A molecular marker related to sheep chest width and its application

The molecular markers related to the breast wide trait of Merino sheep were screened through GWAS analysis, which solved the problem of inefficient breeding efficiency, achieved rapid and low-cost breeding effects, and improved the breast wide trait and meat performance of Merino sheep.

CN120099191BActive Publication Date: 2025-08-29BEIJING COMPASS BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510580214.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-07
Publication Date
2025-08-29
Estimated Expiration
2045-05-07

AI Technical Summary

Technical Problem

In the prior art, there are few molecular markers of merino sheep breast wide traits, resulting in low breeding efficiency.

Method used

Through GWAS analysis, multiple molecular markers significantly related to the merino breast wide traits, including specific chromosomal sites and nucleotide sequences, were screened out, primer pairs and kits were developed to detect and predict the merino breast wide traits, and molecular marker assisted breeding was performed.

Benefits of technology

It improves the efficiency of breeding work, and can quickly and at low cost predict and cultivate long-breasted and wide-breasted traits, improving its meat performance and environmental adaptability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099191B_ABST
    Figure CN120099191B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of animal breeding technology, and in particular to a molecular marker associated with the chest width trait of sheep and its application. According to the assembly ARS-UI_Ramb_v2.0 genome version, the molecular markers include one or more of the following: chr26:31137100, chr26:31137192, chr26:31137200, chr26:31313852, chr26:31314087, chr26:31315328, chr26:31319977, chr26:31320545, and chr26:31317966. The present invention screens multiple molecular markers associated with the chest width trait of sheep. Molecular marker-assisted breeding can significantly improve the chest width trait of sheep, thereby achieving the purpose of improving their growth performance and accelerating the sheep breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of animal breeding, and in particular to a molecular marker related to the chest width trait of sheep and an application thereof. Background Art

[0002] Merino sheep are an excellent dual-purpose breed, boasting a high-density, uniformly fine wool, and occupying a prominent position in the wool market. As a high-quality sheep breed, Merino sheep not only produce fine wool but also offer excellent meat quality, making them a top choice for many breeding programs.

[0003] Chest width is an important indicator for evaluating the body shape and meat quality of Merino sheep. It is not only related to their meat performance, but also an important trait for measuring the overall body shape and physique of the sheep. A wider chest width generally means better carcass structure and meat quality performance, and a body shape with a deep chest helps Merino sheep better adapt to different ecological environments. Therefore, genetic improvement of the chest width trait is a key goal in Merino sheep breeding and has important advantages in the selection and breeding of Merino sheep. However, there are relatively few studies on molecular markers for the chest width trait in Merino sheep. Summary of the Invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a molecular marker related to the chest width trait of sheep and an application thereof.

[0005] Through GWAS analysis, the present invention screened out multiple molecular markers significantly associated with the chest width trait of Merino sheep, explored their application potential in molecular marker-assisted breeding, identified key mutation sites related to chest width, and can effectively improve the efficiency of breeding work.

[0006] In a first aspect, the present invention provides a molecular marker, according to the assembly ARS-UI_Ramb_v2.0 genome version, the molecular marker includes one or more of the following: chr26:31137100, chr26:31137192, chr26:31137200, chr26:31313852, chr26:31314087, chr26:31315328, chr26:31319977, chr26:31320545 and chr26:31317966;

[0007] The chr26: 31137100 is located at position 31137100 of sheep chromosome 26, and the polymorphism is G or A;

[0008] The chr26:31137192 is located at position 31137192 of sheep chromosome 26, and the polymorphism is A or G;

[0009] The chr26:31137200 is located at position 31137200 of sheep chromosome 26, and the polymorphism is A or G;

[0010] The chr26: 31313852 is located at position 31313852 of sheep chromosome 26, and the polymorphism is C or A;

[0011] The chr26: 31314087 is located at position 31314087 of sheep chromosome 26, and the polymorphism is C or T;

[0012] The chr26: 31315328 is located at position 31315328 of sheep chromosome 26, and the polymorphism is T or C;

[0013] The chr26: 31319977 is located at position 31319977 of sheep chromosome 26, and the polymorphism is T or G;

[0014] The chr26: 31320545 is located at position 31320545 of sheep chromosome 26, and the polymorphism is G or A;

[0015] The chr26: 31317966 is located at position 31317966 of sheep chromosome 26, and the polymorphism is G or A.

[0016] In a second aspect, the present invention provides a molecular marker comprising a nucleotide sequence as shown in any one of SEQ ID NOs. 1-9;

[0017] As shown in SEQ ID NO.1, position 51 is a mutation site, and the polymorphism is G or A;

[0018] As shown in SEQ ID NO. 2, position 51 is a mutation site, and the polymorphism is A or G;

[0019] As shown in SEQ ID NO.3, position 51 is a mutation site, and the polymorphism is A or G;

[0020] As shown in SEQ ID NO. 4, position 51 is a mutation site, and the polymorphism is C or A;

[0021] As shown in SEQ ID NO.5, position 51 is a mutation site, and the polymorphism is C or T;

[0022] As shown in SEQ ID NO.6, position 51 is a mutation site, and the polymorphism is T or C;

[0023] As shown in SEQ ID NO.7, position 51 is a mutation site, and the polymorphism is G or A;

[0024] As shown in SEQ ID NO.8, position 51 is a mutation site, and the polymorphism is T or G;

[0025] As shown in SEQ ID NO.9, position 51 is a mutation site, and the polymorphism is G or A.

[0026] In a third aspect, the present invention provides a primer pair for amplifying the aforementioned molecular marker.

[0027] In a fourth aspect, the present invention provides a kit characterized in that it includes the aforementioned molecular marker or the aforementioned primer pair.

[0028] In a fifth aspect, the present invention provides the use of the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned kit in detecting the chest width trait of sheep.

[0029] In a sixth aspect, the present invention provides the use of the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned kit in any of the following:

[0030] (1) Predicting or detecting the chest width trait of sheep, or preparing a reagent for predicting or detecting the chest width trait of sheep;

[0031] (2) Molecular marker-assisted breeding of sheep chest width traits;

[0032] (3) Improvement of sheep breeds related to chest width traits;

[0033] (4) Improvement of sheep germplasm resources.

[0034] In a seventh aspect, the present invention provides a method for identifying the chest width trait of a sheep, comprising:

[0035] The sample of the sheep to be tested is tested for the polymorphism of the aforementioned molecular markers, and the chest width trait of the sheep to be tested is determined based on the genotype test results of the molecular markers.

[0036] Furthermore, the detection method includes one or more of gene sequencing, molecular probes, liquid phase capture or mass spectrometry.

[0037] Furthermore, the chest width trait of the sheep to be tested is determined based on the genotype detection result of the molecular marker, including any one or more of the following:

[0038] (1) For chr26:31137100, sheep with genotype GG have a longer chest width than sheep with AG;

[0039] (2) For chr26:31137192, sheep with genotype AA have a longer chest width than sheep with GA;

[0040] (3) For chr26:31137200, sheep with genotype AA have a longer chest width than sheep with GA;

[0041] (4) For chr26:31313852, sheep with genotypes AA and AC had longer chest widths than those with CC;

[0042] (5) For chr26:31314087, sheep with genotypes TT and TC had longer chest widths than those with CC;

[0043] (6) For chr26:31315328, sheep with genotypes CC and CT had longer chest widths than those with TT;

[0044] (7) For chr26:31319977, sheep with genotypes GG and GT had longer chest widths than those with TT;

[0045] (8) For chr26:31320545, sheep with genotypes AA and AG have longer chest widths than sheep with genotypes GG;

[0046] (9) For chr26:31317966, sheep with genotypes AA and AG had longer chest widths than those with GG.

[0047] In an eighth aspect, the present invention provides a method for breeding a long-chested and wide-breasted sheep breed, comprising:

[0048] During breeding, the genotypes of the sheep population, such as the aforementioned molecular markers, are tested, and sheep with any one or more of the following genotypes are used for breeding:

[0049] (1) For chr26:31137100, select sheep with genotype GG;

[0050] (2) For chr26:31137192, select sheep with genotype AA;

[0051] (3) For chr26:31137200, select sheep with genotype AA;

[0052] (4) For chr26:31313852, sheep with genotypes AA and AC were selected;

[0053] (5) For chr26:31314087, sheep with genotypes TT and TC were selected;

[0054] (6) For chr26:31315328, sheep with genotype CC and CT were selected;

[0055] (7) For chr26:31319977, sheep with genotypes GG and GT were selected;

[0056] (8) For chr26:31320545, sheep with genotypes AA and AG were selected;

[0057] (9) For chr26:31317966, sheep with genotypes AA and AG were selected.

[0058] The present invention has the following beneficial effects:

[0059] The present invention screens multiple single-nucleotide polymorphisms (SNPs) associated with Merino sheep chest width through genome-wide association analysis. By detecting the polymorphism of these SNPs, chest width in Merino sheep can be quickly, cost-effectively, and effectively predicted. The SNPs provided by the present invention can be used to breed Merino sheep with longer chest width, improving their meat performance and environmental adaptability, which is of great significance in the field of Merino sheep breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction is given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0061] Figure 1 This is the technical route for screening SNPs related to the chest width trait of Merino sheep provided in Example 1 of the present invention.

[0062] Figure 2 This is the SNP density map provided in Example 1 of the present invention.

[0063] Figure 3 This is the SNP distribution map provided in Example 1 of the present invention.

[0064] Figure 4 This is the chest width phenotypic distribution diagram provided in Example 1 of the present invention.

[0065] Figure 5 This is the Manhattan plot of the genome-wide association analysis of Merino sheep chest width provided in Example 1 of the present invention.

[0066] Figure 6 This is the QQ plot result of Merino sheep chest width provided in Example 1 of the present invention.

[0067] Figure 7 This is the GO function enrichment map of the Merino sheep chest width significant SNPs candidate genes provided in Example 1 of the present invention. DETAILED DESCRIPTION

[0068] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0069] Unless otherwise specified, the experimental methods involved in the following examples are all conventional methods in the art. For example, reference can be made to experimental manuals in the art, or the conditions recommended by the manufacturer's instructions.

[0070] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0071] Example 1

[0072] The present invention uses the following method to mine molecular markers related to Merino sheep chest width, such as Figure 1 As shown, the process includes the following:

[0073] 1. Materials and Methods

[0074] 1.1 Experimental animals and sample collection

[0075] The 302 Merino sheep in the present invention were from a Xinjiang Merino sheep farm. The first batch included 232 sheep (26 rams and 206 ewes), and the second batch included 70 sheep (70 rams). Blood samples were collected from the groups, and chest width data were recorded.

[0076] 1.2 Whole-genome resequencing

[0077] Genomic DNA is extracted using a magnetic bead method according to standard extraction procedures. The extracted DNA is tested for integrity and purity. Qualified genomic DNA samples are then selected for fragments of appropriate size using gel electrophoresis and enriched by PCR to construct libraries. After library construction, quantitative quality control is performed using Qubit, and qualified libraries are sequenced. Following sequencing, base sequencing quality and base content distribution analyses are performed, and the raw image data (raw reads) files generated by high-throughput sequencing are filtered.

[0078] The final sequence obtained was re-aligned to the reference genome for subsequent analysis. The reference genome species was sheep, and the genome version was assembly ARS-UI_Ramb_v2.0.

[0079] 1.3 Quality Control of Genomic Data

[0080] To obtain reliable GWAS results, PLINK1.9 software was used to perform quality control on the genotype data. The quality control conditions were as follows:

[0081] (1) Retain the SNP sites on the autosomes,

[0082] (2) Eliminate sites with a deletion rate greater than 10%,

[0083] (3) Eliminate sites with minor allele frequencies less than 0.05,

[0084] (4) Eliminate the samples that do not meet the Hardy-Weinberg test P value less than 10 -6 's location.

[0085] After screening, a total of 22,751,147 SNP sites covering chromosomes 1-26 were finally obtained. The density map of the sites after quality control is shown in Figure 2 The changes in the number of sites on the chromosome before and after quality control are shown in Figure 3 .

[0086] 1.4 Introduction to genome-wide association analysis software

[0087] A genome-wide association study of chest width was conducted using GMAT software. Current GWAS analysis software only considers additive gene effects, ignoring non-additive effects, especially interactions, leading to incomplete analysis of complex traits. Studies also focus on cross-sectional data collected at a single point in time, neglecting longitudinal traits. GMAT software features six modules: single-trait analysis, multi-trait analysis, and longitudinal data analysis. Compared to traditional GWAS analysis software, GMAT offers a richer model and trait applicability, significantly improving statistical power and enabling the identification of significant markers associated with traits. Computationally, GMAT software is written in C++ and utilizes the Eigen and MKL libraries. It utilizes block-based reading and computation techniques to conserve memory. Furthermore, it employs techniques such as eigendecomposition, linearly transformed genomic estimates, and weighted EM and AI algorithms, resulting in extremely high computational efficiency, potentially thousands of times higher than the Fast-LMM algorithm.

[0088] 1.5 Genome-wide association analysis

[0089] After the sequencing data passed quality control, GMAT software was used to conduct an association analysis with chest width based on the LMM model to screen out SNPs with significant effects. The LMM model is as follows:

[0090]

[0091] Where y is the phenotype vector, is a fixed effect or covariate, for The correlation matrix, To test the marker effect, for The correlation matrix, is the polygenic effect, and e is the residual effect.

[0092] 1.6 Group Stratification

[0093] Population stratification refers to the difference in allele frequencies due to different ancestries, which has been proven to be a confounding factor and may lead to false positive results. Therefore, a QQ plot was drawn for the chest width index of Merino sheep to determine whether there were biased samples and population stratification in the association analysis.

[0094] 1.7 Significant SNPs Gene Annotation

[0095] After obtaining the significant SNPs markers from the genome-wide association analysis, we downloaded the reference genome information of the corresponding species from the ENSEMBL website and used ANNOVAR software to annotate the genes near the significant SNPs. We then used the clusterProfiler package to perform gene function enrichment analysis on the annotated candidate genes according to the GO database.

[0096] 2. Results and Analysis

[0097] 2.1 Sequencing data quality control and comparison with reference genome

[0098] Table 1 shows the quality control data for sample sequencing. Base type distribution testing, primarily used to check for AT and CG separation, indicates that the average percentage of G and C in the samples was 43.82% of the total bases. Bases with a quality value of 20 or greater accounted for 98.11% of the total bases, and bases with a quality value of 30 or greater accounted for 94.05% of the total bases. The average efficiency of alignment between sample DNA and genomic DNA was 99.89%, indicating that library construction and sequencing of this population of samples were normal.

[0099] Table 1 Quality control statistics of sample sequencing data

[0100]

[0101] 2.2 Statistics of different chest width traits of Merino sheep

[0102] The present invention collects statistics on the maximum, minimum, average, standard deviation and coefficient of variation of the chest width of 302 Merino sheep. As shown in Table 2, the maximum, minimum and average chest width are 19 cm, 31 cm and 24.65 cm respectively; the average chest width of 302 sheep is 24.65 cm. Figure 4 shown.

[0103] Table 2 Statistics of Merino sheep chest width

[0104]

[0105] 2.3 Genome-wide association analysis of Merino sheep chest width traits

[0106] Based on resequencing, 22,751,147 SNPs were screened for further analysis. Using the common GWAS model LMM statistical analysis, 361 SNPs were found to be significantly associated with Merino sheep chest width. The Manhattan plot of the genome-wide association analysis is shown in the figure below. Figure 5 As shown, the QQ graph results are as follows Figure 6 As shown. NCBI and Ensembl sequence alignments resulted in 33 annotations to genes. Literature review and multiple comparisons revealed that chr26:31137100, chr26:31137192, chr26:31137200, chr26:31313852, chr26:31314087, chr26:31315328, chr26:31319977, chr26:31320545, and chr26:31317966 were annotated to the KCNU1 gene. Detailed information on these nine loci is provided in Table 3.

[0107] Table 3 Information on the significantly associated SNPs in Merino sheep

[0108]

[0109] 2.4 Merino sheep chest width-related candidate genes and GO functional annotation

[0110] Gene function enrichment analysis was performed based on the GO and KEGG databases, and the functional annotation results (see Figure 7), anchored by nine significant loci associated with chest width: chr26:31137100, chr26:31137192, chr26:31137200, chr26:31313852, chr26:31314087, chr26:31315328, chr26:31319977, chr26:31320545, and chr26:31317966, all of which are annotated to the potassium calcium activated channel subfamily U member 1 (KCNU1) gene. KCNU1 is located on sheep chromosome 26 and is a member of the potassium channel protein family. This gene encodes a potassium ion channel protein. Studies have shown that this gene is significantly correlated with chest size.

[0111] Genetic mutations in KCNU1 may affect potassium channel function, leading to altered potassium channel activity, which may interfere with normal development and ultimately affect the individual's chest width. Sequence information for the 50 bp before and after the site (including the site, a total of 101 bp) was extracted, as shown below:

[0112] CHR26:31137100 (SEQ ID NO.1):TCCTTTAAGCTTTGTGAAAGGGAAGGATTGATAGAGAATCAAGGGTGTTGCTATTCGAGAAATTGATAGCCAAATTTTTCTCCCCCTAGAAGTGGTCTCT.

[0113] CHR26:31137192 (SEQ ID NO. 2): GTGGTCTCTCTCCTTGGAACTGCCGTAAAGCTCTCTGCGCTTTGGTCTCATCTCCCCAGCACTTTATCATTTTCTACTTGGTGTCAGGCTCCTCTGTGTC.

[0114] CHR26:31137200 (SEQ ID NO.3): TTCTCCTTGGAACTGCCGTAAAGCTCTCTGCGCTTTGGTCTCATCTCCCCAGCACTTTATCATTTTCTACTTGGTGTCAGGCTCCTCTGTGTCCATGCCTT.

[0115] CHR26:31313852 (SEQ ID NO.4): CAAACCAGAGAAGGCAGAAAAGGCAGGGGAAGAATAAATGCAGAAAATAGAAAACAATTATAAAACATAGTAGACAATCTGATTGATCAATAATCACTTTT.

[0116] CHR26:31314087 (SEQ ID NO.5): CCATAGACAAAAGAGCCCAGTGGGCTACAGTCGATGGGGTTGCAAAGAGATAGACATGACTGAGCAACTGAACCCAGCACACAAATAAAATAACTGAAAGA.

[0117] CHR26:31315328 (SEQ ID NO. 6): GATAACTGGTAAGGACCTCCTACGGAGAAGGCAATGGCACCCCACTCCAGCACTCTTGCCTGGAAAATCCCATGGATGGAGGAGCCTGGTGGGCTGCAGTC.

[0118] CHR26:31317966 (SEQ ID NO. 7): TCTTAAATTTTGTCTGTTTCTAAGAAGTCAGCGTGAAAAAGCTACATATTATATGATTCAAATTATATGACATTCTGGAAAAGGCCAGACTATAATGACAG.

[0119] CHR26:31319977 (SEQ ID NO. 8): GGTTCATCCCTCTGAAAAAAACCATTCAGCCCTTCCCACATCCTCTGAAATCACTAATATACTTTCTGTCTTTATGGATTTCCCCATTCTGAACATGTTGT.

[0120] CHR26:31320545 (SEQ ID NO.9): ATGTACCCAGGAGTAGGATTGTTAGGTTATGTGATAACTTGATGCATAGCGTTTTGAAGAGCTGCCAAATTATTTTGCAATGCTGATACACCGTTGGTGAT.

[0121] Example 2

[0122] The present invention verifies the association between the multiple SNP molecular markers obtained in Example 1 and the chest width trait of sheep, and the process is as follows:

[0123] 1. Materials and Methods

[0124] 1.1 Experimental animals and sample collection

[0125] The validation study involved 201 Merino sheep from a Xinjiang Merino farm. The first cohort consisted of 32 ewes, while the second cohort consisted of 169 rams and 148 ewes. Blood samples were collected from these sheep, and chest width data were recorded. Genotyping was performed using liquid phase capture technology to verify the presence of the nine SNPs associated with chest width in Merino sheep.

[0126] 1.2 Association analysis between significant loci and traits and multiple comparisons

[0127] The association test between marker genotype and phenotype was performed using R4.2 software. The model is as follows:

[0128]

[0129] y is the phenotype vector, is a fixed effect or covariate (gender, measurement day), X is The correlation matrix, is the marker effect to be tested, Z is The correlation matrix, The LSD method was used to perform multiple comparisons between different genotypes.

[0130] 2. Association analysis between significant loci and traits and multiple comparison results

[0131] For the 9 SNP markers related to the chest width trait of Merino sheep obtained above, the association test between marker genotype and phenotype and the LSD method were used to perform multiple comparisons between different genotypes. The results showed that: the 9 loci all have two or three genotypes in the Merino sheep population (for example, the site chr26:31137100 has three genotypes of AG, and GG; the site chr26:31313852 has three genotypes of AA, AC and CC), and the average chest width of different genotypes also has different differences.

[0132] The results are shown in the following table (P verification shows that there are significant differences):

[0133] (1) For chr26:31137100, sheep with genotype GG have a longer chest width than sheep with AG;

[0134] (2) For chr26:31137192, sheep with genotype AA have a longer chest width than sheep with GA;

[0135] (3) For chr26:31137200, sheep with genotype AA have a longer chest width than sheep with GA;

[0136] (4) For chr26:31313852, sheep with genotypes AA and AC had longer chest widths than those with CC;

[0137] (5) For chr26:31314087, sheep with genotypes TT and TC had longer chest widths than those with CC;

[0138] (6) For chr26:31315328, sheep with genotypes CC and CT had longer chest widths than those with TT;

[0139] (7) For chr26:31319977, sheep with genotypes GG and GT had longer chest widths than those with TT;

[0140] (8) For chr26:31320545, sheep with genotypes AA and AG have longer chest widths than sheep with genotypes GG;

[0141] (9) For chr26:31317966, sheep with genotypes AA and AG had longer chest widths than those with GG.

[0142] Table 4 Correlation test between Merino sheep SNPs and chest width

[0143]

[0144] Note: There is no significant difference between the data with the same lowercase letters in the numbers of the same trait, and there is a significant difference between the data with different lowercase letters.

[0145] The present invention used 302 Merino sheep as experimental subjects for genome-wide association analysis. Chest width data was recorded, blood samples were collected from this population, genomic DNA was extracted, and the DNA concentration, integrity, and purity were tested. Qualified samples were resequenced, and then genome-wide association analysis was performed on Merino chest width, screening for candidate genes and SNPs. Genotyping of 201 Merino sheep using liquid phase capture technology was performed, and the nine chest width-related loci identified in the genome-wide association analysis were verified, providing support for the future selection and breeding of new high-quality Merino sheep.

[0146] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A molecular marker, characterized in that The molecular marker has a nucleotide sequence as shown in any one of SEQ ID NO. 1-9; As shown in SEQ ID NO.1, position 51 is a mutation site, and the polymorphism is G or A; As shown in SEQ ID NO. 2, position 51 is a mutation site, and the polymorphism is A or G; As shown in SEQ ID NO.3, position 51 is a mutation site, and the polymorphism is A or G; As shown in SEQ ID NO. 4, position 51 is a mutation site, and the polymorphism is C or A; As shown in SEQ ID NO.5, position 51 is a mutation site, and the polymorphism is C or T; As shown in SEQ ID NO.6, position 51 is a mutation site, and the polymorphism is T or C; As shown in SEQ ID NO.7, position 51 is a mutation site, and the polymorphism is G or A; As shown in SEQ ID NO.8, position 51 is a mutation site, and the polymorphism is T or G; As shown in SEQ ID NO.9, position 51 is a mutation site, and the polymorphism is G or A.

2. A kit, characterized in that Comprising the molecular marker according to claim 1.

3. Use of the molecular marker or the kit according to claim 2 in detecting the chest width trait of Merino sheep; The molecular marker is one of the following: (1) According to the assembly ARS-UI_Ramb_v2.0 genome version, including one or more of the following: chr26:31137100, chr26:31137192, chr26:31137200, chr26:31313852, chr26:31314087, chr26:31315328, chr26:31319977, chr26:31320545 and chr26:31317966; The chr26: 31137100 is located at position 31137100 of sheep chromosome 26, and the polymorphism is G or A; The chr26:31137192 is located at position 31137192 of sheep chromosome 26, and the polymorphism is A or G; The chr26:31137200 is located at position 31137200 of sheep chromosome 26, and the polymorphism is A or G; The chr26: 31313852 is located at position 31313852 of sheep chromosome 26, and the polymorphism is C or A; The chr26: 31314087 is located at position 31314087 of sheep chromosome 26, and the polymorphism is C or T; The chr26: 31315328 is located at position 31315328 of sheep chromosome 26, and the polymorphism is T or C; The chr26: 31319977 is located at position 31319977 of sheep chromosome 26, and the polymorphism is T or G; The chr26: 31320545 is located at position 31320545 of sheep chromosome 26, and the polymorphism is G or A; The chr26: 31317966 is located at position 31317966 of sheep chromosome 26, and the polymorphism is G or A; (2) The molecular marker according to claim 1.

4. Use of the molecular marker or the kit according to claim 2 in any of the following: (1) Predicting or detecting the chest width trait of Merino sheep, or preparing a reagent for predicting or detecting the chest width trait of Merino sheep; (2) Molecular marker-assisted breeding of Merino sheep chest width traits; (3) Merino sheep breed improvement related to chest width traits; (4) Improvement of Merino sheep germplasm resources; The molecular marker is one of the following: (1) According to the assembly ARS-UI_Ramb_v2.0 genome version, including one or more of the following: chr26:31137100, chr26:31137192, chr26:31137200, chr26:31313852, chr26:31314087, chr26:31315328, chr26:31319977, chr26:31320545 and chr26:31317966; The chr26: 31137100 is located at position 31137100 of sheep chromosome 26, and the polymorphism is G or A; The chr26:31137192 is located at position 31137192 of sheep chromosome 26, and the polymorphism is A or G; The chr26:31137200 is located at position 31137200 of sheep chromosome 26, and the polymorphism is A or G; The chr26: 31313852 is located at position 31313852 of sheep chromosome 26, and the polymorphism is C or A; The chr26: 31314087 is located at position 31314087 of sheep chromosome 26, and the polymorphism is C or T; The chr26: 31315328 is located at position 31315328 of sheep chromosome 26, and the polymorphism is T or C; The chr26: 31319977 is located at position 31319977 of sheep chromosome 26, and the polymorphism is T or G; The chr26: 31320545 is located at position 31320545 of sheep chromosome 26, and the polymorphism is G or A; The chr26: 31317966 is located at position 31317966 of sheep chromosome 26, and the polymorphism is G or A; (2) The molecular marker according to claim 1.

5. A method for identifying the chest width trait of Merino sheep, characterized in that: include: detecting polymorphism of molecular markers in a sample of a Merino sheep to be tested, and determining the chest width trait of the Merino sheep to be tested according to the genotype detection result of the molecular markers; The molecular marker is one of the following: (1) According to the assembly ARS-UI_Ramb_v2.0 genome version, including one or more of the following: chr26:31137100, chr26:31137192, chr26:31137200, chr26:31313852, chr26:31314087, chr26:31315328, chr26:31319977, chr26:31320545 and chr26:31317966; The chr26: 31137100 is located at position 31137100 of sheep chromosome 26, and the polymorphism is G or A; The chr26:31137192 is located at position 31137192 of sheep chromosome 26, and the polymorphism is A or G; The chr26:31137200 is located at position 31137200 of sheep chromosome 26, and the polymorphism is A or G; The chr26: 31313852 is located at position 31313852 of sheep chromosome 26, and the polymorphism is C or A; The chr26: 31314087 is located at position 31314087 of sheep chromosome 26, and the polymorphism is C or T; The chr26: 31315328 is located at position 31315328 of sheep chromosome 26, and the polymorphism is T or C; The chr26: 31319977 is located at position 31319977 of sheep chromosome 26, and the polymorphism is T or G; The chr26: 31320545 is located at position 31320545 of sheep chromosome 26, and the polymorphism is G or A; The chr26: 31317966 is located at position 31317966 of sheep chromosome 26, and the polymorphism is G or A; (2) The molecular marker according to claim 1; The chest width trait of the Merino sheep to be tested is determined based on the genotype detection result of the molecular marker, and includes any one or more of the following: (1) For chr26:31137100, sheep with genotype GG have a longer chest width than sheep with AG; (2) For chr26:31137192, sheep with genotype AA have a longer chest width than sheep with GA; (3) For chr26:31137200, sheep with genotype AA have a longer chest width than sheep with GA; (4) For chr26:31313852, sheep with genotypes AA and AC had longer chest widths than those with CC; (5) For chr26:31314087, sheep with genotypes TT and TC had longer chest widths than those with CC; (6) For chr26:31315328, sheep with genotypes CC and CT had longer chest widths than those with TT; (7) For chr26:31319977, sheep with genotypes GG and GT had longer chest widths than those with TT; (8) For chr26:31320545, sheep with genotypes AA and AG have longer chest widths than sheep with genotypes GG; (9) For chr26:31317966, sheep with genotypes AA and AG had longer chest widths than those with GG.

6. The method according to claim 5, characterized in that The detection method includes: one or more of gene sequencing, molecular probes, liquid phase capture or mass spectrometry.

Citation Information

Patent Citations

  • Haploid molecular marker related to breast width of down producing goat and application of haplotype molecular marker

    CN118441073A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to sheep chest breadth character, primer group, kit and application of SNP molecular marker

    CN118726614A