Molecular marker related to sheep chest breadth character and application thereof
The molecular markers related to the breast width trait of Merino goat were screened through GWAS analysis, solving the problem of inefficient breeding in the prior art, and achieving rapid and low-cost breast width prediction and improvement of breeding efficiency.
Patent Information
- Application Number
- CN202510580214.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-07
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-05-07
AI Technical Summary
In the prior art, there are few studies on the molecular markers of merino breast wide traits, resulting in low breeding efficiency.
Multiple molecular markers significantly related to the merino breast wide trait were screened through GWAS analysis, identifying key mutation sites, and providing SNP molecular markers for breeding.
It achieves rapid, low-cost and effective prediction of the breast width of Merino sheep, improves the efficiency of breeding work, and enhances the meat performance and environmental adaptability of sheep.
Smart Images

Figure CN120099191A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of animal breeding, and in particular to a molecular marker related to a sheep chest width trait and an application thereof. Background Art
[0002] Merino sheep is an excellent wool and meat dual-purpose sheep breed, with high wool density and uniform fineness, and occupies an important position in the wool market. As a high-quality sheep breed, Merino sheep not only has fine wool, but also excellent meat quality, which makes it the first choice for many breeding projects.
[0003] Chest width is an important indicator for evaluating the body shape and meat quality of Merino sheep. It is not only related to its meat performance, but also an important trait for measuring the overall body shape and physique of the sheep. A wider chest width usually means better carcass structure and meat quality performance, and a body shape with a wide and deep chest helps Merino sheep better adapt to different ecological environments. Therefore, genetic improvement of the chest width trait is a key goal in Merino sheep breeding and has important advantages in the selection and breeding of Merino sheep. However, there are relatively few molecular marker studies on the chest width trait of Merino sheep. Summary of the invention
[0004] In order to solve the problems existing in the prior art, the present invention provides a molecular marker related to the chest width trait of sheep and application thereof.
[0005] The present invention screens out multiple molecular markers significantly associated with the chest width trait of Merino sheep through GWAS analysis, explores their application potential in molecular marker-assisted breeding, identifies key mutation sites associated with chest width, and can effectively improve the efficiency of breeding work.
[0006] In a first aspect, the present invention provides a molecular marker, according to the assembly ARS-UI_Ramb_v2.0 genome version, the molecular marker includes one or more of the following: chr26:31137100, chr26:31137192, chr26:31137200, chr26:31313852, chr26:31314087, chr26:31315328, chr26:31319977, chr26:31320545 and chr26:31317966; The chr26: 31137100 is located at position 31137100 of sheep chromosome 26, and the polymorphism is G or A; The chr26:31137192 is located at position 31137192 of sheep chromosome 26, and the polymorphism is A or G; The chr26:31137200 is located at position 31137200 of sheep chromosome 26, and the polymorphism is A or G; The chr26: 31313852 is located at position 31313852 of sheep chromosome 26, and the polymorphism is C or A; The chr26: 31314087 is located at position 31314087 of sheep chromosome 26, and the polymorphism is C or T; The chr26: 31315328 is located at position 31315328 of sheep chromosome 26, and the polymorphism is T or C; The chr26: 31319977 is located at position 31319977 of sheep chromosome 26, and the polymorphism is T or G; The chr26: 31320545 is located at position 31320545 of sheep chromosome 26, and the polymorphism is G or A; The chr26: 31317966 is located at position 31317966 of sheep chromosome 26, and the polymorphism is G or A.
[0007] In a second aspect, the present invention provides a molecular marker, the molecular marker comprising a nucleotide sequence as shown in any one of SEQ ID NO.1-9; As shown in SEQ ID NO.1, position 51 is a mutation site, and the polymorphism is G or A; As shown in SEQ ID NO.2, position 51 is a mutation site, and the polymorphism is A or G; As shown in SEQ ID NO.3, position 51 is a mutation site, and the polymorphism is A or G; As shown in SEQ ID NO.4, position 51 is a mutation site, and the polymorphism is C or A; As shown in SEQ ID NO.5, position 51 is a mutation site, and the polymorphism is C or T; As shown in SEQ ID NO.6, position 51 is a mutation site, and the polymorphism is T or C; As shown in SEQ ID NO.7, position 51 is a mutation site, and the polymorphism is Y or G; As shown in SEQ ID NO.8, position 51 is a mutation site, and the polymorphism is G or A; As shown in SEQ ID NO.9, position 51 is a mutation site, and the polymorphism is G or A.
[0008] In a third aspect, the present invention provides a primer pair, wherein the primer pair is used to amplify the aforementioned molecular marker.
[0009] In a fourth aspect, the present invention provides a kit, characterized in that it includes the aforementioned molecular marker or the aforementioned primer pair.
[0010] In a fifth aspect, the present invention provides the use of the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned kit in detecting the chest width trait of sheep.
[0011] In a sixth aspect, the present invention provides the use of the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned kit in any of the following: (1) Predicting or detecting the chest width trait of sheep, or preparing a reagent for predicting or detecting the chest width trait of sheep; (2) Molecular marker-assisted breeding of sheep chest width traits; (3) Improvement of sheep breeds related to chest width traits; (4) Improvement of sheep germplasm resources.
[0012] In a seventh aspect, the present invention provides a method for identifying the chest width trait of a sheep, comprising: The sample of the sheep to be tested is tested for the polymorphism of the molecular markers as mentioned above, and the chest width trait of the sheep to be tested is determined according to the genotype detection result of the molecular markers.
[0013] Furthermore, the detection method includes: one or more of gene sequencing, molecular probes, liquid phase capture or mass spectrometry.
[0014] Furthermore, the chest width trait of the sheep to be tested is determined according to the genotype detection result of the molecular marker, including any one or more of the following: (1) For chr26:31137100, sheep with genotype GG have a longer chest width than sheep with AG; (2) For chr26:31137192, sheep with genotype AA have a longer chest width than sheep with GA; (3) For chr26:31137200, sheep with genotype AA have a longer chest width than those with GA; (4) For chr26:31313852, sheep with genotypes AA and AC had longer chest widths than those with CC; (5) For chr26:31314087, sheep with genotypes TT and TC had longer chest widths than those with CC; (6) For chr26:31315328, sheep with genotypes CC and CT had longer chest widths than those with TT; (7) For chr26:31319977, sheep with genotypes GG and GT had longer chest widths than those with TT; (8) For chr26:31320545, sheep with genotypes AA and AG had longer chest widths than those with GG; (9) For chr26:31317966, sheep with genotypes AA and AG had longer chest widths than those with genotypes GG.
[0015] In an eighth aspect, the present invention provides a method for breeding a long-chested and wide-breasted sheep breed, comprising: When breeding, the genotype of the sheep population, such as the aforementioned molecular markers, is detected, and sheep with any one or more of the following genotypes are used for breeding: (1) For chr26:31137100, select sheep with genotype GG; (2) For chr26:31137192, select sheep with genotype AA; (3) For chr26:31137200, select sheep with genotype AA; (4) For chr26:31313852, sheep with genotypes AA and AC were selected; (5) For chr26:31314087, sheep with genotypes TT and TC were selected; (6) For chr26:31315328, sheep with genotype CC and CT were selected; (7) For chr26:31319977, select sheep with genotypes GG and GT; (8) For chr26:31320545, select sheep with genotypes AA and AG; (9) For chr26:31317966, sheep with genotypes AA and AG were selected.
[0016] The present invention has the following beneficial effects: The present invention screens multiple SNP markers related to the chest width trait of Merino sheep based on whole genome association analysis, and can quickly, cost-effectively and effectively predict the chest width of Merino sheep by detecting the polymorphism of these SNP molecular markers. The SNP molecular markers provided by the present invention can be used to breed Merino sheep with long chest width traits, improve their meat performance and environmental adaptability, which is of great significance in the field of Merino sheep breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0018] Figure 1 The technical route for screening SNPs related to the chest width trait of Merino sheep provided in Example 1 of the present invention.
[0019] Figure 2 This is the SNP density map provided in Example 1 of the present invention.
[0020] Figure 3 This is the SNP distribution diagram provided in Example 1 of the present invention.
[0021] Figure 4 This is the chest width phenotype distribution diagram provided in Example 1 of the present invention.
[0022] Figure 5 This is the Manhattan plot of the genome-wide association analysis of Merino sheep chest width provided in Example 1 of the present invention.
[0023] Figure 6 This is the QQ plot result of the chest width of Merino sheep provided in Example 1 of the present invention.
[0024] Figure 7 This is the GO function enrichment map of the Merino sheep chest width significant SNPs candidate genes provided in Example 1 of the present invention. DETAILED DESCRIPTION
[0025] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0026] The experimental methods involved in the following examples, unless otherwise mentioned, are all conventional methods in the art, for example, reference may be made to experimental manuals in the art, or the conditions recommended in the manufacturer's instructions.
[0027] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.
[0028] Example 1 The present invention uses the following method to mine molecular markers related to Merino sheep chest width, such as Figure 1As shown, the following process is included: 1. Materials and methods 1.1 Experimental animals and sample collection The 302 Merino sheep in the present invention were from a Xinjiang Merino sheep farm. The first batch included 232 sheep (26 rams and 206 ewes), and the second batch included 70 sheep (70 rams). Blood samples were collected from the groups, and chest width data were recorded.
[0029] 1.2 Whole-genome resequencing The genomic DNA was extracted by magnetic bead method according to the conventional extraction steps. The extracted DNA was tested for integrity and purity. For qualified genomic DNA samples, the fragments of appropriate size were selected by gel electrophoresis, and then the library was constructed by PCR enrichment. After the library was constructed, the quantification quality control was performed using Qubit, and the qualified library was sequenced. After the sequencing was completed, the base sequencing quality distribution analysis and base content distribution analysis were performed, and the raw image data (Raw reads) files obtained by high-throughput sequencing were filtered.
[0030] The final sequence obtained by sequencing was re-aligned to the reference genome for subsequent analysis. The reference gene species is sheep, and the genome version is: assembly ARS-UI_Ramb_v2.0.
[0031] 1.3 Quality Control of Genomic Data In order to obtain reliable GWAS results, PLINK1.9 software was used to perform quality control on the genotype data. The quality control conditions were as follows: (1) Retain the SNP sites on the autosomes, (2) Eliminate sites with a deletion rate greater than 10%. (3) Eliminate sites with minor allele frequencies less than 0.05. (4) Eliminate those samples that do not meet the Hardy-Weinberg test P value less than 10 -6 The location.
[0032] After screening, a total of 22,751,147 SNP loci covering chromosomes 1-26 were finally obtained. The density map of the loci after quality control is shown in Figure 2 The changes in the number of loci on chromosomes before and after quality control are shown in Figure 3 .
[0033] 1.4 Introduction to genome-wide association analysis software The GMAT software was used to conduct genome-wide association analysis on chest width. The current GWAS analysis software only considers the additive effect of genes, ignoring the non-additive effect, especially the interaction effect, resulting in incomplete analysis of complex traits; the research traits also focus on cross-sectional data collected at a certain time point, ignoring longitudinal traits. The GMAT software has six modules, including single trait analysis module, multi-trait analysis module, and longitudinal data analysis module. Compared with traditional GWAS analysis software, it is richer in model richness and trait applicability, significantly improves the statistical test power, and is more conducive to mining significant markers associated with traits. In terms of calculation, the GMAT software is written in C++ language, calling the Eigen and MKL libraries, using block reading and block calculation technology to save memory, and using technical means such as feature decomposition relationship matrix, linear transformation genome estimation, EM and AI algorithm weighting, making the GAMT software extremely efficient, and the calculation efficiency can be increased by thousands of times compared with the Fast-LMM algorithm.
[0034] 1.5 Genome-wide association analysis After the sequencing data was quality controlled, GMAT software was used to conduct an association analysis with chest width based on the LMM model to screen out SNPs with significant effects. The LMM model is as follows:
[0035] Where y is the phenotype vector, is a fixed effect or covariate, for The correlation matrix of To test the marker effect, for The correlation matrix of is the polygenic effect, and e is the residual effect.
[0036] 1.6 Group Stratification Population stratification refers to the difference in allele frequency due to different ancestors, which has been proven to be a confounding factor and may lead to false positive results. Therefore, a QQ graph was drawn for the chest width index of Merino sheep to determine whether there were biased samples and population stratification in the association analysis.
[0037] 1.7 Significant SNPs Gene Annotation After obtaining the significant SNPs markers of the whole genome association analysis, the reference genome information of the corresponding species was downloaded from the ENSEMBL website, and the genes near the significant SNPs were annotated using the ANNOVAR software. The clusterProfiler package was used to perform gene function enrichment analysis on the annotated candidate genes according to the GO database.
[0038] 2. Results and Analysis 2.1 Sequencing data quality control and comparison with reference genome The sample sequencing quality control data are shown in Table 1. The base type distribution test is mainly used to check whether there is AT and CG separation. As shown in Table 1, the average percentage of G and C in the sample is 43.82% of the total bases, the number of bases with a quality value greater than or equal to 20 accounts for 98.11% of the total bases, and the number of bases with a quality value greater than 30 accounts for 94.05% of the total bases. The average efficiency of the comparison between sample DNA and genomic DNA is 99.89%. This shows that the library construction and sequencing of the samples of this group are normal.
[0039] Table 1 Quality control statistics of sample sequencing data
[0040] 2.2 Statistics of different chest width traits of Merino sheep The present invention statistically analyzes the maximum, minimum, average, standard deviation and coefficient of variation of the chest width of 302 Merino sheep. As shown in Table 2, the maximum, minimum and average of the chest width are 19 cm, 31 cm and 24.65 cm respectively; the average chest width of the 302 sheep is 24.65 cm. Figure 4 shown.
[0041] Table 2 Statistics of Merino sheep chest width
[0042] 2.3 Genome-wide association analysis of Merino sheep chest width traits Based on resequencing, 22,751,147 SNPs were screened for further analysis. Using the commonly used GWAS model LMM statistical analysis, 361 SNPs were found to be significantly associated with Merino sheep chest width. The Manhattan plot of the genome-wide association analysis is shown in the figure below. Figure 5 As shown, the QQ graph results are as follows Figure 6 As shown. Through NCBI and Ensembl sequence alignment, 33 genes were annotated. Through literature review and multiple comparisons, chr26:31137100, chr26:31137192, chr26:31137200, chr26:31313852, chr26:31314087, chr26:31315328, chr26:31319977, chr26:31320545 and chr26:31317966 were anchored and annotated to the KCNU1 gene. The detailed information of the 9 sites is shown in Table 3.
[0043] Table 3 Information on the significantly associated SNPs in Merino sheep
[0044] 2.4 Merino sheep chest width-related candidate genes and GO functional annotations Gene function enrichment analysis was performed based on the GO and KEGG databases, and the functional annotation results (see Figure 7 ), the 9 significant sites related to chest width anchored: chr26:31137100, chr26:31137192, chr26:31137200, chr26:31313852, chr26:31314087, chr26:31315328, chr26:31319977, chr26:31320545 and chr26:31317966 sites are all annotated to the potassium calcium activated channel subfamily U member 1 (KCNU1) gene. KCNU1 is located on chromosome 26 of sheep and is a member of the potassium channel protein family. This gene encodes a potassium ion channel protein. Studies have shown that this gene is significantly correlated with chest size.
[0045] The gene mutation of KCNU1 may affect the function of potassium channels, resulting in changes in potassium channel activity, which may interfere with normal development and ultimately affect the chest width of the individual. In addition, the sequence information of 50 bp before and after the site (including the site, a total of 101 bp) was extracted, as shown below: CHR26:31137100 (SEQ ID NO.1):TCCTTTAAGCTTTGTGAAAGGGAAGGATTGATAGAGAATCAAGGGTGTTGCTATTCGAGAAATTGATAGCCAAATTTTTCTCCCCCTAGAAGTGGTCTCT.
[0046] CHR26:31137192 (SEQ ID NO. 2): GTGGTCTCTCTCCTTGGAACTGCCGTAAAGCTCTCTGCGCTTTGGTCTCATCTCCCCAGCACTTTATCATTTTCTACTTGGTGTCAGGCTCCTCTGTGTC.
[0047] CHR26:31137200 (SEQ ID NO.3): TTCTCCTTGGAACTGCCGTAAAGCTCTCTGCGCTTTGGTCTCATCTCCCCAGCACTTTATCATTTTCTACTTGGTGTCAGGCTCCTCTGTGTCCATGCCTT.
[0048] CHR26:31313852 (SEQ ID NO.4): CAAACCAGAGAAGGCAGAAAAGGCAGGGGAAGAATAAATGCAGAAAATAGAAAACAATTATAAAACATAGTAGACAATCTGATTGATCAATAATCACTTTT.
[0049] CHR26:31314087 (SEQ ID NO.5): CCATAGACAAAAGAGCCCAGTGGGCTACAGTCGATGGGGTTGCAAAGAGATAGACATGACTGAGCAACTGAACCCAGCACACAAATAAAATAACTGAAAGA.
[0050] CHR26:31315328 (SEQ ID NO. 6): GATAACTGGTAAGGACCTCCTACGGAGAAGGCAATGGCACCCCACTCCAGCACTCTTGCCTGGAAAATCCCATGGATGGAGGAGCCTGGTGGGCTGCAGTC.
[0051] CHR26:31319977 (SEQ ID NO. 7): TCTTAAATTTTGTCTGTTTCTAAGAAGTCAGCGTGAAAAAGCTACATATTATATGATTCAAATTATATGACATTCTGGAAAAGGCCAGACTATAATGACAG.
[0052] CHR26:31320545 (SEQ ID NO. 8): GGTTCATCCCTCTGAAAAAAACCATTCAGCCCTTCCCACATCCTCTGAAATCACTAATATACTTTCTGTCTTTATGGATTTCCCCATTCTGAACATGTTGT.
[0053] CHR26:31317966 (SEQ ID NO.9): ATGTACCCAGGAGTAGGATTGTTAGGTTATGTGATAACTTGATGCATAGCGTTTTGAAGAGCTGCCAAATTATTTTGCAATGCTGATACACCGTTGGTGAT.
[0054] Example 2 The present invention verifies the association between the multiple SNP molecular markers obtained in Example 1 and the chest width trait of sheep, and the process is as follows: 1. Materials and methods 1.1 Experimental animals and sample collection The 201 Merino sheep used for verification came from the Xinjiang Merino sheep farm, of which the first batch included 32 ewes (32 ewes) and the second batch included 169 ewes (21 rams and 148 ewes). Blood samples were collected from the group and chest width data were recorded. Genotype detection was performed using liquid capture technology to verify the above 9 SNP sites related to the chest width trait of Merino sheep.
[0055] 1.2 Association analysis between significant loci and traits and multiple comparisons The association test between marker genotype and phenotype was performed using R4.2 software. The model is as follows:
[0056] y is the phenotype vector, is a fixed effect or covariate (gender, measurement day), X is The correlation matrix of , γ is the marker effect to be tested, Z is the correlation matrix of γ, is the residual effect. LSD method was used for multiple comparisons between different genotypes.
[0057] 2. Association analysis between significant loci and traits and multiple comparison results For the 9 SNP markers related to the chest width trait of Merino sheep obtained above, the association test between marker genotype and phenotype and the LSD method were used for multiple comparisons between different genotypes. The results showed that: the 9 loci had two or three genotypes in the Merino sheep population (such as the chr26:31137100 site had three genotypes of AG, and GG; the chr26:31313852 site had three genotypes of AA, AC and CC), and the average chest width of different genotypes also had different differences.
[0058] The results are shown in the following table (P verification shows that there are significant differences): (1) For chr26:31137100, sheep with genotype GG have a longer chest width than sheep with AG; (2) For chr26:31137192, sheep with genotype AA have a longer chest width than sheep with GA; (3) For chr26:31137200, sheep with genotype AA have a longer chest width than those with GA; (4) For chr26:31313852, sheep with genotypes AA and AC had longer chest widths than those with CC; (5) For chr26:31314087, sheep with genotypes TT and TC had longer chest widths than those with CC; (6) For chr26:31315328, sheep with genotypes CC and CT had longer chest widths than those with TT; (7) For chr26:31319977, sheep with genotypes GG and GT had longer chest widths than those with TT; (8) For chr26:31320545, sheep with genotypes AA and AG had longer chest widths than those with GG; (9) For chr26:31317966, sheep with genotypes AA and AG had longer chest widths than those with genotypes GG.
[0059] Table 4 Correlation test between Merino sheep SNPs and chest width
[0060] Note: There is no significant difference between the data with the same lowercase letters in the numbers of the same trait, and there is a significant difference between the data with different lowercase letters.
[0061] The present invention uses 302 Merino sheep as experimental subjects for whole genome association analysis, records the chest width data of the sheep, collects blood samples of the group samples, extracts genomic DNA, and detects the concentration, integrity and purity of the DNA, and resequences the qualified samples, and then performs whole genome association analysis on the chest width index of Merino sheep to screen candidate genes and SNP sites. 201 Merino sheep were genotyped by liquid phase capture technology, and the 9 chest width related sites screened by whole genome association analysis were verified, which provides support for the future selection and breeding of new high-quality Merino sheep varieties.
[0062] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A molecular marker, characterized in that According to the assembly ARS-UI_Ramb_v2.0 genome version, the molecular markers include one or more of the following: chr26:31137100, chr26:31137192, chr26:31137200, chr26:31313852, chr26:31314087, chr26:31315328, chr26:31319977, chr26:31320545 and chr26:31317966; The chr26: 31137100 is located at position 31137100 of sheep chromosome 26, and the polymorphism is G or A; The chr26:31137192 is located at position 31137192 of sheep chromosome 26, and the polymorphism is A or G; The chr26:31137200 is located at position 31137200 of sheep chromosome 26, and the polymorphism is A or G; The chr26: 31313852 is located at position 31313852 of sheep chromosome 26, and the polymorphism is C or A; The chr26: 31314087 is located at position 31314087 of sheep chromosome 26, and the polymorphism is C or T; The chr26: 31315328 is located at position 31315328 of sheep chromosome 26, and the polymorphism is T or C; The chr26: 31319977 is located at position 31319977 of sheep chromosome 26, and the polymorphism is T or G; The chr26: 31320545 is located at position 31320545 of chromosome 26 of sheep, and the polymorphism is G or A The chr26: 31317966 is located at position 31317966 of sheep chromosome 26, and the polymorphism is G or A.
2. A molecular marker, characterized in that The molecular marker comprises a nucleotide sequence as shown in any one of SEQ ID NO.1-9; As shown in SEQ ID NO.1, position 51 is a mutation site, and the polymorphism is G or A; As shown in SEQ ID NO.2, position 51 is a mutation site, and the polymorphism is A or G; As shown in SEQ ID NO.3, position 51 is a mutation site, and the polymorphism is A or G; As shown in SEQ ID NO.4, position 51 is a mutation site, and the polymorphism is C or A; As shown in SEQ ID NO.5, position 51 is a mutation site, and the polymorphism is C or T; As shown in SEQ ID NO.6, position 51 is a mutation site, and the polymorphism is T or C; As shown in SEQ ID NO.7, position 51 is a mutation site, and the polymorphism is Y or G; As shown in SEQ ID NO.8, position 51 is a mutation site, and the polymorphism is G or A; As shown in SEQ ID NO.9, position 51 is a mutation site, and the polymorphism is G or A.
3. A primer pair, characterized in that: The primer pair is used to amplify the molecular marker according to claim 1 or 2.
4. A kit, characterized in that: It comprises the molecular marker according to claim 1 or 2, or the primer pair according to claim 3.
5. Use of the molecular marker according to claim 1 or 2, or the primer pair according to claim 3, or the kit according to claim 4 in detecting the chest width trait of sheep.
6. Use of the molecular marker according to claim 1 or 2, or the primer pair according to claim 3, or the kit according to claim 4 in any of the following: (1) Predicting or detecting the chest width trait of sheep, or preparing a reagent for predicting or detecting the chest width trait of sheep; (2) Molecular marker-assisted breeding of sheep chest width traits; (3) Improvement of sheep breeds related to chest width traits; (4) Improvement of sheep germplasm resources.
7. A method for identifying the chest width trait of sheep, characterized in that: include: The sample of the sheep to be tested is tested for the polymorphism of the molecular marker as claimed in claim 1 or 2, and the chest width trait of the sheep to be tested is determined according to the genotype detection result of the molecular marker.
8. The method according to claim 7, characterized in that The detection method includes: one or more of gene sequencing, molecular probes, liquid phase capture or mass spectrometry.
9. The method according to claim 7 or 8, characterized in that: The method of judging the chest width trait of the sheep to be tested according to the genotype detection result of the molecular marker includes any one or more of the following: (1) For chr26:31137100, sheep with genotype GG have a longer chest width than sheep with AG; (2) For chr26:31137192, sheep with genotype AA have a longer chest width than sheep with GA; (3) For chr26:31137200, sheep with genotype AA have a longer chest width than those with GA; (4) For chr26:31313852, sheep with genotypes AA and AC had longer chest widths than those with CC; (5) For chr26:31314087, sheep with genotypes TT and TC had longer chest widths than those with CC; (6) For chr26:31315328, sheep with genotypes CC and CT had longer chest widths than those with TT; (7) For chr26:31319977, sheep with genotypes GG and GT had longer chest widths than those with TT; (8) For chr26:31320545, sheep with genotypes AA and AG had longer chest widths than those with GG; (9) For chr26:31317966, sheep with genotypes AA and AG had longer chest widths than those with genotypes GG.
10. A method for breeding long-chested and wide-breasted sheep breeds, characterized in that: include: During breeding, the genotype of the molecular markers as described in claim 1 or 2 is detected in the sheep population, and sheep with any one or more of the following genotypes are used for breeding: (1) For chr26:31137100, select sheep with genotype GG; (2) For chr26:31137192, select sheep with genotype AA; (3) For chr26:31137200, select sheep with genotype AA; (4) For chr26:31313852, sheep with genotypes AA and AC were selected; (5) For chr26:31314087, sheep with genotypes TT and TC were selected; (6) For chr26:31315328, sheep with genotype CC and CT were selected; (7) For chr26:31319977, select sheep with genotypes GG and GT; (8) For chr26:31320545, select sheep with genotypes AA and AG; (9) For chr26:31317966, sheep with genotypes AA and AG were selected.
Citation Information
Patent Citations
Haploid molecular marker related to breast width of down producing goat and application of haplotype molecular marker
CN118441073A
SNP (Single Nucleotide Polymorphism) molecular marker related to sheep chest breadth character, primer group, kit and application of SNP molecular marker
CN118726614A
Cited By
SNP (Single Nucleotide Polymorphism) molecular marker and marker combination of genes related to chest circumference traits of saffok sheep and application of SNP molecular marker
CN120400372A