tube containing 18 μL of reaction solution in step S3 in order, cover the eight-tube strip tightly, then gently mix the eight-tube strip, centrifuge it instantaneously, and finally transfer it to the PCR detection area.

[0102] S5. PCR amplification and fluorescence detection:

[0103] Each reaction tube was sequentially placed in a fluorescent quantitative PCR instrument for PCR amplification. The amplification program is shown in Table 4 below:

[0104] Table 4 PCR reaction program

[0105]

[0106] The reaction volume was 20 μL, and the fluorescence detection options were: FAM channel, HEX channel, quencher group selected none, and reference fluorescence selected none (no quencher group and reference fluorescence).

[0107] Quality control requirements:

[0108] (1) Threshold setting: The threshold line is just above the highest point of the normal negative control. The automatic analysis mode or manual analysis mode can be adjusted according to the situation.

[0109] (2) Negative control: There should be no obvious melting peak corresponding to the Tm. If a melting peak appears, it may be due to reagent contamination or operational contamination. The contamination source must be eliminated and retested.

[0110] (3) Result determination: If all the above requirements are met, the test is successful and the sample can be interpreted; otherwise, it is considered invalid and errors in the instrument, reagents, amplification conditions, etc. need to be checked.

[0111] S6. Results Analysis

[0112] The target genes and melting peak Tm values ​​corresponding to each reaction tube are shown in Tables 5 to 7 below. According to the melting peak Tm value range shown in the table below, the corresponding genotype is interpreted:

[0113] Table 5 Melting peak Tm value range of target gene and positive control in reaction tube 1

[0114]

[0115] Table 6 Melting peak Tm value range of target gene and positive control in reaction tube 2

[0116]

[0117] Table 7 Melting peak Tm value range of target gene and positive control in reaction tube 3

[0118]

[0119] Note: “ / ” indicates no obvious melting peak. If the detected peak is at the critical value between the high peak and the low peak, re-test is required.

[0120] Embodiment 3

[0121] An application of a hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis, the application method is the same as that of Example 2. The detection patterns of the Hongshi SLAN-96P real-time fluorescence quantitative PCR instrument are respectively as follows Figures 1 to 3 As shown, the blue curve is the FAM channel, the green curve is the HEX channel, the orange curve is the ROX channel, and the red curve is the CY5 channel.

[0122] like Figure 1 As shown, in the FAM channel: the temperatures at which the melting peaks of PAI-1 (4G / 5G) appear are 65.64°C and 70.59°C. According to the interpretation rules, the result should be the 4G / 5G type (heterozygous mutation).

[0123] HEX channel: The temperature at which the melting peak of MTRR (C.66A>G) appears is 58.25°C. According to the interpretation rules, the result should be GG type (homozygous mutation).

[0124] ROX channel: The temperature at which the melting peak of PROS1 (C.1680T>A) appears is 62.53°C. According to the interpretation rules, the result should be TT type (wild type).

[0125] CY5 channel: The temperature at which the melting peak of SERPINC1 (C.481C>T) appears is 63.59°C. According to the interpretation rules, the result should be CC type (wild type).

[0126] like Figure 2 As shown, in the FAM channel: the temperatures at which the melting peaks of FGG C.10034C>T appear are 47.66°C and 56.63°C. According to the interpretation rules, the result should be CT type (heterozygous mutation).

[0127] HEX channel: PROC C.565C>T The temperature at which the melting peak appears is 64.54°C. According to the interpretation rules, the result should be CC type (wild type).

[0128] ROX channel: The temperature at which the melting peak of PROS1 C.252del appears is 64.30°C. According to the interpretation rules, the result should be AA type (wild type).

[0129] CY5 channel: The temperature at which the melting peak of SERPINC1 C.1273C>T appears is 67.89°C. According to the interpretation rules, the result should be CC (wild type).

[0130] like Figure 3 As shown, in the FAM channel: the temperatures at which the melting peaks of F2 G20210A appear are 58.25°C and 63.83°C. According to the interpretation rules, the result should be GA type (heterozygous mutation).

[0131] HEX channel: The temperatures of the melting peaks of MTHFR C677T are 55.19°C and 63.66°C. According to the interpretation rules, the result should be CT type (heterozygous mutation).

[0132] ROX channel: The melting peak temperature of PROS1 C.1063C>T is 58.92℃ and 64.93℃. According to the interpretation rules, the result should be CT type (heterozygous mutation).

[0133] CY5 channel: The melting peak temperatures of SERPINC1 C.235C>T are 61.63℃ and 68.47℃. According to the interpretation rules, the result should be CT type (heterozygous mutation).

[0134] Therefore, the present invention provides a hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis and its application, which realizes high-throughput typing of 12 SNP sites through multi-channel fluorescent PCR and melting curve analysis technology. The kit has the advantages of simple operation, high sensitivity, low cost, etc., and is suitable for early clinical screening and precise intervention.

[0135] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A genetic thrombophilia detection kit based on multiplex PCR-melting curve analysis, characterized in that: It includes 3 tubes of PCR reaction solution, each tube of PCR reaction solution contains specific primers and fluorescent probes, covering 12 SNP sites.

2. A hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis according to claim 1, characterized in that: The three tubes of PCR reaction solution include: PCR reaction solution 1, PCR reaction solution 2 and PCR reaction solution 3; The SNP sites detected by PCR reaction solution 1 included PAI 4G / 5G, MTRR C.66A>G, ​​PROS1 C.1680T>A, and SERPINC1C.481C>T; The SNP sites detected by PCR reaction solution 2 included FGG C.10034C>T, PROC C.565C>T, PROS1 C.252del, and SERPINC1 C.1273C>T; The SNP sites detected by PCR reaction solution 3 include F2 G20210A, MTHFR C677T, PROS1 C.1063C>T, and SERPINC1C.235C>T.

3. A hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis according to claim 1 or 2, characterized in that: The specific primers and fluorescent probe sequences in the PCR reaction solution 1 include: Specific primers PAI-F, PAI-R and fluorescent probe PAI42 designed for PAI 4G / 5G gene, the sequence number of PAI-F is shown in SEQ ID NO.1, the sequence number of PAI-R is shown in SEQ ID NO.2, and the sequence number of PAI42 is shown in SEQ ID NO.3; and specific primers MTRR-F, MTRR-R and fluorescent probe MTRR1 designed for MTRR C.66A>G gene, MTRR-F sequence number is shown in SEQ ID NO.4, MTRR-R sequence number is shown in SEQ ID NO.5, MTRR1, sequence number is shown in SEQ ID NO.6; and specific primers PROS1-F, P1680-R11 and fluorescent probe P1680A3 designed for PROS1 C.1680T>A gene, PROS1-F sequence number is shown in SEQ ID NO.7, P1680-R11 sequence number is shown in SEQ ID NO.8, P1680A3 sequence number is shown in SEQ ID NO.9; And specific primers 481-F, 481-R and fluorescent probe S481C>T designed for the SERPINC1 C.481C>T gene, the sequence number of 481-F is shown in SEQ ID NO.10, the sequence number of 481-R is shown in SEQ ID NO.11, and the sequence number of S481C>T is shown in SEQ ID NO.

12.

4. A hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis according to claim 1 or 2, characterized in that: The specific primers and fluorescent probe sequences in PCR reaction solution 2 include: Specific primers FGG-F and FGG-R and fluorescent probe FGG1 designed for FGG C.10034C>T gene, the sequence number of FGG-F is shown in SEQ ID NO.13, the sequence number of FG GR is shown in SEQ ID NO.14, and the sequence number of FGG1 is shown in SEQ ID NO.15; and specific primers PRO-F, PR OC2-R and fluorescent probe PROC11 designed for PROC C.565C>T gene, PRO-F sequence number is shown in SEQ ID NO.16, PROC2-R sequence number is shown in SEQ ID NO.17, PROC11 sequence number is shown in SEQ ID NO.18; and specific primers 252del-F, 252del-R and fluorescent probe 252com-P1 designed for PROS1 C.252del gene, the sequence number of 252del-F is shown in SEQ ID NO.19, the sequence number of 252del-R is shown in SEQ ID NO.20, and the sequence number of 252com-P1 is shown in SEQ ID NO.21; And specific primers 1273-F, 1273-R and fluorescent probe S1273C>T designed for the SERPINC1 C.1273C>T gene, the sequence number of 1273-F is shown in SEQ ID NO.22, the sequence number of 1273-R is shown in SEQ ID NO.23, and the sequence number of S1273C>T is shown in SEQ ID NO.

24.

5. A hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis according to claim 1 or 2, characterized in that: The specific primers and fluorescent probe sequences in the PCR reaction solution 3 include: Specific primers F2-F and F2-R and fluorescent probe F21 designed for the F2 G20210A gene, the sequence number of F2-F is shown in SEQ ID NO.25, the sequence number of F2-R is shown in SEQ ID NO.26, and the sequence number of F21 is shown in SEQ ID NO.27; and specific primers MTHF, MTH-R and fluorescent probe MTHFR1 designed for MTHFR C677T gene, the sequence number of MTH-F is shown in SEQ ID NO.28, the sequence number of MTH-R is shown in SEQ ID NO.29, and the sequence number of MTHFR1 is shown in SEQ ID NO.30; and specific primers 1063C-F and 1063-R designed for PROS1 C.1063C>T gene and fluorescent probe P1063C>T2, the sequence number of 1063C-F is shown in SEQ ID NO.31, the sequence number of 1063-R is shown in SEQ ID NO.32, and the sequence number of P1063C>T2 is shown in SEQ ID NO.33; And specific primers S235-F11, S235-R11 and fluorescent probe S235C>T designed for the SERPINC1 C.235C>T gene, the sequence number of S235-F11 is shown in SEQ ID NO.34, the sequence number of S235-R11 is shown in SEQ ID NO.35, and the sequence number of S235C>T is shown in SEQ ID NO.

36.

6. Use of a hereditary thrombophilia gene detection kit based on multiplex PCR-melting curve analysis according to any one of claims 1 to 5, characterized in that: Application in the diagnosis of inherited thrombophilia for non-medical purposes, assessment of thrombotic risk, or personalized medication guidance.

Images