SNP molecular marker for identifying thousand seed weight of wheat and application of SNP molecular marker

By developing the combination of SNP molecular markers and KASP primers at the polymorphic site at the 633763697 bp of the wheat 4B chromosome, the problem of wheat 1000 grain weight identification was solved, and rapid and accurate identification and efficient breeding selection were achieved, which promoted the increase in wheat yield.

CN120099204APending Publication Date: 2025-06-06INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510111541.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-01-23
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The prior art is difficult to effectively identify and increase the weight of wheat 1000 grains, which affects the yield and quality of wheat.

Method used

SNP molecular markers were developed at the polymorphic site (G/A) at 633763697 bp of wheat 4B chromosome 633763697 bp and KASP primer combinations were designed to achieve rapid and accurate identification of wheat 100 grain weights.

Benefits of technology

This method can accurately identify the weight of wheat 1000 grains, improve breeding selection efficiency, shorten breeding cycles, and help cultivate high-yield wheat varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, and discloses an SNP molecular marker for identifying the thousand seed weight of wheat and application thereof. The SNP locus provided by the invention is located at the 633763697 bp position of a wheat 4B chromosome, and the polymorphism is G / A. According to the invention, an SNP locus related to the thousand seed weight of a plant is obtained through phenotypic difference analysis of the thousand seed weight and exon capture analysis, and a corresponding KASP primer combination is designed aiming at the SNP locus. The KASP primer combination provided by the invention can accurately and quickly identify the thousand seed weight of wheat, and has important significance in high-yield breeding of plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to a SNP molecular marker for identifying wheat thousand-grain weight and an application thereof. Background Art

[0002] wheat( Triticum aestivum L.) is one of the most important food crops with a wide planting area and high yield. Thousand-grain weight determines the yield per mu of wheat and is an important trait affecting yield.

[0003] KASP (Kompetitive Allele Specific PCR) is a molecular marker developed based on SNP loci. It has the characteristics of high stability, accuracy and low cost. It has been widely used in high-throughput SNP typing, especially when the sample size is large and the number of SNP loci is small. The application of KASP is more significant.

[0004] wheat( Triticum aestivum L.) is one of the most important food crops in the world and the second largest staple food crop in my country after rice. It is estimated that by 2050, the world population will exceed 9 billion, and the global demand for wheat will increase by 60% compared with 2010, which requires an average annual increase of 2.4% in wheat production, much higher than the current increase of 0.9%. Therefore, increasing wheat yield has become an increasingly important focus of frontier research in the field of wheat. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker for identifying wheat thousand-grain weight and application thereof.

[0006] To achieve the purpose of the present invention, in a first aspect, the present invention provides a SNP molecular marker for identifying wheat thousand-grain weight, wherein the marker contains a nucleotide sequence with a polymorphism of G / A at 633763697 bp of wheat chromosome 4B.

[0007] The above physical locations are based on the wheat genome version CS v1.1 (Chinese spring wheat version 1.1 genome data).

[0008] Furthermore, the plant with the genotype of AA at the polymorphic site contained in the marker has a higher thousand-grain weight than the plant with the genotype of GG.

[0009] In a second aspect, the present invention provides a KASP primer combination for amplifying the marker, comprising forward primer 1 (CCAAGCTCATTCCCCCAATCAAC) as shown in SEQ ID NO: 1, forward primer 2 (CCAAGCTCATTCCCCCAATCAAT) as shown in SEQ ID NO: 2, and reverse primer (GTGCAGTGCTGCTCATTTGGATC) as shown in SEQ ID NO: 3.

[0010] Furthermore, the 5′ ends of the forward primer 1 and the forward primer 2 in the KASP primer combination may also be connected to a fluorescent marker sequence, such as FAM (GAAGGTGACCAAGTTCATGCT) or HEX (GAAGGTCGGAGTCAACGGATT).

[0011] In a specific embodiment of the present invention, the KASP primer combination is as follows: 633763697-F1: 5'-GAAGGTGACCAAGTTCATGCTCCAAGCTCATTCCCCCAATCAAC-3'; (SEQ ID NO: 4) 633763697-F2: 5'-GAAGGTCGGAGTCAACGGATTCCAAGCTCATTCCCCCAATCAAT-3'; (SEQ ID NO: 5) 633763697-R: 5'-GTGCAGTGCTGCTCATTTGGATC-3' (SEQ ID NO: 3).

[0012] In a third aspect, the present invention also provides a detection reagent or a kit containing the primer combination.

[0013] In a fourth aspect, the present invention provides a method for identifying the thousand-grain weight (height, size) of a plant, comprising: using the DNA of a plant sample to be tested as a template, using the KASP primer combination or the detection reagent or kit to perform PCR amplification, and judging the thousand-grain weight of the plant sample to be tested according to the amplification result.

[0014] Preferably, based on a total system of 10 μL, the system used for PCR amplification includes: 4-6 μL of 2×KASP Mix, 0.12-0.16 μL of primer mixture, 25-35 ng of DNA template, and the remainder is water.

[0015] The primer mixture, calculated in 100 μL, includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 10-14 μL, and the remainder is water.

[0016] Preferably, the reaction program adopted for PCR amplification is: 95°C 8-12min; 95°C 15-25s, 61°C 60s, 8-12 cycles, with the annealing temperature decreasing by 0.5°C-0.7°C in each cycle; 95°C 15-25s, 55°C 35-45s, 32-36 cycles; 25°C 10-20min.

[0017] Furthermore, judging the thousand-grain weight of the plant sample to be tested according to the amplification result includes: analyzing the genotype of the polymorphic site contained in the marker in the amplification product, and the plant with the genotype of AA has a higher thousand-grain weight than the plant with the genotype of GG.

[0018] Furthermore, the plant can be selected from wheat, rice, barley or corn.

[0019] In a fifth aspect, the present invention provides any of the following applications of the marker, the marker combination, or the detection reagent or kit: (1) Used for identification, breeding and improvement of wheat thousand-grain weight; (2) Used for early prediction of wheat thousand-grain weight; (3) Used in wheat molecular marker-assisted breeding; (4) Used for screening or cultivating high-yield plants.

[0020] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: (I) The present invention obtains a SNP site of a gene through phenotypic difference analysis of thousand-grain weight and exon capture sequencing technology analysis. The SNP site is closely related to the phenotype of the plant's thousand-grain weight. By detecting the polymorphism of the SNP site, it is possible to accurately and quickly identify whether the plant has thousand-grain weight. The marker for this site has the advantages of good genetic stability, high resolution, and suitability for high-throughput detection applications.

[0021] (ii) The SNP loci and corresponding KASP primer combinations provided by the present invention can not only be used to identify the thousand-grain weight of plants, but also can be used to improve the selection efficiency of plant varieties, shorten the breeding cycle, and accelerate the field of high-yield plant breeding, which has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The exon capture sequencing technology provided in Example 1 of the present invention is obtained by analysis TraesCS4B02G340600 Gene exon SNP site map.

[0023] Figure 2 It is a statistical chart of thousand-grain weight of different genotypes at locus 633763697 of chromosome 4B provided in Example 2 of the present invention.

[0024] Figure 3 It is the typing result of the wheat genotype at the 633763697 site of chromosome 4B provided in Example 2 of the present invention; wherein GG represents 633763697-G, AA represents 633763697-A, and CK represents a no-template control, that is, ultrapure water is used instead of sample DNA.

[0025] Figure 4 It is the sequencing peak diagram of different genotypes of the 633763697 site of chromosome 4B provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0026] The present invention aims to provide a SNP site and application thereof in identifying plant thousand-grain weight.

[0027] The present invention adopts the following technical solution: The present invention provides a SNP site, wherein the SNP site is located at 633763697bp of chromosome 4B, and the polymorphism is G / A.

[0028] The present invention also provides a KASP primer combination, including: 633763697-F1, 633763697-F2 and 633763697-R; The 633763697-F1 includes the following nucleotide sequence: CCAAGCTCATTCCCCCAATCAAC; The 633763697-F2 includes the following nucleotide sequence: CCAAGCTCATTCCCCCAATCAAT; The 633763697-R includes the following nucleotide sequence: GTGCAGTGCTGCTCATTTGGATC.

[0029] Furthermore, 633763697-F1 and 633763697-F2 in the KASP primer combination can also be connected to a fluorescent marker sequence, such as FAM (GAAGGTGACCAAGTTCATGCT), or HEX (GAAGGTCGGAGTCAACGGATT).

[0030] In a specific embodiment of the present invention, 633763697-F1: 5'-GAAGGTGACCAAGTTCATGCTCCAAGCTCATTCCCCCAATCAAC-3', 633763697-F2: 5'-GAAGGTCGGAGTCAACGGATTCCAAGCTCATTCCCCCAATCAAT-3'.

[0031] The present invention further provides use of the SNP site, or the KASP primer combination, or the kit in identifying the thousand-grain weight of a plant.

[0032] The present invention further provides use of the SNP site, or the KASP primer combination, or the kit in screening or cultivating high-yield plants.

[0033] Furthermore, the plant is one or more of wheat, rice or corn.

[0034] The present invention also provides a method for identifying the thousand-grain weight of a plant, comprising: The DNA of the plant sample to be tested is used as a template, and the KASP primer combination or the kit is used for PCR amplification; the thousand-grain weight of the plant sample to be tested is determined according to the amplification result.

[0035] Further, based on a total system of 10 μL, the PCR amplification system includes: KASP Mix (2×), 4~6μL, Primer Mix, 0.12~0.16μL, DNA 25~35 ng, the balance is water; and / or, The reaction procedure of the PCR amplification includes: 95℃ 8~12min; 95℃ 15~25s, 61℃ 60s, 8~12 cycles, annealing temperature decreases 0.5~0.7℃ in each cycle; 95℃ 15~25s, 55℃ 35~45s, 32~36 cycles; 25℃ 10~20min.

[0036] Further, based on 100 μL of the total system, the Primer Mix includes: 100 μM 633763697-F1 10~14μL, 100 μM 633763697-F2 10~14μL and 100 μM 633763697-R 10~14μL, and the balance is water.

[0037] Furthermore, the plant is one or more of wheat, rice or corn.

[0038] Further, judging the thousand-grain weight of the plant sample to be tested according to the amplification result includes: According to the amplification results, the SNP site identified the plant with the genotype of AA, which had a higher thousand-grain weight than the plant with the genotype of GG.

[0039] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0040] The wheat varieties (lines) involved in the following examples were all provided by Zhang Xueyong, a researcher at the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. The wheat was sown in Xinxiang, Henan Province, harvested after physiological maturity, naturally dried and used for subsequent analysis.

[0041] It should be noted that, as a professional agricultural research institution, the applicant has long preserved relevant germplasm materials, and the relevant wheat varieties are publicly available on the market or in existing germplasm banks.

[0042] Example 1 Acquisition of SNP markers associated with plant thousand-grain weight and design of KASP primers 1. 158 exon capture sequencing In order to obtain the regulatory gene for high thousand-grain weight in wheat, the exon capture technology was first used to determine the genotypes of 158 wheat samples in combination with existing technologies, in order to make a preliminary determination on the development of wheat SNP molecular markers. The specific measurement results are shown in Table 1.

[0043] 2. Obtaining thousand-grain weight of different wheat and developing SNP molecular markers In order to obtain the regulatory genes for high thousand-grain weight in wheat, the thousand-grain weight phenotypes of the 158 wheat varieties planted above were measured based on exon sequencing, in order to preliminarily determine the differences in the thousand-grain weight phenotypes of wheat. The specific measurement results are shown in the subsequent Table 1.

[0044] Based on the 158 thousand-grain weight phenotype data obtained in step 2, combined with the exon capture sequencing analysis results, the contribution of SNP sites of important genes to thousand-grain weight was explored, and a single nucleotide polymorphism (SNP) was screened on chromosome 4B of the wheat genome. TraesCS4B02G340600 There is a SNP site in the gene exon, and the SNP variation of this site significantly increases the thousand-grain weight. The significant site affecting the thousand-grain weight of wheat was identified (4B: 633763697bp) (see some results for details) Figure 1 ), and named the site: 633763697.

[0045] Based on the above sequence differences and the KASP principle, a primer set for PCR amplification to obtain the wheat molecular marker was further developed and designed. The specific design is as follows: 633763697-F1: 5'-GAAGGTGACCAAGTTCATGCTCCAAGCTCATTCCCCCAATCAAC-3', (the 5' end "GAAGGTGACCAAGTTCATGCT" part of the sequence is the FAM tag sequence) 633763697-F2: 5'-GAAGGTCGGAGTCAACGGATTCCAAGCTCATTCCCCCAATCAAT-3', (the 5' end "GAAGGTCGGAGTCAACGGATT" part of the sequence is the HEX tag sequence) 633763697-R:5'-GTGCAGTGCTGCTCATTTGGATC-3'.

[0046] When 633763697-F1 and 633763697-R are used as a primer pair combination, it is used to amplify the sequence of the 633763697 position of chromosome 4B in the wheat molecular marker with the base G; When 633763697-F2 and 633763697-R are used as a primer pair combination, they are used to amplify the sequence with base A at position 633763697 of chromosome 4B in the wheat molecular marker.

[0047] Example 2 Application of SNP markers in identifying wheat thousand-grain weight 1. Based on the primer pair design of Example 1, the present invention detected the genotypes of 80 wheat materials (59 GG / 21 AA), and identified the correlation between the genotype and the 1000-grain weight phenotype. The specific process is summarized as follows: First, genomic DNA of each wheat variety was extracted; Then, according to the primers designed in Example 1, the above extracted DNA was used as a template to perform PCR (using Quant Studio1 fluorescent quantitative PCR instrument) detection and analysis on different wheat samples.

[0048] During specific PCR amplification, the 10 μL amplification system was designed as follows: KASP Mix (2×), 5 μL; Primer Mix, 0.14 μL; DNA, 30 ng; dH 2 O, supplemented to 10 μL; Primer Mix, per 100 μL: 633763697-F1, 100 μM, 12 μL; 633763697-F2, 100 μM, 12 μL; 633763697-R, 100 μM, 14 μL; dH 2 O, 62 μL.

[0049] The PCR reaction program reference (can be adjusted appropriately according to the amplification results) is: 95℃ for 10 min; 95℃ for 20 s, 61℃ for 60 s (10 cycles, decreasing by 0.6℃ each cycle); 95℃ for 20 s, 55℃ for 40 s, 34 cycles; 25℃ for 15 min.

[0050] 2. Use the genomic DNA of each wheat variety extracted in step 1 to perform conventional PCR and sequencing to verify the accuracy of KASP genotyping; First, specific primers were designed for amplification at 633763697 bp of wheat chromosome 4B (the reference sequence was Chinese spring wheat). The primer sequences were: C4BF: 5'-TCCTCCACTCTCTCAGCCCTC-3' C4BR: 5'- CCATCATCCTCTGATACTCACT-3' Eight wheat varieties with GG / AA genotypes according to KASP genotyping results were randomly selected, amplified using a common PCR instrument, and sequenced after electrophoresis detection to verify the reliability of the genotyping results.

[0051] During specific PCR amplification, the 25 μL amplification system was designed as follows: Bio-Gold 2×EasyTaq® PCR SuperMix for PAGE (+dye), 10 μL; Primer C4BF / C4BR, 1 μL each; DNA, 60 ng; dH 2 O, add to 25 μL.

[0052] The PCR reaction program (which can be adjusted appropriately according to the amplification results) is: 94℃ 5min; 94℃ 30s, 58℃ 30s, 72℃ 40s (35 cycles); 72℃ 10min; end at 16℃.

[0053] The specific genotypes and wheat thousand-grain weight statistics are shown in Tables 1 to 3 and Figure 1-Figure 4 shown.

[0054] Table 1 Correspondence between different wheat genotypes and their thousand-grain weight

[0055] Table 2 Correspondence between different wheat genotypes and their thousand-grain weight

[0056] Table 3 Correspondence between different wheat genotypes and their thousand-grain weight

[0057] Based on the above statistical results, it can be seen that the average thousand-grain weight of GG genotype wheat is 36.50g; the average thousand-grain weight of AA genotype wheat is 43.76g. The thousand-grain weight of AA genotype wheat is significantly higher than that of GG genotype wheat, increasing by 19.87%, with a significant difference at the p<0.01 level. That is, the thousand-grain weight of GG genotype wheat is significantly lower than that of AA genotype wheat.

[0058] In summary, by designing primers and detecting specific sites, the present invention can accurately determine the high and low traits of wheat thousand-grain weight, thereby laying the foundation for the application of molecular breeding technology. At the same time, based on this site, the present invention can provide technical and theoretical support for the breeding of new wheat varieties with different thousand-grain weights, which has important technical significance for the breeding of high-yield wheat.

[0059] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. Identification of SNP molecular markers for wheat thousand-grain weight, characterized in that: The marker contains a nucleotide sequence with a polymorphism of G / A at 633763697 bp of wheat chromosome 4B; The above physical locations are based on the wheat genome version CS v1.

1.

2. The marking according to claim 1, characterized in that Plants with the genotype of the polymorphic site contained in the marker being AA have a higher thousand-grain weight than plants with the genotype being GG.

3. A KASP primer combination for amplifying the marker according to claim 1 or 2, characterized in that: It includes a forward primer 1 as shown in SEQ ID NO: 1, a forward primer 2 as shown in SEQ ID NO: 2, and a reverse primer as shown in SEQ ID NO:

3.

4. A detection reagent or kit containing the primer combination according to claim 3.

5. A method for identifying plant thousand-grain weight, characterized in that: include: Using the DNA of the plant sample to be tested as a template, PCR amplification is performed using the KASP primer combination described in claim 3 or the detection reagent or kit described in claim 4, and the thousand-grain weight of the plant sample to be tested is determined according to the amplification result.

6. The method according to claim 5, characterized in that Based on a total system of 10 μL, the system used for PCR amplification included: 2×KASP Mix 4-6 μL, primer mixture 0.12-0.16 μL, DNA template 25-35 ng, and the remainder was water; The primer mixture, calculated as 100 μL, includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 10-14 μL, and the balance is water.

7. The method according to claim 6, characterized in that The reaction program used for PCR amplification was: 95°C for 8-12 min; 95°C for 15-25 s, 61°C for 60 s, 8-12 cycles, with the annealing temperature decreasing by 0.5°C-0.7°C in each cycle; 95°C for 15-25 s, 55°C for 35-45 s, 32-36 cycles; 25°C for 10-20 min.

8. The method according to claim 6 or 7, characterized in that: Determining the thousand-grain weight of the plant sample to be tested according to the amplification result includes: analyzing the genotype of the polymorphic site contained in the marker in the amplification product, and the plant with the genotype of AA has a higher thousand-grain weight than the plant with the genotype of GG.

9. The method according to any one of claims 5 to 8, characterized in that: The plant is selected from wheat, rice, barley or corn.

10. Any of the following uses of the marker according to claim 1 or 2, the KASP primer combination according to claim 3, or the detection reagent or kit according to claim 4: (1) Used for identification, breeding and improvement of wheat thousand-grain weight; (2) Used for early prediction of wheat thousand-grain weight; (3) Used in wheat molecular marker-assisted breeding.