Molecular marker related to egg shape index and application thereof

Through SNP molecular marker detection at specific sites in the chicken reference genome, chicken individuals with advantageous genotypes are selected, which solves the problem of time-consuming and slow progress of conventional breeding methods, and achieves rapid improvement of breeding efficiency of egg-shaped index.

CN120099189APending Publication Date: 2025-06-06INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510428613.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-07
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

Conventional breeding methods in the prior art consume a lot of time and eggs, and the breeding progress is slow, making it difficult to quickly achieve the breeding goal.

Method used

The SNP molecular marker at position 14522218 from the end of the 5' on the chicken reference genome Gallus_gallos7.0_W version sequence information chromosome 7 was detected, and chicken individuals were selected according to the GG, GA, and AA genotypes, so as to achieve early selection and breeding.

Benefits of technology

This technical solution can accelerate the breeding progress of egg-shaped index traits, reduce time and resource investment, and improve breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099189A_ABST
    Figure CN120099189A_ABST
Patent Text Reader

Abstract

The invention provides a molecular marker related to an egg shape index and application of the molecular marker, and belongs to the technical field of gene detection. The molecular marker related to the egg shape index is an SNP (Single Nucleotide Polymorphism) molecular marker and corresponds to the 14522218th site from the 5'terminal on a chromosome 7 of chicken reference genome Galusgallus 7.0 W version sequence information published in ENSEMBL, and the basic group at the site is A / G. According to the technical scheme, the SNP molecular marker is related to the egg shape index and is a new molecular marker, the breeding progress of the character can be accelerated by detecting the genotype of the site of a chicken individual to be detected and performing early selection on the chicken with the dominant genotype, a large amount of time and eggs cannot be consumed, and the breeding efficiency is improved. The method has great application value and economic benefit.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a molecular marker related to an egg shape index and an application thereof. Background Art

[0002] The egg shape index refers to the ratio of the short diameter to the long diameter of the egg. The egg shape index is an important indicator of egg quality. Consumers have a low acceptance of eggs with an egg shape index that is too large or too small, and eggs with an egg shape index that is too large or too small are more likely to break during transportation. The egg shape index of each breed is different. The eggs of Chinese local chicken breeds tend to be slender, so the egg shape index generally needs to be increased. The eggs of imported chicken breeds tend to be round, so the egg shape index generally needs to be lowered. The conventional breeding method for this trait requires a large number of phenotypic measurements, which consumes a lot of time and eggs, and the breeding progress is slow.

[0003] The selection of genetic variations such as SNP molecular markers associated with traits can enable early and accurate selection of traits, further improving the breeding progress of target traits from a genetic perspective. Whole genome association analysis is one of the most important methods for identifying genetic variations of complex traits. Therefore, the mining and verification of molecular markers of egg shape index and the establishment of molecular breeding technology are of great significance to improving the breeding progress of this trait and enabling it to quickly achieve breeding goals. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular marker related to the egg shape index and its application, aiming to solve the technical problems in the prior art that conventional breeding methods consume a lot of time and eggs and the breeding progress is slow.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides a molecular marker related to an egg shape index. The molecular marker is a SNP molecular marker corresponding to the 14522218th position from the 5' end on chromosome 7 of the chicken reference genome Gallus_gallus7.0_W version sequence information published in ENSEMBL, where the base is A / G.

[0007] Furthermore, when the SNP molecular marker is a GG genotype, the corresponding egg-shaped index is small; when it is a GA genotype, the corresponding egg-shaped index is in the middle; when it is an AA genotype, the corresponding egg-shaped index is large.

[0008] The present invention also provides a primer pair for detecting the molecular markers related to the egg shape index of chicken eggs described in the above technical solution, the primer pair comprising an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID NO:2, and the downstream primer is shown as SEQ ID NO:3.

[0009] The present invention also provides an application of a molecular marker related to the egg shape index as described in the above technical scheme in identifying or assisting in identifying the egg shape index of an egg, wherein the application is specifically as follows: detecting the genotype of the SNP in the tested chicken, the egg shape index of the tested chicken with the genotype of GG is smaller; the egg shape index of the tested chicken with the genotype of GA is in the middle; the egg shape index of the tested chicken with the genotype of AA is larger.

[0010] The present invention also provides an application of the molecular markers related to the egg shape index described in the above technical solution in chicken breeding, wherein the application specifically comprises: detecting the genotype of the SNP in the chicken to be tested, and selecting parents with the genotype of GG for breeding.

[0011] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0012] The SNP molecular marker in the technical solution of the present invention is related to the egg shape index and is a new molecular marker. By detecting the genotype of this site in the chicken individual to be measured, chickens with a superior genotype can be selected at an early stage, which can accelerate the breeding progress of this trait without consuming a lot of time and eggs, and has great application value and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a schematic diagram of the results of the whole genome association analysis in Example 1. DETAILED DESCRIPTION

[0014] The invention provides a molecular marker related to an egg shape index. The molecular marker is a SNP molecular marker corresponding to the 14522218th position from the 5' end on chromosome 7 of the chicken reference genome Gallus_gallus7.0_W version sequence information published in ENSEMBL, where the base is A / G.

[0015] The present invention also provides a primer pair for detecting the molecular markers related to the egg shape index of chicken eggs described in the above technical solution, the primer pair comprising an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID NO:2, and the downstream primer is shown as SEQ ID NO:3.

[0016] The 14522218th position from the 5' end on chromosome 7 described in the present invention is referred to as chr7:14522218 in the following description and in the examples.

[0017] In the present invention, the primer pair is designed and synthesized based on the upstream and downstream DNA sequence information of chr7:14522218 site published on the Ensemble website, namely SEQ ID NO:1, wherein SEQ ID NO:1 is CCATCTTACTTTTCTAGCAAGTGCTGGTGAGGTTTTTCAATTG AGCTTGAAAGTGCTCCCTAAGTTACCAAGTCACCAAACAGGCTATCCTCAAAATCCTGCCTACAGCCCATTCACAGCAGAAAAAACCCACCTCCCAAATGAAAGAACCACCAGAACACCTGCAGGGAGAGTAAAGCTCTCCCTGCAGCTTTAAAAAAAGAAGATTTTGGAAAATCTGACTGGAACTCAGATTTTAGCAAGTAAGAACG / ACTTAAGAATAGGGGACAGCACAGTCAT GACCCTTCTTATTTCATCTGTCTAAGCTCTGTCAGCCTTGACTGCACTAAGCACCTTTTCTGGCAGATCTGATGCTTGCCTTGAAGGGTCAGTGATGCCTGCAAATGCTTCCTTTTTGCAATATTTTATCTCTTCGGGAAGGTAGGTGGTATTTTCATTCAAAGATAATTCAACTGTGCCAAATCAGGTTTTCACATACAATTTGAATTTTAAAATGTTTTCT.

[0018] In the present invention, the SEQ ID NO: 2 is CCACCTCCCAAATGAAAGAA; the SEQ ID NO: 3 is GTGCAGTCAAGGCTGACAGA.

[0019] The present invention also provides an application of a molecular marker related to the egg shape index as described in the above technical scheme in identifying or assisting in identifying the egg shape index of an egg, wherein the application is specifically as follows: detecting the genotype of the SNP in the tested chicken, the egg shape index of the tested chicken with the genotype of GG is smaller; the egg shape index of the tested chicken with the genotype of GA is in the middle; the egg shape index of the tested chicken with the genotype of AA is larger.

[0020] The present invention also provides an application of the molecular markers related to the egg shape index described in the above technical solution in chicken breeding, wherein the application specifically comprises: detecting the genotype of the SNP in the chicken to be tested, and selecting parents with the genotype of GG for breeding.

[0021] In the present invention, unless otherwise specified, the required raw materials for preparation are all commercially available products well known to those skilled in the art.

[0022] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0023] Example 1

[0024] Determination of SNP molecular markers associated with egg shape index size

[0025] (1) Experimental animals: 197 purebred white Leghorn chickens were selected and fed and watered ad libitum during the feeding process. The feeding standards were in accordance with the relevant provisions of the industry standard (NY / T 33-2004);

[0026] (2) Extraction of genomic DNA: 0.5 mL of venous blood was collected from all test chicken wings using an anticoagulant vacuum blood collection tube, and the whole genomic DNA was extracted using the phenol-chloroform extraction method. The concentration and purity of the DNA samples were tested, and then agarose gel electrophoresis was performed to further test the purity and integrity of the DNA samples. The sample concentration was required to be greater than 50 ng / μL, the purity OD260 / 280 was 1.8-2.0, and the integrity was good. The DNA samples were stored at -20 degrees for later use;

[0027] (3) Genome resequencing: DNA samples of all experimental chickens were sent to a genetic testing company, and the DNBSEQ sequencing platform was used to perform individual whole genome resequencing according to standard operating procedures, with a sequencing depth of approximately 15×; BWA and GATK software were used for sequence alignment and genotype extraction; SNP call rate and MAF were used for further quality control to obtain 7,498,204 SNPs and 203 individuals for subsequent analysis;

[0028] (4) Phenotypic determination: The long and short diameters of three eggs from each chicken at 32 weeks of age were measured, and the egg shape index was calculated as (short diameter / long diameter) × 100;

[0029] (5) Genome-wide association analysis: After pedigree data, phenotypic data, and genomic SNP site data were sorted, GCTA software was used to perform genome-wide association analysis. The univariate mixed linear model was:

[0030] y=Xb+jα+u+e

[0031] y is the phenotypic value; b is the fixed effect (including group effect and cage effect), X is the corresponding relationship matrix; j is the additive genotype of the SNP site to be detected, α is the additive SNP effect; u is the random animal effect, which obeys where G is the genome additive relationship matrix, is the additive genetic variance; e is subject to The residual effect of , where I is the identity matrix, The R package qvalue was used to calculate the genome-wide FDR value, and FDR<0.01 was set as the significance threshold (P=1.43E-06).

[0032] GWAS analysis results Figure 1 As shown, based on Figure 1 It can be seen that the egg shape index is significantly associated with the 0.2Mb region on chromosome 7 (chr7:14466623-14605125). All sites in the genome association region were further verified, and the chr7:14522218 site was locked as a candidate site. The genetic marker information affecting the egg shape index is shown in Table 1.

[0033] Table 1 Genetic markers affecting egg shape index

[0034]

[0035] Example 2

[0036] Correlation test between different genotypes of chr7:14522218 locus and egg shape index

[0037] (1) Experimental animals: Same as in Example 1.

[0038] (2) Phenotypic determination: Same as Example 1.

[0039] (3) Extraction of genomic DNA: Same as Example 1.

[0040] (4) Genotyping of chr7:14522218 locus: same as Example 1.

[0041] (5) Determination of phenotypic dominant genotype: The egg shape index of eggs from individuals with the GG genotype at chr7:14522218 was 74.80, and the egg shape index of eggs from individuals with the GA genotype was 76.72. The GA type is the dominant genotype for the large egg shape index, and the GG type is the dominant genotype for the small egg shape index.

[0042] Table 2 Egg shape index of chicken eggs from individuals with different genotypes at the chr7:14522218 SNP locus

[0043]

[0044] Note: Some of the individuals sequenced did not lay eggs or died when the egg shape index was measured at 32 weeks, so they are not included in the table. ab: Different letters in the shoulder indicate significant differences among the groups (P<0.05).

[0045] Example 3

[0046] Establishment of a molecular marker detection method for the chr7:14522218 locus and its application in breeding Establishment of a molecular marker detection method: According to the upstream and downstream DNA sequence information of the chr7:14522218 locus published on the Ensemble website (SEQ ID NO: 1), specific primers were designed and synthesized for PCR amplification. SEQ ID NO: 1 is: CCATCTTACTTTTCTAGCAAGTGCTGGTGAGGTTTTTCAA TTGAGCTTGAAAGTGCTCCCTAAGTTACCAAGTCACCAAACAGGCTATCCTCAAAATCCTGCCTACAGCCCATTCACAGCAGAAAAAACCCACCTCCCAAATGAAAGAACCACCAGAACACCTGCAGGGAGAGTAAAGCTCTCCCTGCAGCTTTAAAAAAAGAAGATTTTGGAAAATCTGACTGGAACTCAGATTTTAGCAAGTAAGAACG / ACTTAAGAATAGGGGACAGCACAGT CATGACCCTTCTTATTTCATCTGTCTAAGCTCTGTCAGCCTTGACTGCACTAAGCACCTTTTCTGGCAGATCTGATGCTTGCCTTGAAGGGTCAGTGATGCCTGCAAATGCTTCCTTTTTGCAATATTTTATCTCTTCGGGAAGGTAGGTGGTATTTTCATTCAAAGATAATTCAACTGTGCCAAATCAGGTTTTCACATACAATTTGAATTTTAAAATGTTTTCT.

[0047] The specific primer sequence information obtained is shown in Table 3, the PCR amplification system is shown in Table 4, and the PCR amplification conditions are shown in Table 5. The amplified product was analyzed by first-generation sequencing results for the genotype of the chr7:14522218 site, and the genotype results included GG and GA.

[0048] Table 3 Specific primer sequence list

[0049] Primer name sequence Corresponding number of sequence list Upstream primer CCACCTCCCAAATGAAAGAA SEQ ID NO:2 Downstream primer GTGCAGTCAAGGCTGACAGA SEQ ID NO:3

[0050] Table 4 PCR amplification system

[0051] Reagents Volume (μL) <![CDATA[ddH 2 The]]> 8.0 2×Taq Plus Master Mix 10.0 Upstream primer (10 μM) 0.5 Downstream primer (10 μM) 0.5 Genomic DNA 1.0 Total 20.0

[0052] Table 5 PCR amplification conditions

[0053]

[0054] Application Example 1

[0055] 225 pure Beijing oil chickens were selected as research subjects, and the breeding target was the small egg shape index; at 3 weeks of age, blood samples were collected and genomic DNA was extracted with reference to (3) of Example 1. The site sequence was amplified by specific primers and first-generation sequencing was performed, and the site was genotyped, among which 202 individuals with GG genotype, 23 individuals with GA genotype, and 0 individuals with AA genotype. GG type individuals can be selected based on the dominant genotype of the small egg shape index. The chickens continued to be raised until they laid eggs, and the egg shape index at 32 weeks of age was measured. The verification results are shown in Table 6. Based on Table 6, it can be seen that the egg shape index of the GG genotype individual is 77.80, which is lower than the egg shape index of the GA genotype individual of 79.10.

[0056] Table 6 Correlation index between different genotypes of chicken chr7:14522218 SNP locus and egg shape index

[0057]

[0058] Note: ab: Different letters in the shoulder indicate significant differences among the groups (P<0.05).

[0059] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A molecular marker associated with egg shape index, characterized in that: The molecular marker is a SNP molecular marker, corresponding to the 14522218th position from the 5' end on chromosome 7 of the chicken reference genome Gallus_gallus7.0_W version sequence information published in ENSEMBL, where the base is A / G.

2. The molecular marker associated with egg shape index according to claim 1, characterized in that: When the SNP molecular marker is a GG genotype, the corresponding egg-shaped index is small; when it is a GA genotype, the corresponding egg-shaped index is in the middle; when it is an AA genotype, the corresponding egg-shaped index is large.

3. A primer pair for detecting a molecular marker associated with an egg shape index as claimed in any one of claims 1 to 2, characterized in that: The primer pair includes an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID NO:2, and the downstream primer is shown as SEQ ID NO:

3.

4. Use of a molecular marker related to egg shape index as claimed in any one of claims 1 to 2 in identifying or assisting in identifying egg shape index, characterized in that: The application is specifically as follows: detecting the genotype of the SNP in the tested chicken, the egg shape index of the eggs obtained from the tested chicken with the genotype of GG is smaller; the egg shape index of the eggs obtained from the tested chicken with the genotype of GA is in the middle; the egg shape index of the eggs obtained from the tested chicken with the genotype of AA is larger.

5. Use of a molecular marker related to egg shape index as claimed in any one of claims 1 to 2 in chicken breeding, characterized in that: The application is specifically: detecting the genotype of the SNP in the chicken to be tested, and selecting parents with the genotype of GG for breeding.

Citation Information

Cited By

  • Molecular marker related to eggshell strength in egg laying peak period and application of molecular marker

    CN120924681A

  • POMT1 gene molecular marker primer related to chicken malformed egg traits and application of POMT1 gene molecular marker primer

    CN121109617A