Method for rapidly detecting pork by using RPA-PfAgo
Through the RPA-PfAgo system, using specific primer sets and guide DNA, combined with PfAgo enzyme and MnCl2, the accuracy and efficiency of pork detection in the prior art are solved, and a fast, simple and low-cost detection effect is achieved.
Patent Information
- Application Number
- CN202510326973.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-18
- Publication Date
- 2025-06-06
AI Technical Summary
The prior art is difficult to detect pork species quickly, simply and at low cost, especially in the identification of doped meat and veterinary drug residues.
Using the RPA-PfAgo system, rapid and accurate detection of pork is achieved by designing specific primer sets and guide DNA, combining PfAgo enzyme and MnCl2.
It improves the accuracy and efficiency of detection, simplifies the detection process, reduces costs, and verifies the repetition, specificity and sensitivity of the RPA-PfAgo system.
Smart Images

Figure CN120099184A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular detection, and in particular relates to a method and application of rapid detection of pork using RPA-PfAgo. Background Art
[0002] As one of the most consumed meats in the world, pork has attracted much attention for its safety and authenticity. However, there are some problems in the pork market, such as some merchants will mix cheap chicken, duck and other meats into pork. In order to ensure the safety and quality of pork, the following detection methods are traditionally used: sensory detection: preliminary judgment is made by observing the sensory indicators such as color, smell, and elasticity of pork, but this method is highly subjective and has low accuracy, and it is difficult to identify problems such as adulterated meat and veterinary drug residues; physical and chemical detection: chemical reagents or instruments are used to analyze the composition of pork, such as detecting moisture, protein, and fat content, but this method is complicated to operate, time-consuming, and cannot specifically identify the type of adulterated meat; microbial detection: the type and number of microorganisms in pork are detected by culture or molecular biology methods, but this method has a long cycle and high cost, and it is difficult to meet the needs of rapid detection. In order to overcome the limitations of traditional detection methods, it is still necessary to provide a fast, simple, and low-cost method for detecting pork types. Summary of the invention
[0003] In view of this, the purpose of the present invention is to provide a method for rapid detection of pork using RPA-PfAgo. The present invention utilizes the high efficiency and specificity of RPA, combined with Argonaute protein from extremely thermophilic archaea, to achieve accurate identification of pork.
[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0005] The present invention provides a primer set for detecting pork, the primer set comprising a pork RPA amplification primer pair, gDNA and a molecular beacon;
[0006] The RPA amplification primer pair is SEQ ID NO.1 and SEQ ID NO.5, SEQ ID NO.1 and SEQ ID NO.6, or SEQ ID NO.3 and SEQ ID NO.5;
[0007] The SEQ ID NO.1 and SEQ ID NO.3 are forward primers;
[0008] The SEQ ID NO.5 and SEQ ID NO.6 are reverse primers;
[0009] The gDNAs are P-gDNA 21-1 and P-gDNA 21-2;
[0010] The nucleotide sequence of the P-gDNA 21-1 is shown in SEQ ID NO:7;
[0011] The nucleotide sequence of the P-gDNA 21-2 is shown in SEQ ID NO:8;
[0012] The nucleotide sequence of the molecular beacon is shown in SEQ ID NO:11.
[0013] Preferably, the 5' end of the molecular beacon is labeled with a fluorescent group, and the fluorescent group is FAM or ROX.
[0014] The present invention provides a kit for detecting pork, the kit comprising a forward primer, a reverse primer, P-gDNA 21-1, P-gDNA 21-2, a molecular beacon, a PfAgo enzyme and MnCl 2 .
[0015] The present invention provides a method for detecting pork using the kit, comprising the following steps:
[0016] 1) Extracting nucleic acid from the sample and amplifying it using forward primers and reverse primers to obtain an amplification product;
[0017] 2) The amplified product, P-gDNA 21-1, P-gDNA 21-2, PfAgo enzyme, MnCl 2 , a buffer solution and water are mixed and reacted to obtain a reactant;
[0018] 3) Detect whether the reactant has fluorescence. If it has fluorescence, the sample contains pork. If it does not have fluorescence, the sample does not contain pork.
[0019] In step 2), amplification products: P-gDNA 21-1: P-gDNA 21-2: molecular beacon: PfAgo enzyme: MnCl 2 : The volume ratio of buffer solution: water is 4-8:1-3:1-3:0.5-1.5:3-7:2-6:1-5:1-10.
[0020] Preferably, the volume ratio of the components amplified in step 1) is:
[0021] Buffer: forward primer: reverse primer: sample DNA: magnesium acetate: water = 27-32: 1-3: 1-3: 1-3: 1-4: 10-16;
[0022] The initial concentrations of the forward primer and the reverse primer are independently 8 to 12 μM;
[0023] The initial concentration of magnesium acetate is 250-300 mM.
[0024] Preferably, the amplification temperature in step 1) is 32-40° C., and the amplification time is 20-40 min.
[0025] Preferably, the initial concentration of the amplified product in step 2) is 1-5 ng / μL;
[0026] The initial concentrations of P-gDNA 21-1 and P-gDNA 21-2 were independently 8–12 μM;
[0027] The initial concentration of the molecular beacon is 8 to 12 μM;
[0028] The initial concentration of the PfAgo enzyme is 100-300 U / μL;
[0029] The MnCl 2 The initial concentration is 30-50 mM.
[0030] Preferably, the reaction temperature in step 2) is 93-97° C., and the reaction time is 28-32 min.
[0031] Preferably, the detection in step 3) is to use light with a wavelength of 470 nm or 525 nm to detect whether the reactant has fluorescence.
[0032] Preferably, the detection in step 3) is to record fluorescence every 25 to 35 seconds.
[0033] Compared with the prior art, the present invention has the following beneficial effects:
[0034] The present invention provides a method for rapid detection of pork using RPA-PfAgo, wherein a primer set is designed according to the conserved sequence of pork, and the primer set includes an RPA amplification primer pair, gDNA and a molecular beacon of pork. The reaction conditions, such as the type of added ingredients, reaction time and temperature, are strictly limited, which greatly improves the accuracy of detection. At the same time, the repeatability, specificity and sensitivity of the RPA-PfAgo system are verified to ensure reliable performance. The technical solution of the present invention is simple, fast and highly accurate, and provides a practical solution for rapid on-site detection, which is convenient for meat management in commercial and regulatory environments. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 Design a flow chart for the RPA-PfAgo system for testing pork;
[0036] Figure 2 Figure 1 is a graph of amplification primer pairs and gDNA screening results;
[0037] Figure 3This is the result diagram of amplification parameter optimization, which from top to bottom are MgAc, RPA reaction temperature and reaction time;
[0038] Figure 4 This is the result of multi-parameter optimization of the RPA-PfAgo system, where from top to bottom are gDNA, MnCl 2 , probes, PfAgo, and RPA products;
[0039] Figure 5 The sensitivity, specificity, and repeatability evaluation results of the RPA-PfAgo system are shown in Figure 1. From top to bottom, repeatability, specificity, and sensitivity are shown, with the primary vertical axis (scale of 4) for targeted meat and the secondary axis (scale of 0.01) for non-targeted meat and negative controls (NCs). Sensitivity highlights the maximum fluorescence intensity (MFI) at each concentration;
[0040] Figure 6 The pork RPA-PfAgo system test results for random meat samples;
[0041] Figure 7 This is a graph showing the PCR test results of random meat samples. DETAILED DESCRIPTION
[0042] The present invention provides a primer set for detecting pork, the primer set comprising a pork RPA amplification primer pair, gDNA and a molecular beacon;
[0043] The RPA amplification primer pair is SEQ ID NO.1 and SEQ ID NO.5, SEQ ID NO.1 and SEQ ID NO.6, or SEQ ID NO.3 and SEQ ID NO.5; preferably SEQ ID NO.1 and SEQ ID NO.5;
[0044] The SEQ ID NO.1 and SEQ ID NO.3 are forward primers;
[0045] SEQ ID NO.1:TCTTCATAGCAGAATATGCCAACATCATC;
[0046] SEQ ID NO.3: TCGCCATATTCTTCATAGCAGAATA;
[0047] The SEQ ID NO.5 and SEQ ID NO.6 are reverse primers;
[0048] SEQ ID NO.5:AATGTGGTGTATTTTGGTAGCACGGA;
[0049] SEQ ID NO.6: GTGGTGTATTTTGGTAGCACGGAGA;
[0050] The gDNAs are P-gDNA 21-1 and P-gDNA 21-2;
[0051] The nucleotide sequence of the P-gDNA 21-1 is shown in SEQ ID NO:7;
[0052] SEQ ID NO:7: TAATTGCTGTAATGC;
[0053] The nucleotide sequence of the P-gDNA 21-2 is shown in SEQ ID NO:8;
[0054] SEQ ID NO:8:TATGCTCCTAGGAAGA;
[0055] The nucleotide sequence of the molecular beacon is shown in SEQ ID NO: 11;
[0056] SEQ ID NO: 11: CCTAGGAAGAGAATTGCTGTAAAATGCATT.
[0057] In the present invention, the 5' end of the molecular beacon is labeled with a fluorescent group, and the fluorescent group is FAM or ROX.
[0058] The present invention provides a kit for detecting pork, the kit comprising a forward primer, a reverse primer, P-gDNA 21-1 and P-gDNA 21-2, a molecular beacon, a PfAgo enzyme and MnCl 2 .
[0059] The present invention provides a method for detecting pork using the kit, comprising the following steps:
[0060] 1) Extracting nucleic acid from the sample and amplifying it using forward primers and reverse primers to obtain an amplification product;
[0061] 2) The amplified product, P-gDNA 21-1, P-gDNA 21-2, PfAgo enzyme, MnCl 2 , a buffer solution and water are mixed and reacted to obtain a reactant;
[0062] 3) Detect whether the reactant has fluorescence. If it has fluorescence, the sample contains pork. If it does not have fluorescence, the sample does not contain pork.
[0063] In the present invention, the nucleic acid in the extracted sample in step 1) is preferably extracted using an Ezup column animal genomic DNA extraction kit;
[0064] In the present invention, the volume ratio of the amplification components in step 1) is preferably: buffer: forward primer: reverse primer: sample DNA: magnesium acetate: water = 27-32: 1-3: 1-3: 1-3: 1-4: 10-16, and further preferably: buffer: forward primer: reverse primer: template DNA: magnesium acetate: water = 28-31: 1.5-2.5: 1.5-2.5: 1.5-2.5: 1.5-2.5: 11-15, and further preferably: buffer: forward primer: reverse primer: template DNA: magnesium acetate: water = 29.5: 2: 2: 2: 2: 12.5; the volume of the final amplification system is 50 μL.
[0065] In the present invention, the initial concentrations of the forward primer and the reverse primer in step 1) are independently preferably 8-12 μM, more preferably 9-11 μM, and further preferably 10 μM; the initial concentration of magnesium acetate is preferably 250-300 mM, more preferably 260-290 mM, and further preferably 280 mM.
[0066] In the present invention, the amplification temperature in step 1) is preferably 32-40°C, more preferably 33-38°C, and more preferably 35°C. The amplification time is preferably 20-40 min, more preferably 25-35 min, and more preferably 30 min.
[0067] In the present invention, in step 2), amplification products: P-gDNA 21-1: P-gDNA 21-2: molecular beacon: PfAgo enzyme: MnCl 2 The volume ratio of buffer solution: water is preferably 4-8: 1-3: 1-3: 0.5-1.5: 3-7: 2-6: 1-5: 1-10, more preferably 5-7: 1.5-2.5: 1.5-2.5: 0.7-1.2: 4-6: 3-5: 2-4: 1.5-5, and even more preferably 6: 2: 2: 1: 5: 4: 3: 2.
[0068] In the present invention, the initial concentration of the amplified product in step 2) is preferably 1-5 ng / μL, more preferably 2-4 ng / μL, and more preferably 3 ng / μL; the initial concentrations of P-gDNA 21-1 and P-gDNA 21-2 are independently preferably 8-12 μM, more preferably 9-11 μM, and more preferably 10 μM; the initial concentration of the molecular beacon is preferably 8-12 μM, more preferably 9-11 μM, and more preferably 10 μM; the initial concentration of the PfAgo enzyme is preferably 100-300 U / μL, more preferably 150-250 U / μL, and more preferably 200 U / μL; the MnCl 2The initial concentration is preferably 30 to 50 mM, more preferably 35 to 45 mM, and even more preferably 40 mM.
[0069] In the present invention, the reaction temperature in step 2) is 93-97°C, more preferably 94-96°C, and more preferably 95°C. The reaction time is preferably 28-32 min, more preferably 29-31 min, and more preferably 30 min.
[0070] In the present invention, the fluorescence of the reactants in step 3) is detected using light with a wavelength of 470nm or 525nm. The detection in step 3) preferably records the fluorescence every 25 to 35 seconds, more preferably every 27 to 32 seconds, and even more preferably every 30 seconds.
[0071] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0072] Sources:
[0073] TwistAmp DNA amplification kit was purchased from TwistDx, Cambridge, UK;
[0074] The kit was purchased from TwistDx, Cambridge, UK;
[0075] Ezup column-type animal genomic DNA extraction kit was purchased from Bio-Tech, Shanghai, China;
[0076] 2×Taq PCR MasterMix was purchased from TIANGEN, Beijing, China.
[0077] Experimental Example 1
[0078] Design of RPA primers, gDNA, and meat molecular beacons
[0079] The conserved sequence of pigs used in the present invention is from the National Center for Biotechnology Information (NCBI, https: / / www.ncbi.nlm.nih.gov): pig (NC_000845.1), and the conserved sequence of pigs is SEQ ID NO.12: CATAATAAATGCATTTACAGCAATTCTCTTCCTAGGAGCATCC (5'-3'). The conserved sequence downloaded from NCBI was synthesized into a plasmid by GENEWIZ (Suzhou, Jiangsu Province, China) (the following is the template DNA used to optimize the reaction conditions of the entire RPA-PfAgo system). According to the design principles listed in the instructions of the TwistAmp DNA amplification kit, three sets of RPA primers were designed for the mitochondrial conserved sequence of pork. The specificity of the designed primers was verified by the Primer-BLAST tool of NCBI. The guide DNA (gDNA) was designed according to the cleavage characteristics of the PfAgo protein, including sequences complementary to the RPA primers. Two gDNA sequences and their corresponding molecular beacons were designed, the 5' end of the molecular beacon was labeled with 6-carboxyfluorescein (FAM) or 6-carboxy-X-rhodamine (ROX), and the 5' end of the gDNA was phosphorylated (see Table 1). The designed primers, gDNA and molecular beacons were synthesized by GENEWIZ (Suzhou, Jiangsu, China).
[0080] Table 1 Detailed information of designed RPA primers, gDNA sequences and molecular beacons
[0081]
[0082]
[0083] The RPA-PfAgo system design flow chart for pork testing is available at Figure 1 .
[0084] These primers were evaluated in RPA reactions, randomly paired to assess amplification efficiency and specificity. All tested combinations produced a distinct single band pattern, indicating amplification of the specific target. Quantitative gel analysis by ImageJ software enabled the selection of the three most efficient primer pairs under standardized conditions based on band brightness and clarity (see Figure 2). The best primer pairs determined were: F1R2, F1R3, and F3R2, of which F1R2 was the best, and F1R2 was used in subsequent experimental examples and embodiments. Subsequent screening paired these primers with two sets of specifically designed gDNAs for each type of meat and further evaluated them by PfAgo enzyme digestion. The results showed that the most suitable gDNAs for pork were P-gDNA21-1 and P-gDNA21-2, and subsequent experimental examples and embodiments also used gDNA21-1 and gDNA21-2. These combinations consistently produced clear and distinct RPA products, confirming their suitability for accurate meat identification.
[0085] Experimental Example 2
[0086] Optimization of RPA amplification parameters
[0087] RPA The reaction mixture included 29.5 μL of buffer A (derived from Kit), 1 μL of forward primer, 1 μL of reverse primer, 2 μL of template DNA, and 2.5 μL of magnesium acetate (MgAc, 280 mM) were added with ddH 2 O to a final volume of 50 μL. After mixing and centrifugation, the mixture was incubated at 39°C for 30 min in a PCR thermal cycler or isothermal heating device. The RPA products were analyzed by agarose gel electrophoresis. The volume of MgAc added (2.0, 2.3, 2.5, 2.8, and 3.0 μL), reaction temperature (35°C, 37°C, 39°C, 42°C, and 45°C), and time (10, 15, 20, 25, and 30 min) were systematically changed during the optimization process. Only the parameters tested were changed, and the other parameters remained unchanged. 2 O was used as a negative control for the template. Figure 3 .
[0088] Figure 3 The results showed that the optimal MgAc addition volume for pork was 2.0 μL; the optimal amplification temperature was 35°C; and the optimal amplification time was 30 minutes.
[0089] The best amplification system is:
[0090] Buffer A: volume 29.5 μL;
[0091] Forward primer: volume 2 μL, concentration 10 μM;
[0092] Reverse primer: volume 2 μL, concentration 10 μM;
[0093] Sample DNA: Volume 2 μL;
[0094] MgAc: volume 2.0 μL, concentration 280 mM;
[0095] dH 2 O: Volume is 12.5 μL.
[0096] The template DNA is used to optimize amplification parameters and needs to be replaced by sample DNA in actual operation.
[0097] The sample DNA was extracted by taking 25 mg of sample and extracting the sample DNA according to the steps in the instruction manual of the Ezup column animal genomic DNA extraction kit.
[0098] Experimental Example 3
[0099] Multi-parameter optimization of RPA-PfAgo system
[0100] PfAgo digestion reaction: The optimal amplification reaction conditions in Example 2 were used to obtain RPA amplification products. 4 μL of RPA amplification product was mixed with 2 μL of gDNA21-1 (10 μM), 2 μL of gDNA21-2 (10 μM), 1 μL of probe (MB, 10 μM), 2 μL of PfAgo enzyme (200 U / μL), and 4 μL of MnCl. 2 (40mM), 3μL 10× Buffer, and ddHO 2 O to a final volume of 25 μL. PfAgo digestion assay The reaction was carried out at 95 °C for 30 min using a GelView 6000Plus imaging station (Bo Lu Teng, Guangzhou, China) under blue light (470 nm) and green light (525 nm). 2 O served as a negative control for template.
[0101] 1. Optimization of gDNA in PfAgo digestion reaction
[0102] The F1R2 primer pair was used as the RPA specific primer pair for amplification, and the obtained RPA product was used as the RPA amplification product used in the PfAgo restriction digestion reaction. The other parameters in the PfAgo restriction digestion reaction were kept unchanged, and only the concentrations of gDNA21-1 and gDNA21-2 were changed. The PfAgo restriction digestion experiment was performed. The system (Hongshi, Shanghai, China) was used at 95°C for 30 min, and FAM fluorescence was recorded every 30 s. After the reaction, the tubes were imaged under blue light (470 nm) and green light (525 nm) by GelView 6000Plus imaging station (Bo Lu Teng, Guangzhou, China). The concentrations of gDNA1 were 10 μM, 20 μM, 40 μM, 60 μM, 80 μM, and 100 μM.
[0103] 2. MnCl in PfAgo digestion reaction 2 Added volume optimization
[0104] The F1R2 primer pair was used as the RPA specific primer pair for amplification, and the obtained RPA product was used as the RPA amplification product used in the PfAgo restriction reaction. The other parameters in the PfAgo restriction reaction were kept unchanged, and only the MnCl 2 The added volume was used for PfAgo digestion experiments. The reaction was carried out at 95 °C for 30 min using a GelView 6000Plus imaging station (Bo Lu Teng, Guangzhou, China) under blue light (470 nm) and green light (525 nm). 2 The added volumes were 1 μL, 2 μL, 3 μL, 4 μL, 5 μL and 6 μL.
[0105] 3. Optimization of probe concentration in PfAgo digestion reaction
[0106] The F1R2 primer pair was used as the RPA specific primer pair for amplification, and the obtained RPA product was used as the RPA amplification product used in the PfAgo restriction reaction. The other parameters in the PfAgo restriction reaction were kept unchanged, and only the concentration of the probe was changed. The PfAgo restriction experiment was performed. The system (Hongshi, Shanghai, China) was used at 95°C for 30 min, and FAM fluorescence was recorded every 30 s. After the reaction, the tubes were imaged under blue light (470 nm) and green light (525 nm) by GelView 6000Plus imaging station (Bo Lu Teng, Guangzhou, China). The concentrations of the probe were 10 μM, 20 μM, 40 μM, 60 μM, 80 μM, and 100 μM.
[0107] 4. Optimization of the amount of PfAgo enzyme added in the PfAgo digestion reaction
[0108] The F1R2 primer pair was used as the RPA specific primer pair for amplification, and the obtained RPA product was used as the RPA amplification product used in the PfAgo restriction digestion reaction. The other parameters in the PfAgo restriction digestion reaction were kept unchanged, and only the amount of PfAgo enzyme added was changed. The PfAgo restriction digestion experiment was performed. The system (Hongshi, Shanghai, China) was used at 95°C for 30 min, and FAM fluorescence was recorded every 30 s. After the reaction, the tubes were imaged under blue light (470 nm) and green light (525 nm) by GelView 6000Plus imaging station (Bo Lu Teng, Guangzhou, China). The amount of PfAgo enzyme added was 1 μL, 2 μL, 3 μL, 4 μL, 5 μL and 6 μL.
[0109] 5. Optimization of the volume of RPA product added in PfAgo digestion reaction
[0110] The F1R2 primer pair was used as the RPA specific primer pair for amplification, and the obtained RPA product was used as the RPA amplification product used in the PfAgo restriction digestion reaction. The other parameters in the PfAgo restriction digestion reaction were kept unchanged, and only the added volume of the RPA product was changed. The PfAgo restriction digestion experiment was performed. The system (Hongshi, Shanghai, China) was used at 95°C for 30 min, and FAM fluorescence was recorded every 30 s. After the reaction, the tubes were imaged under blue light (470 nm) and green light (525 nm) by GelView 6000Plus imaging station (Bo Lu Teng, Guangzhou, China). The added volumes of RPA products were 1 μL, 2 μL, 3 μL, 4 μL, 5 μL, and 6 μL.
[0111] The above results are detailed in Figure 4 . The results showed that as the gDNA concentration increased, the fluorescence signal initially increased but then decreased, indicating that 10 μM was the optimal concentration for gDNA21-1 and gDNA21-2. The gDNA21 combination showed the highest fluorescence intensity in both the FAM channel and the ROX channel, indicating that gDNA21 is the most suitable guide DNA for pork. The molecular beacon concentration optimization results showed that the optimal concentration of the molecular beacon was 10 μM. The optimization results of the PfAgo enzyme volume showed that the optimal volume of the PfAgo enzyme was 5 μL. For MnCl 2 The optimal volume for addition is 4 μL.
[0112] The best reaction system is:
[0113] The volume of the amplified product was 6 μL;
[0114] The volume of P-gDNA 21-1 and P-gDNA 21-2 was independently 2 μL, and the concentration was independently 10 μM;
[0115] The volume of the molecular beacon was 1 μL, and the concentration was 10 μM;
[0116] The volume of PfAgo enzyme was 5 μL, and the concentration was 200 U / μL;
[0117] MnCl 2 The volume was 4 μL and the concentration was 40 mM;
[0118] The volume of the buffer was 3 μL;
[0119] dH 2 The volume of HO is 2 μL.
[0120] Experimental Example 4
[0121] Evaluation of sensitivity, specificity, and reproducibility of the RPA-PfAgo system
[0122] Reproducibility was assessed by testing genomic DNA from pork under various conditions. Figure 5 (The experiment was repeated three times). The results showed that the coefficient of variation in all tests remained below 10%, indicating that the detection method has high repeatability and reliability. The pork-specific RPA-PfAgo platform detected fluorescence only in pork samples, and no cross-reaction was observed in chicken, beef, duck or lamb samples. The sensitivity experiment was performed by serial dilution of meat genomic DNA (ranging from 1×10 0 to 1×10 7 The results showed that the RPA-PfAgo detection system was able to detect fluorescence in pork samples. It is worth noting that the detection limit for pork was 1×10 1 copies / μL.
[0123] Example 1 Meat product detection
[0124] In order to evaluate the practical application of the RPA-PfAgo system, 20 different samples were analyzed, including commercially available meat products (randomly purchased duck, chicken, beef, pork and lamb, not purchased unprocessed meat, and the samples contained lamb kebab products and roast duck products, etc.) and artificially adulterated samples (5 samples with different mixed meat ratios), as shown in Table 2. The samples were blindly tested using the best primer pairs and gDNA screened in Example 1, the RPA conditions optimized in Experimental Example 2, and the RPA-PfAgo system optimized in Experimental Example 3, and the order was randomized and renumbered. The test results are shown in Table 2. Figure 6. PCR was then performed to verify the type of meat in the different samples, and the DNA of the samples was extracted as a template. The total reaction mixture was 25 μL, containing 12.5 μL of 2×Taq PCR MasterMix, 1 μL of 10 μM forward primer and 1 μL of reverse primer, 2 μL of DNA template and 8.5 μL of water. The PCR program was: initial denaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 45 seconds, annealing at 54°C for 45 seconds, extension at 72°C for 30 seconds, and finally extension at 72°C for 10 minutes and holding at 4°C. The PCR products were analyzed by 1.2% agarose gel electrophoresis to confirm the amplification of the target band. When performing PCR verification, the forward primer sequence used for chicken was SEQ ID NO.13: TCGACCCAGCAAATTATAGACCCAC, and the reverse primer sequence was SEQ ID NO.14: GCAAGAGTATGATTGTTGGTAGGATGATCT; the forward primer sequence used for duck was SEQ ID NO.15: GCCCATCCTTCCCACAGTATCAATC, and the reverse primer sequence was SEQ ID NO.16: CGGCGGCTAGCAGGATAGATGAGTT; the forward primer sequence used for pork was SEQ ID NO.17: AAACACTCGCATTAACAATCACCTT, and the reverse primer sequence was SEQ ID NO.18: TGTAGAATGTGGTGTATTTTGGTAGCACGGA; the forward primer sequence used for mutton was SEQ ID NO.19: GCCTCTCCAGTATTAAACTTGC, and the reverse primer sequence was SEQ ID NO. NO.20: GTACTCGTTTGCATGTTTAAGACAGAC; the forward primer sequence used for beef is SEQ ID NO.21: ATTATACATCGCCTAGCTCCATACA, and the reverse primer sequence is SEQ ID NO.22: GGTTCTTTAGTGAAGAGGCCATAGGGA. For details of the types of meat tested by PCR, see Figure 7 .
[0125] Table 2 Randomly purchased meat samples and artificially adulterated samples
[0126]
[0127]
[0128] Depend on Figure 6 It can be seen that the RPA-PfAgo system of the present invention detected that samples 6, 8, 9, 12, 14 and 16 contained pork, which is consistent with Figure 7The PCR test results match those of the control group, indicating that the RPA-PfAgo system of the present application has high detection sensitivity and good application value.
[0129] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A primer set for detecting pork, characterized in that: The primer set includes a pork RPA amplification primer pair, gDNA and a molecular beacon; The RPA amplification primer pair is SEQ ID NO.1 and SEQ ID NO.5, SEQ ID NO.1 and SEQ ID NO.6, or SEQ ID NO.3 and SEQ ID NO.5; The SEQ ID NO.1 and SEQ ID NO.3 are forward primers; The SEQ ID NO.5 and SEQ ID NO.6 are reverse primers; The gDNAs are P-gDNA 21-1 and P-gDNA 21-2; The nucleotide sequence of the P-gDNA 21-1 is shown in SEQ ID NO:7; The nucleotide sequence of the P-gDNA 21-2 is shown in SEQ ID NO:8; The nucleotide sequence of the molecular beacon is shown in SEQ ID NO:
11.
2. The primer set according to claim 1, characterized in that: The 5' end of the molecular beacon is labeled with a fluorescent group, and the fluorescent group is FAM or ROX.
3. A test kit for detecting pork, characterized in that: The kit comprises the forward primer, the reverse primer, P-gDNA 21-1, P-gDNA 21-2, a molecular beacon, a PfAgo enzyme and MnCl2 in the primer set of claim 1.
4. A method for detecting pork using the kit according to claim 3, characterized in that: The steps include: 1) Extracting nucleic acid from the sample and amplifying it using forward primers and reverse primers to obtain an amplification product; 2) mixing the amplified product, P-gDNA 21-1, P-gDNA 21-2, PfAgo enzyme, MnCl2, buffer and water, reacting to obtain a reactant; 3) Detect whether the reactant has fluorescence. If it has fluorescence, the sample contains pork. If it does not have fluorescence, the sample does not contain pork. In step 2), the volume ratio of amplification product: P-gDNA 21-1: P-gDNA 21-2: molecular beacon: PfAgo enzyme: MnCl2: buffer: water is 4-8: 1-3: 1-3: 0.5-1.5: 3-7: 2-6: 1-5: 1-10.
5. The method according to claim 4, characterized in that The volume ratio of the components amplified in step 1) is: Buffer: forward primer: reverse primer: sample DNA: magnesium acetate: water = 27-32: 1-3: 1-3: 1-3: 1-4: 10-16; The initial concentrations of the forward primer and the reverse primer are independently 8 to 12 μM; The initial concentration of magnesium acetate is 250-300 mM.
6. The method according to claim 5, characterized in that The amplification temperature in step 1) is 32-40° C. and the amplification time is 20-40 min.
7. The method according to claim 4, characterized in that Step 2) the initial concentration of the amplified product is 1-5 ng / μL; The initial concentrations of P-gDNA 21-1 and P-gDNA 21-2 were independently 8–12 μM; The initial concentration of the molecular beacon is 8 to 12 μM; The initial concentration of the PfAgo enzyme is 100-300 U / μL; The initial concentration of MnCl2 is 30-50 mM.
8. The method according to claim 7, characterized in that The reaction temperature in step 2) is 93-97° C., and the reaction time is 28-32 min.
9. The method of use according to claim 4, characterized in that: The detection in step 3) is to use light with a wavelength of 470nm or 525nm to detect whether the reactant has fluorescence.
10. The method according to claim 9, characterized in that The detection in step 3) is to record fluorescence every 25 to 35 seconds.