System for identifying whether people are in active tuberculosis infection state or not from gene expression of peripheral blood and application of system

Abstract

The invention provides a system for identifying whether a person is in an active tuberculosis infection state or not from gene expression of peripheral blood and application of the system, and the system is used for simultaneously detecting expression levels of human FCGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 gene so as to determine whether the person is in the active tuberculosis infection state or not. The sensitivity of combined detection of the six genes is 91.18%, the specificity reaches 86.84%, the target requirement for terminating tuberculosis in 2035 published by the United National Health Organization is met, and TB high-risk groups can be screened out by the method and then diagnosed by a diagnosis method.

Description

Technical Field

[0001] The invention belongs to the field of disease detection, and particularly relates to a system for identifying whether a person is in an active tuberculosis infection state from the gene expression of peripheral blood and its application. Background Art

[0002] In traditional TB detection, sputum smears have low sensitivity; and although culture has high sensitivity, the culture conditions are relatively harsh and the culture cycle is long. The method of detecting TB based on molecular biology is to directly detect tuberculosis bacteria from sputum; young infected people and HIV-infected people often cannot produce sputum; detecting tuberculosis from sputum often shows symptoms of coughing and sputum, and some tuberculosis patients have no typical clinical symptoms and are already contagious; in addition, when it comes to extrapulmonary tuberculosis, the current molecular biological method for directly detecting tuberculosis bacteria has a very low positive rate. According to the goal of ending tuberculosis by 2035 issued by the World Health Organization, a non-sputum-based TB triage method is required, requiring a minimum sensitivity of 90% and a specificity of 70%, and then using a confirmation method after screening out high-risk groups for TB. This method of screening high-risk groups for TB currently focuses on human blood and urine specimens. The gene expression in human blood samples has shown good screening performance in existing studies. Summary of the invention

[0003] Therefore, in order to solve the above technical problems, the present invention provides a system for identifying whether a person is in an active tuberculosis infection state from the gene expression in peripheral blood, wherein the system is used to simultaneously detect the expression levels of human FCGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 gene, thereby determining whether a person is in an active tuberculosis infection state.

[0004] In one embodiment, the primers and probe sequences for detecting FCGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 gene in humans are as follows: the upstream primer, downstream primer and probe sequences for detecting FCGR1A gene are: SEQ ID NO.1: GCAAGTGGACACCACAA, SEQ ID NO.2: CCATTGAGAAACCACTGTGTA, and SEQ ID NO.3: AAGAGGAAACCGTAACCTTGCA; The upstream primer, downstream primer and probe sequences for detecting the FCGR1B gene are: SEQ ID NO.4: GTTGATGGGCAAGTGGAC, SEQ ID NO.5: CCTCACAGTGCAAGGTTAT, and SEQ ID NO.6: CTCCATGGGTCAGCGTGTTC; The upstream primer, downstream primer and probe sequences for detecting the GBP5 gene are: SEQ ID NO.7: GGCAACTTGTCACACCAGAT, SEQ ID NO.8: GAACTCTTTGATCACTACCTTGCT, and SEQ ID NO.9: ACCTGGAGAATTCCCTAAGGCCA; The upstream primer, downstream primer and probe sequences for detecting the GBP6 gene are: SEQ ID NO.10: GCGATGTGGAAAAGGGTGA, SEQ ID NO.11: TTGATGGTGCTCATGCTGTTG, and SEQ ID NO.12: CCCTGGCTGTGCTCCTGTGC; The upstream primer, downstream primer and probe sequences for detecting the CXCL10 gene are: SEQ ID NO.13: TCTAAGTGGCATTCAAGGAGTA, SEQ ID NO.14: CCTTGGATTAACAGGTTGATTAC, and SEQ ID NO.15: CTCTAGAACTGTACGCTGTACCTGC; The upstream primer, downstream primer and probe sequences for detecting the KLF2 gene are: SEQ ID NO.34: GCACGCACACAGGTGAGAA, SEQ ID NO.35: ATCGCACAGATGGCACT, and SEQ ID NO.36: TCACGCGCCACTACCGAAAGC, respectively.

[0005] In one embodiment, the system is also used to detect the expression level of the internal reference gene HPRT1. The upstream primer, downstream primer and probe sequences for detecting the human internal reference gene HPRT1 are as follows: SEQ ID NO.37: TGACACTGGCAAAACAATGCA, SEQ ID NO.38: GGTCCTTTTCACCAGCAAGCT, and SEQ ID NO.39: CCATCTTTGGATTATACTGCCTGACCAAGGAA.

[0006] In one embodiment, the present invention provides use of the above system in preparing a product for identifying whether a person is in an active tuberculosis infection state.

[0007] In one embodiment, the present invention provides primers, probes or a combination thereof, which are used to detect the expression levels of human FCGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 gene simultaneously, thereby determining whether the human is in an active tuberculosis infection state.

[0008] The present invention analyzes a group of genes highly expressed in the peripheral blood of people with active tuberculosis infection: BATF2, FCGR1A, FCGR1B, UBE2L6, GBP5, GBP6, SCARF1, CCR6, CXCR5, CXCL10, DUSP3, KLF2, and then collects patients initially diagnosed with tuberculosis infection, other infectious diseases, and autoimmune diseases as a control group; finally, the mRNA expression of 6 genes is screened out, and the mRNA of the 6 genes can accurately identify whether the person is in an active tuberculosis infection state from the gene expression in the peripheral blood, and the sensitivity of the 6-gene combination detection is 91.18%, and the specificity reaches 86.84%; in accordance with the goal of ending tuberculosis by 2035 issued by the World Health Organization of the United Nations, the method of the present invention can screen out the high-risk population for TB, and then use the diagnosis method for diagnosis. DETAILED DESCRIPTION

[0009] From public databases or published literature, peripheral blood gene expression data of people with active tuberculosis infection and non-tuberculosis infection were retrieved and analyzed to find a group of genes highly expressed in the peripheral blood of people with active tuberculosis infection: BATF2, FCGR1A, FCGR1B, UBE2L6, GBP5, GBP6, SCARF1, CCR6, CXCR5, CXCL10, DUSP3, KLF2; primers and probes were designed for the mRNA expressed by each gene, as shown in Table 1 below, and at least one of the primers and probes was required to span the genome intron, so that the reverse transcription amplification of mRNA would not be affected by genomic DNA. Then, patients with initial diagnosis of tuberculosis infection, other infectious diseases, and autoimmune diseases were collected as the control group; finally, the mRNA expression of 6 genes was screened, and an arithmetic model for calculating these 6 mRNAs was constructed to obtain a final TB infection prediction scoring model. Through the scoring value, it is possible to accurately identify whether the person is in an active tuberculosis infection state from the gene expression of peripheral blood.

[0010] Table 1 .

[0011] The qPCR reaction system of the above primer probes uses the premixed qRT-PCR reaction system produced by Novagen. For the specific reaction system, see Table 2.

[0012] Table 2 qPCR reaction system composition 2×qPCR Master Mix 10μl HPRT1 gene upstream primers 0.25 μM (final concentration) HPRT1 gene downstream primers 0.25 μM (final concentration) HPRT1 gene probe 0.15 μM (final concentration) Target gene upstream primer 0.25 μM (final concentration) Target gene downstream primers 0.25 μM (final concentration) Target gene probe 0.15 μM (final concentration) Nucleic acid template 5μl Replenish water to 20ml See Table 3 for reaction conditions.

[0013] Table 3

[0014] Fluorescence was collected at 60°C and the Ct values ​​of the reference gene and target gene were recorded.

[0015] The test was conducted using blood samples from 68 cases of tuberculosis infection and 152 cases of non-tuberculosis infection. The expression abundance of the above 12 genes was detected by reverse transcription fluorescence quantitative PCR, and the relative expression value of each gene was obtained by comparing with the internal reference gene HPRT1. The relative expression values ​​of the genes were then input into the logistic regression calculation model, and different genes were combined. A judgment parameter was assigned to each gene to distinguish between tuberculosis-infected and non-tuberculosis-infected specimens in the training data with the greatest accuracy.

[0016] The primers of each gene and the internal reference gene HPRT1 were tested together. The probes of the target gene were labeled with FAM fluorescent dye, and the probes of the HPRT1 gene were labeled with VIC fluorescent dye. Based on the Ct values ​​of the target gene and the HPRT1 gene, the relative expression value of the target gene to HPRT1 was obtained = 2 （HPRT1的Ct-靶基因的Ct） *100, and then according to the relative abundance of each target gene, an expression score is obtained, and then the probability of the sample suffering from tuberculosis p=1-1 / (1+EXP(-score)) is obtained according to the score; p value <=0.20 is judged as non-TB infection; p value >0.20 is judged as TB infection.

[0017] Here, the top 5 gene combinations with the highest accuracy are listed to obtain the Score formula. The number in front of each target gene in the calculation formula is calculated by the logistic regression model based on the known clinical specimen grouping. For example, according to the Ct value, the relative expression abundance of GBP5 is relatively high. During the calculation process of the logistic regression model, it is found that the coefficient in front of the GBP5 gene should be relatively small. The score obtained can distinguish the tuberculosis infection group from the non-tuberculosis infection group, and the p value is calculated by the Score, and then the sensitivity and specificity of tuberculosis infection are judged based on the p value.

[0018] Combination 1: FCGR1A+FCGR1B+GBP5+GBP6+CXCL10+KLF2 combination; Score=4.1-0.0016*FCGR1A-0.0086*FCGR1B-0.0001*GBP5+0.0019*BP6-0.0062*CXCL10+0.002*KLF2 Combination 2: BATF2+FCGR1A+UBE2L6+DUSP3 combination: Score=3.6-0.0028*BATF2-0.0102*FCGR1A-0.0082*UBE2L6+0.0021*DUSP3 Combination 3: FCGR1A+FCGR1B+GBP5+KLF2 combination: Score=2.5-0.0036*FCGR1A-0.0232*FCGR1B-0.0132*GBP5-0.0018*KLF2 Combination 4: FCGR1A+GBP5+CCR6+CXCR5+KLF2 combination Score=3.9-0.0028*FCGR1A-0.0102*GBP5+0.0008*CCR6+0.0011*CXCR5-0.0023*KLF2 Combination 5: FCGR1A+UBE2L6+GBP5+SCARF1+CXCL10+KLF2 combination Score=5.2-0.0045*FCGR1A-0.021*UBE2L6-0.0102*GBP5+0.0011*SCARF1-0.0013*CXCL10-0.021*KLF2 The score and p-values ​​calculated for combination 1 of 68 cases of clinical tuberculosis infection and 152 cases of non-tuberculosis infection are shown in Tables 4-1 to 4-7.

[0019] Table 4-1

[0020] Table 4-2

[0021] Table 4-3

[0022] Table 4-4

[0023] Table 4-5

[0024] Table 4-6

[0025] Table 4-7 .

[0026] The sensitivity and specificity of combination 1 detection were calculated based on the Score and p-value calculation data in the above table, as shown in the following table; similarly, for combination 2, combination 3, combination 4 and combination 5, the Score and p-value were calculated (the original data for calculating the Score and p-value are not shown in this application) to obtain the corresponding sensitivity and specificity data. The sensitivity and specificity results calculated for the five combinations of 68 cases of clinical tuberculosis infection and 152 cases of non-tuberculosis infection are shown in Table 5.

[0027] Table 5

[0028] The sensitivity and specificity of tuberculosis infection were interpreted according to the p value as follows: only the six-gene combination 1 (FCGR1A+FCGR1B+GBP5+GBP6+CXCL10+KLF2) met the non-sputum-based TB triage method published by the World Health Organization, requiring a minimum threshold of 90% sensitivity and 70% specificity.

[0029] It is easy for those skilled in the art to understand that, under the premise of no conflict, the above-mentioned advantageous methods can be freely combined and superimposed.

[0030] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention shall be included in the protection scope of the present invention. The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and variations can be made without departing from the technical principles of the present invention, and these improvements and variations should also be regarded as the protection scope of the present invention.

Claims

1. A system for identifying whether a person is in an active tuberculosis infection state from gene expression in peripheral blood, characterized in that: The system is used to simultaneously detect the expression levels of human FCGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 gene, so as to determine whether the human is in an active tuberculosis infection state.

2. The system according to claim 1, characterized in that The primer and probe sequences used to detect human FCGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 are as follows: the upstream primer, downstream primer and probe sequences for detecting FCGR1A gene are: SEQ ID NO.1: GCAAGTGGACACCACAA, SEQ ID NO.2: CCATTGAGAAACCACTGTGTA, and SEQ ID NO.3: AAGAGGAAACCGTAACCTTGCA; The upstream primer, downstream primer and probe sequences for detecting the FCGR1B gene are: SEQ ID NO.4: GTTGATGGGCAAGTGGAC, SEQ ID NO.5: CCTCACAGTGCAAGGTTAT, and SEQ ID NO.6: CTCCATGGGTCAGCGTGTTC; The upstream primer, downstream primer and probe sequences for detecting the GBP5 gene are: SEQ ID NO.7: GGCAACTTGTCACACCAGAT, SEQ ID NO.8: GAACTCTTTGATCACTACCTTGCT, and SEQ ID NO.9: ACCTGGAGAATTCCCTAAGGCCA; The upstream primer, downstream primer and probe sequences for detecting the GBP6 gene are: SEQ ID NO.10: GCGATGTGGAAAAGGGTGA, SEQ ID NO.11: TTGATGGTGCTCATGCTGTTG, and SEQ ID NO.12: CCCTGGCTGTGCTCCTGTGC; The upstream primer, downstream primer and probe sequences for detecting the CXCL10 gene are: SEQ ID NO.13: TCTAAGTGGCATTCAAGGAGTA, SEQ ID NO.14: CCTTGGATTAACAGGTTGATTAC, and SEQ ID NO.15: CTCTAGAACTGTACGCTGTACCTGC; The upstream primer, downstream primer and probe sequences for detecting the KLF2 gene are: SEQ ID NO.34: GCACGCACACAGGTGAGAA, SEQ ID NO.35: ATCGCACAGATGGCACT, and SEQ ID NO.36: TCACGCGCCACTACCGAAAGC, respectively.

3. The system according to claim 1, characterized in that The system is also used to detect the expression level of the internal reference gene HPRT1. The system is also used to detect the expression level of the internal reference gene HPRT1. The upstream primer, downstream primer and probe sequences for detecting the human internal reference gene HPRT1 are as follows: SEQ ID NO.37: TGACACTGGCAAAACAATGCA, SEQ ID NO.38: GGTCCTTTTCACCAGCAAGCT, and SEQ ID NO.39: CCATCTTTGGATTATACTGCCTGACCAAGGAA.

4. Use of the system according to any one of claims 1 to 3 in the preparation of a product for identifying whether a person is in an active tuberculosis infection state.

5. A primer, a probe or a combination thereof, characterized in that: It is used to detect the expression levels of human FCGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2, so as to determine whether a person is in an active tuberculosis infection state.

6. The primer, probe or combination thereof according to claim 5, characterized in that: The primer and probe sequences used to detect human FCGR1A gene, FCGR1B gene, GBP5 gene, GBP6 gene, CXCL10 gene and KLF2 gene are as follows: the upstream primer, downstream primer and probe sequences for detecting FCGR1A gene are: SEQ ID NO.1: GCAAGTGGACACCACAA, SEQ ID NO.2: CCATTGAGAAACCACTGTGTA, and SEQ ID NO.3: AAGAGGAAACCGTAACCTTGCA; The upstream primer, downstream primer and probe sequences for detecting the FCGR1B gene are: SEQ ID NO.4: GTTGATGGGCAAGTGGAC, SEQ ID NO.5: CCTCACAGTGCAAGGTTAT, and SEQ ID NO.6: CTCCATGGGTCAGCGTGTTC; The upstream primer, downstream primer and probe sequences for detecting the GBP5 gene are: SEQ ID NO.7: GGCAACTTGTCACACCAGAT, SEQ ID NO.8: GAACTCTTTGATCACTACCTTGCT, and SEQ ID NO.9: ACCTGGAGAATTCCCTAAGGCCA; The upstream primer, downstream primer and probe sequences for detecting the GBP6 gene are: SEQ ID NO.10: GCGATGTGGAAAAGGGTGA, SEQ ID NO.11: TTGATGGTGCTCATGCTGTTG, and SEQ ID NO.12: CCCTGGCTGTGCTCCTGTGC; The upstream primer, downstream primer and probe sequences for detecting the CXCL10 gene are: SEQ ID NO.13: TCTAAGTGGCATTCAAGGAGTA, SEQ ID NO.14: CCTTGGATTAACAGGTTGATTAC, and SEQ ID NO.15: CTCTAGAACTGTACGCTGTACCTGC; The upstream primer, downstream primer and probe sequences for detecting the KLF2 gene are: SEQ ID NO.34: GCACGCACACAGGTGAGAA, SEQ ID NO.35: ATCGCACAGATGGCACT, and SEQ ID NO.36: TCACGCGCCACTACCGAAAGC, respectively.

Images